ID: 929915935

View in Genome Browser
Species Human (GRCh38)
Location 2:46135654-46135676
Sequence CAAAGATAATATTTCATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 471}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929915935_929915938 3 Left 929915935 2:46135654-46135676 CCCAGAATGAAATATTATCTTTG 0: 1
1: 0
2: 2
3: 42
4: 471
Right 929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG 0: 1
1: 0
2: 0
3: 5
4: 54
929915935_929915940 29 Left 929915935 2:46135654-46135676 CCCAGAATGAAATATTATCTTTG 0: 1
1: 0
2: 2
3: 42
4: 471
Right 929915940 2:46135706-46135728 ACTTGAAAAAAATTTACCTTGGG 0: 1
1: 1
2: 2
3: 64
4: 594
929915935_929915939 28 Left 929915935 2:46135654-46135676 CCCAGAATGAAATATTATCTTTG 0: 1
1: 0
2: 2
3: 42
4: 471
Right 929915939 2:46135705-46135727 AACTTGAAAAAAATTTACCTTGG 0: 1
1: 0
2: 6
3: 117
4: 1315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929915935 Original CRISPR CAAAGATAATATTTCATTCT GGG (reversed) Intronic
901314182 1:8294586-8294608 CGAAGATGAGATCTCATTCTAGG + Intergenic
904461498 1:30683331-30683353 AAAAGAAAGTATTTCATTGTGGG - Intergenic
905808643 1:40895672-40895694 GAAAAATAAAATTTCTTTCTTGG - Intergenic
906260383 1:44383309-44383331 AAAAGAGAATATTTCATCCAGGG - Intergenic
907141779 1:52192847-52192869 CAGAAATAATGTTTCATTATGGG - Intronic
907780216 1:57559836-57559858 CAAAAATAATATCGCATCCTTGG + Intronic
907783273 1:57586865-57586887 CAAGGATTTTATCTCATTCTGGG + Intronic
907903957 1:58767176-58767198 CCAAAATAATATTTAATTCATGG - Intergenic
908257502 1:62315056-62315078 CACAGATAATATTTCAAAGTAGG - Intronic
908379151 1:63578237-63578259 CAAAGATACAATAACATTCTAGG - Intronic
908402119 1:63781204-63781226 CAAAGTTAATACTTTATTCCTGG - Intronic
908640916 1:66222355-66222377 TAATGACAATATTTAATTCTTGG + Intronic
908700950 1:66899298-66899320 TAAAGTGAATATTTCATTGTGGG + Intronic
909021593 1:70437276-70437298 AAAAGATAATAGTTCATAGTAGG - Intronic
909044386 1:70691194-70691216 TAAAGGTAATGTTTCATTGTGGG - Intergenic
909744134 1:79072331-79072353 CAAAGACAATATTCCAACCTGGG - Intergenic
909777068 1:79494566-79494588 TAAAGATAATGTTTCCCTCTAGG + Intergenic
909786297 1:79618023-79618045 TAAAGATAATATGTCTTTCATGG + Intergenic
909840294 1:80312668-80312690 TAAAGATAATGTCTCATTCTCGG + Intergenic
909862695 1:80629171-80629193 TAAAGATAATATTTTCTTCCAGG - Intergenic
910328684 1:86042409-86042431 TAAACATAACATTTCATTTTGGG + Intronic
910352835 1:86319195-86319217 CAAAGAGAATTTGGCATTCTGGG + Intergenic
910683820 1:89895633-89895655 CATATATAATATTTCATTTTAGG + Intronic
910855594 1:91692053-91692075 GAAAGATAATAATTAATTCTAGG + Intronic
911035870 1:93546801-93546823 TGAAGTTAATATTTAATTCTGGG + Intronic
911127334 1:94352789-94352811 TAAAGATAATGTTTGCTTCTGGG + Intergenic
911301174 1:96176262-96176284 CAAAGATAATATATCAACCGCGG - Intergenic
911423776 1:97680272-97680294 CAAAGATAATATCCTATCCTGGG + Intronic
912130423 1:106592875-106592897 CACATATAATATTTCATTAAAGG + Intergenic
912731499 1:112110769-112110791 CAAAGATACTGTATCAGTCTGGG - Intergenic
913267233 1:117057100-117057122 CAAAAATAAAATATAATTCTGGG - Intergenic
913357050 1:117933382-117933404 CAAAGACAATATTACCTTTTTGG - Exonic
916307779 1:163358688-163358710 AAAAGATAACATTTCTTGCTGGG - Intergenic
918755858 1:188338787-188338809 CAAAAATAATATTGCATCCCTGG - Intergenic
918803718 1:189009925-189009947 TAAAGATAATTTATGATTCTAGG - Intergenic
918880093 1:190108109-190108131 CCAAGATAATATCACCTTCTAGG + Intronic
918899816 1:190400464-190400486 CAAAGAGAAAGTTTAATTCTAGG + Intronic
920021420 1:202958978-202959000 AAATAATACTATTTCATTCTTGG - Intergenic
920490684 1:206412443-206412465 AACAGGTAATATTTTATTCTAGG - Intronic
921517669 1:216117098-216117120 CAAAGACAAAGTGTCATTCTAGG - Intronic
921798874 1:219379283-219379305 CAAGAATAATCTTTCATCCTTGG + Intergenic
924441079 1:244086053-244086075 CGAAGATAATAATTCTGTCTTGG + Intergenic
1063505805 10:6598445-6598467 TAAAGATAGTATTTTTTTCTTGG + Intergenic
1065209790 10:23391567-23391589 CACATATTATATTTAATTCTCGG - Intergenic
1065375365 10:25034982-25035004 CCAAGATAAAATTTTATTTTAGG + Intronic
1067440428 10:46306211-46306233 CAGAGATAATTTATCATTCATGG + Intronic
1068020153 10:51571735-51571757 CAAAGATTATAGTTCATAATGGG + Intronic
1068048741 10:51920958-51920980 TAAAAATAATATTTTAATCTTGG - Intronic
1068425497 10:56856891-56856913 GAAAGAAAATATATCATTTTGGG + Intergenic
1068926385 10:62543862-62543884 CCTAGATAATATTCCAGTCTTGG - Intronic
1069048153 10:63764645-63764667 CAAAGACAGTATCACATTCTGGG - Intergenic
1069244934 10:66192276-66192298 TATAGAAAATATTTAATTCTTGG - Intronic
1069283707 10:66687826-66687848 GAAAGATAATATTTTCTTTTGGG + Intronic
1069342256 10:67425460-67425482 CAAAGAATATAGTACATTCTTGG + Intronic
1070315304 10:75304662-75304684 CATAGAAAATATTTATTTCTGGG - Intergenic
1070661310 10:78307588-78307610 CAAAGATAATGTCCCCTTCTAGG + Intergenic
1071185675 10:83041591-83041613 CAGACACAATATATCATTCTAGG + Intergenic
1071863739 10:89702727-89702749 GAAAGATAATATTACAGACTAGG + Intronic
1072856984 10:98957830-98957852 GTAATATAAGATTTCATTCTTGG + Intronic
1074479392 10:113805371-113805393 CGAAGATCATACTTCAGTCTGGG - Intergenic
1075988226 10:126807180-126807202 CAATTATGCTATTTCATTCTGGG - Intergenic
1079354632 11:19719982-19720004 CAATGAAAATGTTCCATTCTTGG - Intronic
1079872412 11:25816138-25816160 CAAAGGTGATATTTATTTCTAGG - Intergenic
1080064726 11:27998382-27998404 CAATGATAATATTTCAGTAATGG + Intergenic
1085589633 11:77747578-77747600 TAAAGTTAAAATTCCATTCTTGG + Intronic
1085771952 11:79333472-79333494 CAAAGATCACTTTCCATTCTGGG - Intronic
1086212005 11:84331987-84332009 AAAAGAAAATATTTTATTGTTGG - Intronic
1086482670 11:87259360-87259382 CACACATAAAATTTCCTTCTGGG - Intronic
1086603767 11:88668619-88668641 CAATAATAATTTTTCATTCCTGG - Intronic
1087438274 11:98150928-98150950 CAAAAATAATTTTTCCTCCTAGG - Intergenic
1087496438 11:98895727-98895749 CAAAGATGGTATATGATTCTTGG + Intergenic
1087599911 11:100300616-100300638 CAAAGATAATGTTTGATTTAAGG + Intronic
1087909576 11:103737694-103737716 CAAATGTAATATTTAATTATTGG + Intergenic
1088255905 11:107903432-107903454 AAAAGAAAATATCTCCTTCTTGG - Intronic
1088277805 11:108107214-108107236 GAAAGCTAACATTTCATTTTTGG - Exonic
1088524719 11:110740270-110740292 CAAAAATAAAATTGCATCCTGGG - Intergenic
1088620090 11:111672761-111672783 CAAAGTTAAAACATCATTCTAGG - Intronic
1089611724 11:119673025-119673047 GAAATTTAATTTTTCATTCTGGG - Intronic
1090063000 11:123479767-123479789 CAAAGATAATATGTAAATGTAGG + Intergenic
1090251696 11:125256147-125256169 CACAGAAAATATTTTATTCCAGG + Intronic
1091352590 11:134908988-134909010 CAAAGGTATTATCTCATTTTGGG - Intergenic
1092513395 12:9182578-9182600 CTAAAAGAATATTTAATTCTTGG + Intronic
1092533633 12:9366032-9366054 CAGATTTAACATTTCATTCTTGG - Intergenic
1092562941 12:9635741-9635763 CAAAATTAAGATTTTATTCTTGG + Intergenic
1093278879 12:17166101-17166123 AAAAAAAAAAATTTCATTCTAGG - Intergenic
1093644972 12:21575210-21575232 CAAAGCTGCTATTTGATTCTAGG - Intronic
1093827096 12:23706268-23706290 TAAATATAATATTTCATACCAGG - Intronic
1094784901 12:33836678-33836700 CAAACATGAGATTTCGTTCTAGG + Intergenic
1095072025 12:37864441-37864463 CAAAAGAAATATTGCATTCTGGG + Intergenic
1095847979 12:46767700-46767722 GAAAGATAATATTTCCTTATTGG + Intronic
1096316424 12:50571141-50571163 CAAAGAGAATATGTTATTATTGG + Intronic
1096448610 12:51718033-51718055 CAAAGAAAATATACCAATCTGGG + Intronic
1098337729 12:69420989-69421011 GACAAATAATATTCCATTCTAGG + Intergenic
1098805318 12:75015067-75015089 CAAAAACAATATTTCATCCCTGG + Intergenic
1099117148 12:78642085-78642107 GAAATATAATATATAATTCTGGG - Intergenic
1099520625 12:83656477-83656499 TACATATTATATTTCATTCTTGG + Intergenic
1099611888 12:84883744-84883766 CACACATAACACTTCATTCTAGG - Intronic
1099618353 12:84968629-84968651 CAAATATAAAATTTGAATCTGGG - Intergenic
1099771585 12:87065673-87065695 GAAAAATAATATTTCATTTTAGG + Intergenic
1099863844 12:88253736-88253758 CAAAAACAAGATGTCATTCTAGG + Intergenic
1099909932 12:88817543-88817565 CTAAACTAATATTTCATTTTGGG - Intergenic
1101575761 12:105994984-105995006 CACAAAGAATATTTTATTCTTGG - Intergenic
1102936017 12:116897701-116897723 CCAAGATCATATTTCCTTCCAGG + Intergenic
1104136464 12:125944259-125944281 CAAAAACCATATTTCAGTCTTGG + Intergenic
1105796805 13:23862715-23862737 CAATGATAAAATTCCTTTCTAGG - Intronic
1105901596 13:24759280-24759302 AAAAGCTAATATTACATTGTTGG + Intergenic
1106910018 13:34453674-34453696 CAAAGTTATTTCTTCATTCTGGG - Intergenic
1107253745 13:38397306-38397328 AAATGTTAATATTTCATTCCTGG - Intergenic
1108807998 13:54183720-54183742 CAAGGATAATATCACCTTCTTGG - Intergenic
1109379410 13:61540250-61540272 CCAAAATAATCTTCCATTCTTGG - Intergenic
1110039893 13:70740544-70740566 CAAAGATTAGATTTCAACCTAGG + Intergenic
1110049320 13:70874469-70874491 CAAGGGTAATTTTTCATCCTAGG + Intergenic
1110377051 13:74805461-74805483 CAAAAATAATATTGCATCCCCGG + Intergenic
1110600795 13:77370768-77370790 CAAATATGATCTTTCATTCTTGG + Intergenic
1110874130 13:80488987-80489009 TATATATAAGATTTCATTCTAGG + Intergenic
1111022159 13:82465289-82465311 AGAAGTTAATATTTCATTTTAGG + Intergenic
1111099338 13:83561687-83561709 GAAAAATAATATTTTCTTCTGGG + Intergenic
1111303787 13:86379985-86380007 CAAAAATATTATCTCATTGTTGG + Intergenic
1111342407 13:86904199-86904221 TAAAGATATTTTTTCATTATTGG - Intergenic
1111451180 13:88419411-88419433 TAGAGATAATTTCTCATTCTAGG + Intergenic
1111456845 13:88495707-88495729 CAAGGCTAAAATCTCATTCTGGG + Intergenic
1111675491 13:91382713-91382735 AAAATATAATATTTGATTCCTGG + Intergenic
1111763242 13:92493482-92493504 GAACGATAATATTTCATTTGTGG + Intronic
1112143312 13:96670731-96670753 ATAAGAAAATATTTCATTCCAGG - Intronic
1112387489 13:98953526-98953548 CAAATAGAATTTTTCATTCTAGG + Intronic
1112853749 13:103738604-103738626 CAAAGATTCTATCTCATTTTTGG + Intergenic
1113230463 13:108208330-108208352 TCAAGATAATTTTTCTTTCTTGG + Exonic
1114368785 14:22061521-22061543 CAAAGATAATATATTATTAGAGG - Intergenic
1116176407 14:41476048-41476070 CAAAGATAATACTAAATTATAGG - Intergenic
1116682579 14:47992722-47992744 CAATGATATTATTTTATTTTTGG + Intergenic
1116757950 14:48971327-48971349 CAAAGATTACATTTCATTGTGGG + Intergenic
1117622591 14:57602802-57602824 TAAGGATAATATTTTATTCAGGG - Intronic
1117709582 14:58511612-58511634 CCAAGATAATATTTCCTTCGAGG + Intronic
1117942853 14:60987526-60987548 CAATGATAACACTTCCTTCTTGG + Intronic
1118157052 14:63252629-63252651 CAAAGATAGTAGTAAATTCTAGG - Intronic
1119533132 14:75377471-75377493 CAGAGCTAATATTTGAATCTGGG - Intergenic
1120135356 14:80861292-80861314 CAAAGATAATTTTACTTTATAGG + Intronic
1120580646 14:86244492-86244514 CAAATATTTTATCTCATTCTGGG - Intergenic
1120581698 14:86258581-86258603 CAAAGATAATATTAAACTCAAGG - Intergenic
1121801767 14:96780222-96780244 AAAAGCTACTTTTTCATTCTGGG + Intergenic
1122489555 14:102104896-102104918 AAATGACAAGATTTCATTCTTGG + Intronic
1124502272 15:30239306-30239328 CAAAGACACTATTGCTTTCTAGG + Intergenic
1124741291 15:32299346-32299368 CAAAGACACTATTGCTTTCTAGG - Intergenic
1125256296 15:37767686-37767708 TAAATATAACATTTCAGTCTTGG + Intergenic
1126519750 15:49579097-49579119 ATAAGATGATATTTCATTGTGGG - Intronic
1126569802 15:50138621-50138643 CTTAGATAATAGTTCATCCTTGG - Intronic
1126636902 15:50788723-50788745 CACAGATTATAATTCATTGTGGG - Intergenic
1127575952 15:60292494-60292516 CAAAGGTATTATTTATTTCTAGG + Intergenic
1129527135 15:76226188-76226210 CAAAAAAAATATTTGATTTTAGG + Intronic
1129534113 15:76297246-76297268 CAAACATTGTATTTGATTCTGGG - Intronic
1130006447 15:80103667-80103689 CAAATAGAATAGTTCATTTTTGG - Intronic
1131020253 15:89091605-89091627 CAAAGAAATTATTTCCTGCTCGG - Intronic
1133631672 16:7627947-7627969 CAAAGAAAATATTTCAGTCCAGG + Intronic
1133945574 16:10345193-10345215 TAAAGATAAGATTTCAGTCTGGG - Intronic
1134561496 16:15213955-15213977 CAAAAATAATACTTCTTCCTGGG - Intergenic
1134922034 16:18125575-18125597 CAAAAATAATACTTCTTCCTGGG - Intergenic
1135517883 16:23150200-23150222 TAAAGAAAATATTGCATGCTTGG - Intergenic
1135995737 16:27246788-27246810 CAAGGTAAATATCTCATTCTTGG - Intronic
1137312281 16:47275232-47275254 CAAAGAAAATATATTATTCCAGG - Intronic
1139174099 16:64666436-64666458 CAAAGATTATATTTCTTTCAAGG - Intergenic
1139908681 16:70383253-70383275 GAAAGATAACATTTCAGGCTGGG + Intronic
1140141217 16:72259728-72259750 CAAAAATAATTTTTGAGTCTGGG + Intergenic
1140180004 16:72706186-72706208 CACAGATCATAGTGCATTCTGGG + Intergenic
1140316982 16:73908051-73908073 TTAAGATAAAATTTCATTTTTGG - Intergenic
1141931969 16:87211492-87211514 CAAAGAGAATTTCTCTTTCTTGG + Intronic
1144233598 17:13234333-13234355 AGAAGATAGTATTTCATTCTGGG - Intergenic
1144351346 17:14400011-14400033 TAAAAATAATATTACATTCTGGG - Intergenic
1145944818 17:28765628-28765650 CAAGGAAAATATTCTATTCTTGG - Intronic
1146023079 17:29295172-29295194 CTCTGATAATATTTCATTTTGGG + Intergenic
1146390096 17:32414062-32414084 CAAAAATAATATTTTATTGGTGG + Intergenic
1146654611 17:34627642-34627664 AAATGATAATATTTCACACTAGG + Intronic
1147472954 17:40680999-40681021 CACAGATAATAATTCAATATGGG - Intergenic
1151083831 17:71358726-71358748 AAAAGATAATATTTTATTCAGGG + Intergenic
1154173930 18:12069715-12069737 CAAATATAATATTTGTTTTTTGG - Intergenic
1155210837 18:23600172-23600194 TAAACCTCATATTTCATTCTTGG + Exonic
1155306725 18:24485612-24485634 CAATGATAAGACTACATTCTGGG + Intergenic
1155386425 18:25282715-25282737 CTAAAATAATATTTCTTTTTAGG - Intronic
1155544044 18:26896523-26896545 AAAAGTTAATATTTCACTTTGGG - Intergenic
1156330785 18:36120041-36120063 AAAAGATCAGTTTTCATTCTGGG - Intronic
1156416604 18:36899929-36899951 CAAGCATTAAATTTCATTCTTGG - Intronic
1156504241 18:37578743-37578765 CAAATTAAATATTTCCTTCTGGG + Intergenic
1156512365 18:37649200-37649222 CAATAATAATATTGCCTTCTGGG + Intergenic
1156570734 18:38250014-38250036 AAAAGACAATATTTCTTTCTTGG + Intergenic
1158306966 18:56116500-56116522 CAAAAATTATATTTCATTCTGGG + Intergenic
1159196308 18:65121130-65121152 CTCAGATTATATTTCCTTCTGGG - Intergenic
1159360370 18:67393902-67393924 TAAAGATGATATATCATTCCTGG + Intergenic
1159544527 18:69822571-69822593 AAAAGATAATGTCTCTTTCTGGG - Intronic
1160985333 19:1835998-1836020 CAAAGATGATATTTCTTCCCAGG + Intronic
1164671620 19:30075417-30075439 TAAAGACAGTATTTCATTATTGG + Intergenic
1164826921 19:31290660-31290682 CAAAGAGAAAATGGCATTCTTGG + Intronic
926408805 2:12580718-12580740 TAAAAATAATATTGCATTCCAGG + Intergenic
926746704 2:16164505-16164527 CATACATAATTTTTTATTCTGGG + Intergenic
927305146 2:21562723-21562745 CACAGATACTAGTTTATTCTAGG - Intergenic
927659054 2:24976639-24976661 CAAAGATACTATGTCCTTTTTGG + Intergenic
929157049 2:38797801-38797823 CAAAATTAAAATTTCATTTTAGG - Exonic
929915935 2:46135654-46135676 CAAAGATAATATTTCATTCTGGG - Intronic
930154072 2:48087738-48087760 CAGAGATAATCCTTCAGTCTTGG - Intergenic
930361551 2:50386736-50386758 CACAGATCACACTTCATTCTTGG - Intronic
931587589 2:63844984-63845006 CAAAGATAATATTATATCCTTGG + Intronic
932021320 2:68090364-68090386 CAAAGATAATTTACTATTCTGGG - Intronic
932543419 2:72681226-72681248 CAAAGAGAATATTCTATTTTAGG - Intronic
933034838 2:77382487-77382509 CAAACATCTTATGTCATTCTGGG + Intronic
933227974 2:79772946-79772968 CAAACATAACATTTTATTCTAGG + Intronic
937968156 2:127530256-127530278 GAAAGATAATGTTTCAATCATGG + Intergenic
938644288 2:133315354-133315376 CGAAGATAATATTTGATTTGGGG + Intronic
938752806 2:134350447-134350469 AGAAGGTAAAATTTCATTCTGGG - Intronic
938938349 2:136147135-136147157 CAAAAATAATATTGCACTCTAGG + Intergenic
939367077 2:141247413-141247435 CAAAAATAATATTTTCTTCAAGG - Intronic
939521244 2:143233345-143233367 CAAAGAGAATATATATTTCTAGG - Intronic
939982181 2:148795260-148795282 CAAAAATAATAATTCTTTCTTGG + Intergenic
941188083 2:162342590-162342612 CAAAGATAGTATTTCCTGCCAGG - Intronic
941200789 2:162506830-162506852 CTATGGTAGTATTTCATTCTAGG + Intronic
941446863 2:165611923-165611945 CAAAGATTTTATTTTATACTTGG - Intronic
941668531 2:168265655-168265677 AAAAAAGAATACTTCATTCTTGG - Intergenic
941939148 2:171014764-171014786 TAAACACAATATTTCCTTCTTGG - Intronic
942061915 2:172235139-172235161 CACAGATAATAATCCATTGTCGG + Intergenic
942226958 2:173824979-173825001 CAAAGATAATAATTCATATTTGG + Intergenic
942456042 2:176139218-176139240 CAAAGACAGTATTTCACCCTGGG + Intergenic
943883414 2:193179012-193179034 CAAAAATAATGCTGCATTCTAGG - Intergenic
944298107 2:198090944-198090966 AAAGGCTAATATTTCAGTCTTGG - Intronic
944360052 2:198843471-198843493 CAAAGCTAACTTTTCACTCTTGG + Intergenic
944448518 2:199817348-199817370 TAAAGGTAATATTTAATACTGGG - Intronic
945163267 2:206915179-206915201 TAAAGATAATGTCTCCTTCTGGG + Intergenic
945646238 2:212498604-212498626 TAATTATATTATTTCATTCTTGG + Intronic
946043347 2:216801266-216801288 CAAAAAAAATATTTTATTCAAGG - Intergenic
946933287 2:224693296-224693318 TAAAAATAACATTTCATCCTAGG + Intergenic
948341346 2:237254846-237254868 CAAAGATTACCTTTCATTCAAGG - Intergenic
1169550273 20:6695275-6695297 CAAAGATATTATCTTAGTCTGGG + Intergenic
1170100007 20:12688442-12688464 CACATAAAATATTTCATTTTGGG - Intergenic
1170410564 20:16086177-16086199 CAAAAATAAAATAACATTCTAGG + Intergenic
1170910735 20:20565006-20565028 CAAAGTTATTATTTCATCCTCGG + Intronic
1171246323 20:23612762-23612784 CAGAGATAATACTTCCTTTTGGG + Intergenic
1172570029 20:35962731-35962753 TAAAAATAACATATCATTCTGGG - Intronic
1177388855 21:20441437-20441459 CAAAGAAAATATAACTTTCTAGG - Intergenic
1177503338 21:21987826-21987848 CATAGACAATATTTTATTTTTGG - Intergenic
1177850729 21:26344908-26344930 CAAAGCTATTATTACATTGTCGG + Intergenic
1177991195 21:28038182-28038204 CAAAAATAATATTGCATCCGTGG - Intergenic
1178473396 21:32915640-32915662 CAAACATATTCTTTCATTGTTGG - Intergenic
1179142933 21:38742849-38742871 CAAATATAATAATGAATTCTAGG - Intergenic
1179332645 21:40419887-40419909 CATAGATACTTTTTTATTCTTGG + Intronic
1179768098 21:43589163-43589185 TAAAGATAATGTTTCCCTCTAGG - Intronic
1182406305 22:30135051-30135073 CAAAATCAATATTTCAATCTAGG + Intronic
950845147 3:16008145-16008167 CAAAGATAATGTCTCCCTCTAGG - Intergenic
951003494 3:17591815-17591837 CAAAAATAATATTGAATCCTTGG + Intronic
951807828 3:26665954-26665976 CAAAGATAATAAATCATTCAAGG + Intronic
951851488 3:27146006-27146028 GAGAAATAATATTTCATTATGGG - Intronic
951922371 3:27870542-27870564 CAAAGAGAATCTTTCATCTTTGG + Intergenic
952111798 3:30132676-30132698 CAGAGATATTAACTCATTCTAGG - Intergenic
952204398 3:31165516-31165538 GAAAGAAAACACTTCATTCTAGG + Intergenic
952207308 3:31192743-31192765 CAAAGATGATTTTTCAGGCTTGG + Intergenic
953744537 3:45564244-45564266 GAAAGATGATAGTTCTTTCTGGG - Intronic
953774987 3:45808988-45809010 CAATGATAACACGTCATTCTGGG - Intergenic
953897517 3:46813515-46813537 CAAAAATAATATTGCATCCCGGG - Intergenic
954566501 3:51604536-51604558 TAAAGATAAGATTTGATTCCAGG - Intronic
956800464 3:72753377-72753399 CAAAGATGGTATTTTAATCTGGG + Intronic
957417368 3:79923308-79923330 CTAAGATAATATTTCATATTAGG - Intergenic
957719538 3:83976115-83976137 TAAAGATAATGTTTCATAATAGG + Intergenic
957855662 3:85873839-85873861 TAAAGATAATATTTTATTTGTGG + Intronic
958459786 3:94380095-94380117 AAAAGTTGATAATTCATTCTTGG - Intergenic
959093811 3:101932238-101932260 CAAAGGTAATATTTTTCTCTTGG + Intergenic
959120226 3:102223531-102223553 CATAGATAATATTTAAAACTTGG + Intronic
959467656 3:106709078-106709100 TAAAGTTAATATTTGATTATTGG - Intergenic
960058250 3:113292080-113292102 GAAACAGAAGATTTCATTCTGGG - Intronic
960188311 3:114671722-114671744 CTAAGATATCTTTTCATTCTTGG - Intronic
960226329 3:115173747-115173769 CAAAGATAATATATTAGTATTGG + Intergenic
961549155 3:127657666-127657688 CAAGCATAATATTTCATTATTGG - Intronic
961920023 3:130415803-130415825 CATATATATTATTTCATTTTTGG + Intronic
961920526 3:130420728-130420750 CAAAGATAGTATCTCATTGCAGG + Intronic
963373260 3:144429466-144429488 CAAACATAATATTTATTTATTGG + Intergenic
963958120 3:151278067-151278089 AAATGATAATATTTCAGTATTGG + Intronic
964193328 3:154032151-154032173 CAACCATAAAAATTCATTCTGGG + Intergenic
964493532 3:157263860-157263882 TAAAAATTATAATTCATTCTCGG - Intronic
965251647 3:166350829-166350851 CAAAAACAATATTGCATCCTTGG - Intergenic
965566774 3:170127865-170127887 TCAAGATAATTTTTCTTTCTAGG + Intronic
965767944 3:172151492-172151514 CAAAGGTAATATATCTCTCTTGG - Intronic
967450496 3:189617667-189617689 AAAGGGTAATATTACATTCTAGG - Intergenic
968155014 3:196373696-196373718 AAAAGAAAATAATTTATTCTGGG - Intronic
970566568 4:17337564-17337586 CAATGTTAATATTGCATTTTGGG + Intergenic
970714153 4:18900822-18900844 AAGAGATTATATTTAATTCTAGG - Intergenic
970883300 4:20957515-20957537 GAGAGATATTATTTCATTCCAGG + Intronic
972095382 4:35341670-35341692 CAAAAACAATATTTCATCCCAGG + Intergenic
972555036 4:40173070-40173092 CAAAGATCCTTTTTTATTCTGGG - Intergenic
972819411 4:42682693-42682715 CCAACCTAATATTTCCTTCTGGG - Intergenic
973112693 4:46414890-46414912 AAAAGATAAAATTGCATGCTGGG - Intronic
974076786 4:57174183-57174205 CCAAGTTAAAATTTCATTCTAGG - Intergenic
974194552 4:58555598-58555620 GCTACATAATATTTCATTCTTGG - Intergenic
974285400 4:59859473-59859495 ATAAGATAATATCTCATTGTAGG + Intergenic
974692113 4:65309460-65309482 CAAAAATAAATTTTCCTTCTAGG - Intergenic
974776308 4:66487116-66487138 CAAATATATTATTTATTTCTGGG + Intergenic
974987000 4:69040566-69040588 CAAATATTTTGTTTCATTCTGGG + Intronic
975648009 4:76564757-76564779 AAAAGACCACATTTCATTCTTGG + Intronic
976244197 4:82990830-82990852 TAAAGATAATATCTCCCTCTGGG - Intronic
976382597 4:84417298-84417320 CAAAAATTACATTTCTTTCTAGG - Intergenic
976426612 4:84911132-84911154 CAAATATTTTCTTTCATTCTGGG - Intronic
977465867 4:97382372-97382394 CAAAAATAATATTACATCCCTGG + Intronic
978441409 4:108738026-108738048 CAAAGACAACATCACATTCTAGG + Intergenic
978716455 4:111849032-111849054 CAAACATAATAATTCATTAAGGG - Intergenic
979154716 4:117369868-117369890 GTAAGATAATATCTCATTGTGGG + Intergenic
979274933 4:118804736-118804758 TAAAAATAATTTTTCCTTCTCGG - Intronic
979396472 4:120195799-120195821 CAAAGACAATTTTTTTTTCTTGG + Intergenic
979742040 4:124163228-124163250 TAAAAATACTATTTCATTCTGGG + Intergenic
981460949 4:145013331-145013353 AAAGGATAATATATCATTCTAGG + Intronic
981499032 4:145427198-145427220 TAAAGATAAAACTTGATTCTGGG + Intergenic
982181750 4:152754216-152754238 CAAAGTTAATGATACATTCTGGG - Intronic
982301604 4:153884211-153884233 CAGAGTTAAAAGTTCATTCTGGG + Intergenic
982363209 4:154546104-154546126 TAATTATAATATTTCATACTTGG + Exonic
982819248 4:159926155-159926177 CAAAGGTCATATGTAATTCTGGG - Intergenic
982832515 4:160081247-160081269 GAAAGAAAATATTTCATTTTAGG + Intergenic
982989128 4:162248204-162248226 TAAAGTTGCTATTTCATTCTGGG + Intergenic
983207194 4:164923094-164923116 CAAATACAATATTTCAATGTTGG - Intergenic
983353284 4:166622081-166622103 CAAAAATAATTTGTCAGTCTTGG - Intergenic
983870531 4:172820270-172820292 AAAAGCTAATAGTTTATTCTAGG - Intronic
983875870 4:172874100-172874122 CAAATATAACTTTTCATTCATGG - Intronic
984122572 4:175764757-175764779 CAAATAAAATAATTCAGTCTGGG - Intronic
984293097 4:177819857-177819879 CTAGAATGATATTTCATTCTAGG - Intronic
984750184 4:183264866-183264888 CCAAAATAAGATTTCCTTCTGGG - Intronic
986698499 5:10380088-10380110 GAAGCATAATTTTTCATTCTGGG + Intronic
986742785 5:10718481-10718503 CAAAAACAATATTGCATTCCTGG + Intronic
986836153 5:11639840-11639862 CATAGGTAATAATTCATTCAAGG - Intronic
987144390 5:14978219-14978241 TAAAAATAAAATTTTATTCTTGG + Intergenic
988295912 5:29361908-29361930 CAAAGCTAATATTAGGTTCTTGG - Intergenic
988834327 5:35016492-35016514 CAAGGATAAACTTTCATCCTTGG - Intronic
988937786 5:36106458-36106480 TAAAGGTAAGATTTCAATCTGGG - Intronic
989403566 5:41035756-41035778 ATAAGACAATATTTCATTGTGGG - Intronic
989453731 5:41617544-41617566 TATTGATATTATTTCATTCTAGG - Intergenic
989762647 5:45036948-45036970 CTATGAAAATATTTCATTTTAGG + Intergenic
989975036 5:50574914-50574936 CAAAGCTCATATCTAATTCTTGG + Intergenic
990031742 5:51269439-51269461 CCAAGATAATATTGAATTGTTGG - Intergenic
990269531 5:54120855-54120877 AAAAGATCTTATTTCATCCTGGG - Intronic
990806119 5:59664438-59664460 CATATATATTATTTCATTTTAGG + Intronic
991013947 5:61911925-61911947 CAAAAACAATATTGCATTCCTGG - Intergenic
991107817 5:62862999-62863021 CAAATATTTTCTTTCATTCTGGG + Intergenic
991479554 5:67062427-67062449 CAAAGGCAATATTTCACTCAGGG - Intronic
992036856 5:72788186-72788208 TAAAAATAAAAATTCATTCTGGG - Intergenic
992060166 5:73036236-73036258 CAAAGATAATTTTTACTCCTCGG + Intronic
992325574 5:75656446-75656468 CAATTACAATATTTCACTCTGGG - Intronic
992607313 5:78471964-78471986 CTAAAATAATATTTAGTTCTAGG - Intronic
992728609 5:79635023-79635045 CAAAAATATTCTTTAATTCTGGG - Intronic
992991541 5:82288714-82288736 GAAAGATAATTTTTCTTACTAGG + Intronic
993707835 5:91191590-91191612 CAAAGAATATATCTCAATCTAGG - Intergenic
993827838 5:92714291-92714313 CAAAGTTAAGTTTTAATTCTTGG + Intergenic
993945198 5:94110388-94110410 CATAGATAATATTTCCCTCTTGG + Intronic
994766682 5:103927332-103927354 CAATGATAATAATACATTTTAGG + Intergenic
994919115 5:106019355-106019377 CAATAATAATATTGCAATCTGGG + Intergenic
994946691 5:106403058-106403080 CAAAGGTCATATTTCAGTTTTGG - Intergenic
995012667 5:107275519-107275541 CTAAGATAATAATTAATCCTAGG + Intergenic
995665628 5:114538933-114538955 CAGAAAGAATATATCATTCTTGG - Intergenic
995857579 5:116609523-116609545 CAAAAATGATATGTCATTCCAGG - Intergenic
995987126 5:118190721-118190743 AAAAGTTAATTTCTCATTCTTGG + Intergenic
996606179 5:125326271-125326293 GAAAGATAGTAGGTCATTCTTGG - Intergenic
997091285 5:130861762-130861784 CAAAGAAATAATTTTATTCTAGG + Intergenic
998921019 5:147067967-147067989 CAAAGATTATATTTCATCTTTGG - Intronic
998992412 5:147832521-147832543 TAAAGTTAATATCTCCTTCTAGG + Intergenic
999499802 5:152135502-152135524 CATAGATAATATGTAACTCTGGG + Intergenic
999832892 5:155337559-155337581 CAAAAACAATATTGCATTCCAGG + Intergenic
999943167 5:156566808-156566830 TAAAGATAATGTCTCATTTTAGG - Intronic
1000469860 5:161627984-161628006 AAAAGGAAATATTTCCTTCTTGG - Intronic
1000789858 5:165592464-165592486 CAAAGAAATAATGTCATTCTAGG + Intergenic
1001143687 5:169165905-169165927 CTCAGAAACTATTTCATTCTAGG - Intronic
1002788323 6:420549-420571 GAATGAAAATATTTCCTTCTCGG - Intergenic
1003722120 6:8715583-8715605 CAAATATAATATTTACTCCTCGG + Intergenic
1005674402 6:28138933-28138955 TAAAGATAATGGCTCATTCTGGG - Intergenic
1005676943 6:28164564-28164586 CCAAGATGAAATTTCAATCTAGG - Intergenic
1005800326 6:29415382-29415404 CAAATATAATTTTTGGTTCTTGG - Intronic
1005841393 6:29746719-29746741 CAAATATTTTCTTTCATTCTGGG - Intergenic
1007184177 6:39953636-39953658 CAAAGATATTATCTCTCTCTGGG + Intergenic
1008508553 6:52254877-52254899 TAAAGATACAATTTCAGTCTTGG + Intergenic
1008860916 6:56149303-56149325 AAAAGAAAACATTACATTCTGGG + Intronic
1009270738 6:61610259-61610281 CACAAATTATATTTCAATCTAGG + Intergenic
1009274535 6:61658354-61658376 TAAAGATAAAATTTTATTTTGGG + Intergenic
1009376277 6:62974329-62974351 TAAAGGTAATTTTTCATTATGGG + Intergenic
1009809709 6:68645438-68645460 CAGAGATAATACTTTTTTCTAGG + Intronic
1009942953 6:70310352-70310374 TTAAGAAAATATTTCATTCTTGG + Intergenic
1010065260 6:71675313-71675335 CAAAGAGAATAATTCATGCACGG - Intergenic
1010763704 6:79754278-79754300 TAAAGGAAATATTTTATTCTTGG - Intergenic
1011345280 6:86362657-86362679 TAAAGATAATGTTTCACTCTGGG + Intergenic
1012010443 6:93777994-93778016 GAAACTTCATATTTCATTCTAGG - Intergenic
1012035461 6:94132461-94132483 AAAAGATAATATTCTTTTCTAGG + Intergenic
1012048030 6:94303321-94303343 CATTGATTATATTTGATTCTGGG - Intergenic
1012225984 6:96703809-96703831 CAAAAACAATACTGCATTCTTGG + Intergenic
1012730336 6:102873300-102873322 CAAAAACAATATTTCATCCCTGG + Intergenic
1012768473 6:103398453-103398475 CAAAGATGGTGTTTCATCCTAGG - Intergenic
1012826062 6:104148658-104148680 CAAAGATTGTATATGATTCTTGG + Intergenic
1013440768 6:110165172-110165194 CAAAGTTAATATTTTATACCAGG - Intronic
1014038776 6:116799475-116799497 CAAATAAAATATTTCATTGAGGG + Intronic
1014151023 6:118055455-118055477 CAAAAAGAATTTTTCATTTTAGG + Intronic
1014195326 6:118551146-118551168 CAAAGAGACTACTTGATTCTAGG - Intronic
1014494073 6:122098778-122098800 AAAAGAAAATATGTCTTTCTGGG - Intergenic
1014619102 6:123643594-123643616 CATAGAAATGATTTCATTCTTGG - Intergenic
1014725527 6:124967302-124967324 AACAGATAATATTTCCTCCTAGG - Intronic
1014779451 6:125546813-125546835 CAAAGTTTATATTTGATCCTTGG + Intergenic
1015130693 6:129805591-129805613 CAATTATAATATTTCCTTCTAGG + Intergenic
1015346712 6:132168823-132168845 CAATTATTTTATTTCATTCTTGG - Intergenic
1015493244 6:133852951-133852973 CAAAAATTATATGTCATTCTTGG + Intergenic
1015689012 6:135899692-135899714 CAAATATAATAATTTATTTTTGG + Intronic
1015962440 6:138663870-138663892 CAAAGAAAAAAAATCATTCTAGG + Intronic
1016120035 6:140333674-140333696 CAAAAACAATATTGCATTCCTGG - Intergenic
1017640249 6:156486357-156486379 AAAAGATTAAATTTCATTGTTGG - Intergenic
1018183499 6:161244799-161244821 CAAAGACAGTGTTTCATCCTAGG - Intronic
1018563693 6:165129038-165129060 TAAAGAAAATATTTCCTTTTAGG + Intergenic
1019004097 6:168781900-168781922 TAAACATAAAATTTCATGCTAGG + Intergenic
1020639393 7:10736577-10736599 CAAAGAAAATATTTCCTAATTGG - Intergenic
1020726007 7:11815713-11815735 CAAATATATTCTTTCATTCCTGG + Intronic
1020952071 7:14692363-14692385 CAAACATAAAATGTCCTTCTCGG + Intronic
1021051066 7:15985632-15985654 CATACATAATAATTCTTTCTTGG - Intergenic
1021181162 7:17507631-17507653 AAAAGATAATATTTATTTTTGGG - Intergenic
1021318004 7:19174501-19174523 CTGTGATAATATTTCCTTCTTGG + Intergenic
1021449310 7:20767865-20767887 AATAGATAAGATTTAATTCTGGG + Intronic
1021595382 7:22310814-22310836 CAAAAATAATTTTTCATGCGTGG - Intronic
1021718037 7:23478289-23478311 CAAAGATATTATTTGAATCTTGG - Intergenic
1022731523 7:33031181-33031203 CAATGATAATATTCCAGACTAGG + Intronic
1023526455 7:41108350-41108372 CAAAGAAACTATTTTCTTCTGGG - Intergenic
1025920141 7:65904106-65904128 CAAAAATAATAATGCATTATAGG + Intronic
1026647025 7:72180426-72180448 CAAACACCGTATTTCATTCTTGG + Intronic
1026761862 7:73132929-73132951 CAAAGATGATTTTTCTCTCTTGG - Intergenic
1027038203 7:74941753-74941775 CAAAGATGATTTTTCTCTCTTGG - Intergenic
1027085360 7:75259729-75259751 CAAAGATGATTTTTCTCTCTTGG + Intergenic
1027770792 7:82403574-82403596 CAAAGAGAATATTTCTTTTCTGG - Intronic
1027808699 7:82864260-82864282 CAAAGAGAATACTAAATTCTGGG + Intronic
1028151393 7:87377848-87377870 CAAAGATTATGTGTCATTTTAGG - Intronic
1028329025 7:89565281-89565303 AAAAGAAAATATTTAATACTTGG - Intergenic
1028459748 7:91077858-91077880 CAAATTTAATATTGGATTCTTGG - Intronic
1028778214 7:94705032-94705054 CTTAGATAATATTTCTTTCCAGG - Intergenic
1030884853 7:114923663-114923685 CAAAGAAGCTAATTCATTCTTGG - Intronic
1031320251 7:120316750-120316772 CAAAAAAAAGATATCATTCTTGG - Intronic
1031434437 7:121714908-121714930 CAAAGATAATCTTTAGTTTTTGG + Intergenic
1031681223 7:124676913-124676935 CATAGATATTGTTTCTTTCTGGG - Intergenic
1032817350 7:135490326-135490348 GAAATATAATATTTCCATCTGGG + Intronic
1032859262 7:135862054-135862076 CATAGATATTATTTCTTTTTTGG - Intergenic
1033141998 7:138835709-138835731 CAAAGATAATCGTTCAATTTGGG + Intronic
1033252588 7:139773856-139773878 CAAAGGTTATCTTTCATACTTGG + Intronic
1033297393 7:140152822-140152844 AAAAGATAATTTGTCATTATAGG + Intronic
1033672005 7:143502144-143502166 CATAGATATTATTTCATTTGAGG + Intergenic
1033705143 7:143879320-143879342 AAAAGATGATACTTCTTTCTAGG + Intronic
1033851657 7:145503762-145503784 CAAATATATTATTTAATTTTTGG + Intergenic
1037781978 8:21875755-21875777 AAAAGAAAATATTTCGTTTTTGG - Intergenic
1040328094 8:46370857-46370879 CAAAGAAAAGGTTTAATTCTGGG + Intergenic
1040463559 8:47673393-47673415 CAAAGCAAATATTTCTTTCATGG + Intronic
1040969478 8:53118522-53118544 TAAAGAAAATATTTGATTCCAGG - Intergenic
1041037754 8:53812668-53812690 CAAAAACAAAACTTCATTCTGGG - Intronic
1041225586 8:55694264-55694286 CACAAATAATATATCATTATTGG + Intergenic
1041480416 8:58314154-58314176 CAAAGATAAGATTTTATTTTGGG - Intergenic
1042650309 8:71033299-71033321 CAATGATAATATTACCTTGTAGG + Intergenic
1043338159 8:79203246-79203268 CAAAGATAGGTTTTGATTCTGGG + Intergenic
1043687350 8:83104124-83104146 TAAAGATAAAATTTCAGTGTGGG - Intergenic
1043707905 8:83377214-83377236 TAAAGGTGATGTTTCATTCTTGG - Intergenic
1045421966 8:102025285-102025307 CAAAGACCAAATTTCCTTCTGGG - Intronic
1045935495 8:107674099-107674121 CCATGAGAATATTTCATTCTAGG + Intergenic
1046110091 8:109712253-109712275 TAAATATAATAGTTCATTTTGGG - Intergenic
1046444774 8:114303701-114303723 TAAATATAATATGGCATTCTAGG - Intergenic
1046462976 8:114567337-114567359 CAAATATATTCTCTCATTCTGGG + Intergenic
1046472742 8:114699732-114699754 CAAAAATAATATTTTAATATTGG + Intergenic
1047112336 8:121804375-121804397 TAAAGATAATATCTAACTCTGGG - Intergenic
1047291958 8:123539591-123539613 GAAAGACATTATTTAATTCTGGG - Intronic
1047538973 8:125745575-125745597 CAAAGATAATAATTCACTTGAGG + Intergenic
1047731333 8:127731337-127731359 CACAAATAATCATTCATTCTTGG - Intergenic
1047819347 8:128501640-128501662 CATAGAACATATTGCATTCTAGG + Intergenic
1048161014 8:132022110-132022132 TAAAGATAATGTCTCCTTCTGGG + Intergenic
1050774264 9:9240370-9240392 CAAACATAAAAATTCTTTCTAGG + Intronic
1050779272 9:9310615-9310637 CACAGATAATCTCACATTCTGGG + Intronic
1050794654 9:9523231-9523253 CAAAGATTATATTTAATTACTGG + Intronic
1050905608 9:11000733-11000755 CAAAGCTATTATTTCACTATTGG - Intergenic
1051122225 9:13763873-13763895 AAAAAATAATATTGCATCCTTGG - Intergenic
1051126171 9:13808253-13808275 CATATATAATATTTCAATGTAGG + Intergenic
1051870347 9:21730217-21730239 TAAAGATAATATTTCAGTAGTGG - Intergenic
1053605138 9:39650265-39650287 AAAATATAATAGTTTATTCTTGG - Intergenic
1053863056 9:42406892-42406914 AAAATATAATAGTTTATTCTTGG - Intergenic
1054248403 9:62692150-62692172 AAAATATAATAGTTTATTCTTGG + Intergenic
1054562517 9:66726676-66726698 AAAATATAATAGTTTATTCTTGG + Intergenic
1055145573 9:72930531-72930553 TAAACCTAATATATCATTCTAGG + Intronic
1055786827 9:79879214-79879236 TAAAGTTAAGATTTCATTTTAGG + Intergenic
1055901012 9:81237911-81237933 CAAAGATAAAATGTGGTTCTGGG + Intergenic
1055949504 9:81717789-81717811 GAAAGATAAAACTTCATTGTTGG - Intergenic
1058752651 9:108054000-108054022 CAAAGCTAATAATTGCTTCTTGG - Intergenic
1059258987 9:112957807-112957829 CAAAGAAAACCTTTGATTCTTGG + Intergenic
1060332715 9:122688385-122688407 CAAAGATATCATGTCAATCTTGG - Intergenic
1185688386 X:1949005-1949027 CAAAGAAAGTATTTGATGCTGGG - Intergenic
1185688664 X:2134528-2134550 CAAAGAAAGTATTTGATGCTGGG - Intergenic
1186296007 X:8149104-8149126 CAAATTTAATATTGCATTCCTGG + Intergenic
1186300013 X:8190342-8190364 CAAAGGGCATATTTCATTGTTGG - Intergenic
1186574887 X:10754544-10754566 AAAAGATAAAATTTCATTTCAGG - Intronic
1187671726 X:21673593-21673615 TAAAGGTTATACTTCATTCTAGG + Intergenic
1188491718 X:30745054-30745076 TAAAGATAATATTGAAATCTGGG + Intergenic
1188637727 X:32456223-32456245 TATAGATAATACTTCATTTTAGG + Intronic
1188713489 X:33431308-33431330 CAAACATCATATTTCAAACTTGG - Intergenic
1189011669 X:37051543-37051565 CAAAGATGATATTTAAATATTGG + Intergenic
1189066657 X:37816938-37816960 CAAAGCTAATATATTATTCATGG - Intronic
1191212819 X:57907405-57907427 CAAAGCAAACATTTCACTCTGGG + Exonic
1191665662 X:63700083-63700105 CCTTGATAATATTTCATTCCAGG - Intronic
1191721902 X:64237922-64237944 GTAAGATAATATTTCATTGTGGG + Intergenic
1191815829 X:65243404-65243426 GTAAGATAATATATCATTGTGGG - Intergenic
1192271135 X:69580750-69580772 TAAAGATAACCTTTCCTTCTAGG + Intergenic
1193573796 X:83175953-83175975 CAAAGACAATATCACATTCCTGG - Intergenic
1193593243 X:83415926-83415948 CAAAGATAATATTACACCCAAGG - Intergenic
1194175306 X:90639045-90639067 CACACATGAAATTTCATTCTGGG - Intergenic
1194292772 X:92095441-92095463 AAATAATAATATTTCATTCTGGG + Intronic
1194595827 X:95856161-95856183 GCAAGATGATATTTCATTGTAGG - Intergenic
1194600364 X:95913306-95913328 CAAAGATAAGATACCATTCTTGG - Intergenic
1194851004 X:98869063-98869085 CAAAAATATTTTTTCATTATAGG - Intergenic
1196100362 X:111841380-111841402 CAAAGACAGGATTTCAATCTAGG - Intronic
1196289111 X:113917550-113917572 CAAAGTTTATCTTTCATTTTGGG + Intergenic
1196683597 X:118493060-118493082 TAAAGACACTATTTCCTTCTGGG - Intergenic
1197002163 X:121451933-121451955 CAAAAACAATATTGCATCCTTGG + Intergenic
1197097337 X:122611809-122611831 CAAAAACAATATTTCATCCCTGG + Intergenic
1197584695 X:128330689-128330711 CAAAGTTATTATTTCCTCCTGGG + Intergenic
1197866601 X:131025695-131025717 CAGAGCTAATATTTTATTTTAGG + Intergenic
1198068172 X:133120648-133120670 AAAAGATTAGATGTCATTCTTGG - Intergenic
1198202137 X:134432436-134432458 CAAAAATAATAGCTCATTTTTGG - Intergenic
1198590513 X:138175284-138175306 CAAATAAAATATGTCATTATAGG + Intergenic
1199620068 X:149692085-149692107 CAAAGAAAATATTTTTTTTTTGG + Intronic
1200521957 Y:4220014-4220036 CACACATGAAATTTCATTCTGGG - Intergenic
1200610277 Y:5320003-5320025 AAATGATAATATTTCATTCTGGG + Intronic
1200965322 Y:9030380-9030402 CAAATATAATAGTGCAATCTAGG - Intergenic
1200979866 Y:9253062-9253084 CAAAGATAAGGTTTGATTGTTGG - Intergenic
1201992312 Y:20041186-20041208 CAAAGTTGATTTTTTATTCTTGG + Intergenic
1202131449 Y:21615612-21615634 CAAAGATAATATTTGGTTGTTGG + Intergenic