ID: 929915934

View in Genome Browser
Species Human (GRCh38)
Location 2:46135642-46135664
Sequence TTCATTCTGGGCCAATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929915934_929915937 -3 Left 929915934 2:46135642-46135664 CCTGGAGATTGGCCCAGAATGAA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 929915937 2:46135662-46135684 GAAATATTATCTTTGACTCTCGG 0: 1
1: 0
2: 0
3: 26
4: 366
929915934_929915938 15 Left 929915934 2:46135642-46135664 CCTGGAGATTGGCCCAGAATGAA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929915934 Original CRISPR TTCATTCTGGGCCAATCTCC AGG (reversed) Intronic
900758465 1:4454334-4454356 CTCACGCTGGGCCACTCTCCCGG + Intergenic
903291805 1:22318730-22318752 TTCAGGCTGGGCCATTATCCCGG + Intergenic
904172630 1:28602153-28602175 CTCATCCTGGGCCAAGCTTCAGG + Intronic
904545959 1:31272553-31272575 TTCTTTCTGGGCCTGTTTCCTGG + Intronic
910726676 1:90347293-90347315 TTATTTCTGGGCCAATATTCTGG - Intergenic
912656345 1:111489409-111489431 TTCATTCTGAGGCCATCTCTCGG - Intronic
914322226 1:146576261-146576283 TTCCCTCTTGGCCAAGCTCCTGG - Intergenic
917747562 1:178025650-178025672 TTCATTGTGGACCAAACTACAGG - Intergenic
918323584 1:183388369-183388391 CTCACTCTGGGCCAATTTCAGGG + Intronic
919689611 1:200517392-200517414 TTGATTCTGTCCCAAGCTCCTGG - Intergenic
920399828 1:205669837-205669859 GTCACCCTGGGCCAACCTCCCGG + Intronic
920842945 1:209570213-209570235 TTCTTTCTGGTCCGGTCTCCAGG + Intergenic
922471097 1:225877783-225877805 TGCATTGTGGGACAATCTCAGGG + Intronic
1067303697 10:45038016-45038038 TTAAGTGTGGGCCAATATCCTGG + Intergenic
1068217833 10:54006520-54006542 TTGAGTCTGGGACAACCTCCTGG + Intronic
1068587921 10:58820984-58821006 TTCATTCTGTGACTATCTTCAGG - Intronic
1069345136 10:67460157-67460179 TTCATTCTTTGCCTATCTCCTGG - Intronic
1070248705 10:74754720-74754742 TACATTCTGGGCCTACCTTCTGG - Intergenic
1070282724 10:75061692-75061714 TGCATTCTGGGCCAAAGACCGGG - Intergenic
1070287756 10:75095914-75095936 TTCACCCTGGGCCAATTTGCAGG - Intronic
1070322287 10:75363228-75363250 TCCATCCTGGGCCTGTCTCCCGG - Intergenic
1074181654 10:111070378-111070400 TTCATTCTGGTCAAATATTCTGG + Intergenic
1074261032 10:111853415-111853437 TTCATTCTGGTCCATTTTCCTGG + Intergenic
1075710046 10:124525991-124526013 TACCTTCTGGGCCAACCCCCAGG - Intronic
1076788234 10:132762078-132762100 TGCATTCTGGGCCATTCCCCAGG - Intronic
1077452413 11:2656409-2656431 TTCACTCTGAGCCCTTCTCCTGG + Intronic
1078650361 11:13185385-13185407 TTAAATCTGGCCCAGTCTCCAGG + Intergenic
1080217582 11:29862943-29862965 TTTCTTCTGGTCCATTCTCCTGG + Intergenic
1080425201 11:32148418-32148440 AGCCTTCTGGGCCAATGTCCTGG - Intergenic
1080545956 11:33318849-33318871 TTACTTCTGGGCCAATTTCTAGG + Intronic
1081078644 11:38710186-38710208 TTGATCCTGGGCCAAGGTCCTGG - Intergenic
1085300486 11:75455607-75455629 GTCATTCTGGCCCCATCTCATGG + Intronic
1089294949 11:117461788-117461810 TTCTGTCTGCCCCAATCTCCAGG - Intronic
1089829168 11:121310229-121310251 TTCATGCTGTGACAATCTCATGG - Intergenic
1091016395 11:132054904-132054926 TTCATTCTGAGCTACACTCCAGG - Intronic
1091276408 11:134355494-134355516 TTCATGTTGGGCTGATCTCCGGG - Intronic
1091885431 12:4013732-4013754 TTCATTCTTGTCCTGTCTCCAGG - Intergenic
1093538652 12:20253717-20253739 TCCATTCTTGGCCAATTTTCAGG + Intergenic
1094548945 12:31431488-31431510 TTAACTCTGGGCTAATCTCTTGG + Intronic
1095863622 12:46947668-46947690 TTCCTCCTAGGCCTATCTCCAGG + Intergenic
1098811605 12:75101338-75101360 TTCATTCTAGGGCAATTTCATGG + Intronic
1099956779 12:89358837-89358859 TTCATTCAGGGCCACTCATCAGG - Intergenic
1101949119 12:109160749-109160771 TTGTTTCAGGCCCAATCTCCAGG - Intronic
1102329887 12:112019983-112020005 TTCCTTCTGAGCCACTCTCAAGG + Intronic
1102864858 12:116366439-116366461 TAGACTCTGGGCCATTCTCCTGG + Intergenic
1105557062 13:21457592-21457614 TTTATTCTGGGCCTACCTGCAGG + Intronic
1106023338 13:25934906-25934928 TTCATTCAGGACCCAGCTCCTGG - Intronic
1107762184 13:43691664-43691686 TTCATTCAGGGATAATCTCCTGG + Intronic
1108710765 13:53029931-53029953 TTCACTCTGGGCCTTTCTGCGGG + Intronic
1113576562 13:111399287-111399309 TTCATCCTGGCCCCATCTCTGGG + Intergenic
1113581325 13:111431748-111431770 TTCATGGGGGGCCAATCTCATGG - Intergenic
1113801320 13:113087945-113087967 TTCATTCTGGGTCCAGCTCAGGG - Intronic
1115218265 14:31033990-31034012 TTCATTCTTAGCCAATGTCCAGG - Intronic
1115330586 14:32192793-32192815 TCCTTTCTGGGCTAATCTTCTGG - Intergenic
1115457242 14:33617653-33617675 TTCATTCAGAGCAAATCTCAGGG - Intronic
1118082699 14:62380009-62380031 TTCTTTCAGTGCCAATTTCCTGG + Intergenic
1119533972 14:75385173-75385195 TTCTTTCAGGGCAAATCTGCTGG - Intergenic
1125009280 15:34852929-34852951 TGCATTCTGAGTCAAGCTCCAGG + Exonic
1127292294 15:57581481-57581503 TTCTGTCTGGGCCACTCTTCTGG + Intergenic
1128660649 15:69498663-69498685 TTCCTTCTGCTCCAATGTCCCGG - Intergenic
1128728403 15:70004761-70004783 TCCCTTCTGGGCCAGCCTCCAGG + Intergenic
1128769358 15:70270252-70270274 TTCTTTGGGGGCCAGTCTCCAGG + Intergenic
1130300348 15:82675865-82675887 TTCATTTTAGGAGAATCTCCTGG + Intronic
1135573964 16:23570610-23570632 TTCACTTTGGGTCAGTCTCCTGG - Exonic
1140011400 16:71134907-71134929 TTCCCTCTTGGCCAAGCTCCTGG + Intronic
1142112864 16:88341453-88341475 CTCATTCTGGGCCACCCTCCAGG + Intergenic
1142182401 16:88677640-88677662 TTGAGTCTTGGCCAATCCCCTGG - Intergenic
1143083232 17:4396864-4396886 ATCCTTCTGGGCCAACTTCCAGG + Intergenic
1143631153 17:8141043-8141065 TCCATTCTGGGACCATCTCCAGG - Exonic
1143835045 17:9684883-9684905 CTCATTCTGGGCCAGAGTCCGGG + Intronic
1143995902 17:11006193-11006215 TTCTTTCTGAGCCAATGTCAAGG - Intergenic
1144265842 17:13568740-13568762 TTCATTCTGGGGTAGTCTCCTGG + Intronic
1146724216 17:35144518-35144540 TCCTTTCAGGGCCCATCTCCAGG - Intergenic
1148217905 17:45843794-45843816 TGGATTCTGAGCCACTCTCCTGG - Intergenic
1148743007 17:49903408-49903430 TTCATTCTTTGCCCATATCCTGG + Intergenic
1157604085 18:48914811-48914833 TTAATTCAGGGACAATTTCCTGG - Intergenic
1157620278 18:49013232-49013254 TTCACCCTGGGTCAATTTCCTGG + Intergenic
1162914594 19:13867337-13867359 TGCAATCTAGGCCCATCTCCTGG + Intronic
1164908793 19:31988902-31988924 TTCATCCTGTGCCTCTCTCCTGG - Intergenic
927179328 2:20433336-20433358 TTGCTTCTGGGACAAGCTCCAGG + Intergenic
927453804 2:23232089-23232111 TGAACTCTGGGCCCATCTCCGGG - Intergenic
929915934 2:46135642-46135664 TTCATTCTGGGCCAATCTCCAGG - Intronic
933895652 2:86808026-86808048 CTCATTCTGCGCAAATCTCGGGG + Intronic
935791512 2:106595204-106595226 TGCATTCTGGGTGAATCTCTTGG + Intergenic
936003137 2:108854727-108854749 TTCTTTCTTGGCCTCTCTCCAGG + Intronic
936748265 2:115607842-115607864 TTGATTCTGGGCCTGTTTCCTGG - Intronic
937971217 2:127550840-127550862 TTCATCCTCGTCCACTCTCCTGG - Intronic
938138902 2:128780871-128780893 TTCATGCTGGCCCATTCACCAGG - Intergenic
939747011 2:145985748-145985770 TTCATTCTAGGCAACTCTCTGGG - Intergenic
942151543 2:173080874-173080896 TTCTTTCTGGACTCATCTCCAGG + Intronic
947955319 2:234184849-234184871 TTCATTCTGTGCTTCTCTCCTGG - Intergenic
948562911 2:238865938-238865960 TTCTTCCTGGTCCCATCTCCCGG + Intronic
1172843063 20:37913669-37913691 TTCCTTCTGGGCCTGTATCCAGG + Intronic
1173042650 20:39478796-39478818 TCCAGTCTGGGTCAAGCTCCTGG + Intergenic
1175018878 20:55823096-55823118 ATCAGTCTTGGCCAATCTCCAGG + Intergenic
1176695375 21:9971434-9971456 TTAATTCTGTGCCCATATCCCGG + Intergenic
1177479731 21:21670508-21670530 TTCATTCTGTGCCGTTCTCTAGG + Intergenic
1178494168 21:33072671-33072693 TTCATTCTTTGCCAAGCTTCAGG + Intergenic
1179309978 21:40186633-40186655 TTCACTCTGGAGCAACCTCCTGG - Intronic
1180695076 22:17746789-17746811 TTCCTTCTGGGGCGCTCTCCTGG - Intronic
1185221358 22:49630586-49630608 CTCGTTCTGGGCCCTTCTCCCGG - Intronic
953808555 3:46092759-46092781 TTCATTCTGAGCCTTGCTCCTGG + Intergenic
958270010 3:91487920-91487942 TTCATTCTGATCCAACCTCACGG + Intergenic
959533891 3:107464388-107464410 TTCTTTCTGGGCCACCTTCCAGG - Intergenic
960352856 3:116614635-116614657 TTCCTTCTGCCCCTATCTCCTGG - Intronic
960587594 3:119334516-119334538 TGCCTTCTGGGCCCATCTTCAGG + Intronic
961114439 3:124316606-124316628 TTCATTCAGGGTCAAGCTCAGGG + Intronic
962220636 3:133561839-133561861 GTGATTCTGTGCCACTCTCCAGG + Intergenic
962815817 3:138998141-138998163 TTCATTATGAGCCTATCTGCAGG + Intergenic
962847351 3:139283982-139284004 TCCAATCTGGCCCAGTCTCCTGG - Intronic
966030247 3:175337562-175337584 TTCTTTCTGGGGCTCTCTCCTGG - Intronic
966326992 3:178767893-178767915 TCCATACTGGGCCAATCTATTGG + Intronic
967933681 3:194709337-194709359 TTCATGCTGGCCCAGCCTCCAGG + Intergenic
969668329 4:8575072-8575094 ATCATGCTGGGCCACTCACCTGG - Intronic
976090550 4:81452875-81452897 TTCATTTTGGGCAAATCCCCAGG + Intronic
976267448 4:83197434-83197456 TTAATGCTGGGAAAATCTCCAGG + Intergenic
977090293 4:92665595-92665617 TTCTTTCAGGGCCAATCTAGTGG + Intronic
980368005 4:131831681-131831703 TTAATTCTGTGCCCATATCCCGG + Intergenic
980841833 4:138271485-138271507 TTACTTCTGGACCAATTTCCAGG + Intergenic
981018453 4:140000508-140000530 GTCATTCTGGGCCATTTTTCTGG - Intronic
983610418 4:169638321-169638343 TTCATTCTTGACCTATTTCCTGG - Intronic
988790411 5:34602579-34602601 TGGCTTCTGGGCCCATCTCCAGG + Intergenic
989003064 5:36781516-36781538 TTCATTCTTGACTATTCTCCTGG - Intergenic
990640500 5:57778704-57778726 TACATTCTGGGCACATTTCCTGG - Intergenic
991563765 5:67983236-67983258 TCAATTCTGGGCCTATCTTCTGG + Intergenic
1001412791 5:171522644-171522666 TTCATTGTGGGGCCAGCTCCTGG + Intergenic
1002377563 5:178799116-178799138 CTCCTTCTGGGCCAGTCTCAGGG - Intergenic
1002405620 5:179027871-179027893 TTCTTCCTGGGACCATCTCCTGG + Intronic
1003201086 6:3961036-3961058 TTCAGTCTGGGTCAGTCACCAGG + Intergenic
1005390498 6:25328150-25328172 TTTATTCTGTGCCAAGCTCTTGG + Intronic
1007374258 6:41445573-41445595 CTCCTTCTGGGCCCATCACCTGG - Intergenic
1009173182 6:60426377-60426399 TTCATTCTGATCCAAACTCACGG - Intergenic
1010830857 6:80527065-80527087 TTAATTCAGGTCCAATCTCTGGG - Intergenic
1011412501 6:87080618-87080640 TTCAACCTGGGCAAATCTCAAGG + Intergenic
1014617339 6:123619424-123619446 TTCATTATGGGCCTGCCTCCAGG + Intronic
1015870480 6:137771178-137771200 TTCATTCTGAGCCAAACACTAGG - Intergenic
1018234774 6:161713412-161713434 GTCTTTCTGGGCCAATCTGGAGG + Intronic
1018977577 6:168576958-168576980 TTCCTTCTGGGAAAATCTCCAGG - Intronic
1019408355 7:895649-895671 TTTATTGTGGGTCAATCTCGGGG - Exonic
1019585008 7:1795791-1795813 ATCACTCTGGGCCAATGTCGGGG - Intergenic
1023569231 7:41555160-41555182 TTCATTCTGGTGCTATTTCCTGG + Intergenic
1026356786 7:69564705-69564727 TTCATTCTGGGCCAAGCAGCAGG - Intergenic
1026543202 7:71298888-71298910 TACTTTCTGGCCCAATGTCCCGG - Intronic
1026953747 7:74364146-74364168 TGGATTCTGGGCCATTCTCATGG + Intronic
1032563661 7:132918080-132918102 TTCATTCTGTGACAACCCCCAGG + Intronic
1035181457 7:157092289-157092311 TTCCCTTTGGGCCAATCTTCTGG - Intergenic
1037663218 8:20944499-20944521 TCCAATCTGGGCCACTGTCCTGG + Intergenic
1043014769 8:74923981-74924003 TTCATTCTGGGACAAATGCCTGG - Intergenic
1043684336 8:83068021-83068043 TTCATTCTGGGCATATTTGCTGG - Intergenic
1046243554 8:111530146-111530168 CTCATTCTGGGCTAACATCCAGG - Intergenic
1047336777 8:123943596-123943618 TTCCTGCTGGGCCGACCTCCTGG + Intronic
1048045048 8:130765216-130765238 TTCATTATGGGCTAAGCACCGGG + Intergenic
1048506556 8:135027071-135027093 ATCCTACTGGGCTAATCTCCTGG + Intergenic
1049198734 8:141329611-141329633 TTCCTTCCGGGCCCATCGCCTGG - Intergenic
1049968836 9:803464-803486 TCTATTCCGGGCCACTCTCCTGG + Intergenic
1053632356 9:39957386-39957408 TTAATTCTGTGCCCATATCCCGG + Intergenic
1053773404 9:41506145-41506167 TTAATTCTGTGCCCATATCCCGG - Intergenic
1054211532 9:62293311-62293333 TTAATTCTGTGCCCATATCCCGG - Intergenic
1054313452 9:63555535-63555557 TTAATTCTGTGCCCATATCCCGG + Intergenic
1054878810 9:70123834-70123856 TTTGTTCTGGGCCTCTCTCCCGG - Intronic
1056126522 9:83539982-83540004 TTCATTCTTGGCCCAGCTACTGG + Intergenic
1059932420 9:119274127-119274149 TTTATTCTGAGTCATTCTCCAGG + Intronic
1060314776 9:122499346-122499368 TTCATGCCAGGCAAATCTCCAGG - Intergenic
1186207886 X:7219136-7219158 TTCAGTCTGGGTCAATGACCAGG - Intergenic
1187413975 X:19076207-19076229 AACATTCTGTGCCAATTTCCAGG - Intronic
1187514434 X:19954492-19954514 TCTGTTCTGGGACAATCTCCTGG + Intronic
1188538613 X:31224635-31224657 TTTATTCTGTGCAAATATCCAGG - Intronic
1201567003 Y:15375751-15375773 GTCTTTCTTGGCCAATCACCAGG - Intergenic