ID: 929915938

View in Genome Browser
Species Human (GRCh38)
Location 2:46135680-46135702
Sequence CTCGGTTATCAGCACTGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929915934_929915938 15 Left 929915934 2:46135642-46135664 CCTGGAGATTGGCCCAGAATGAA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG 0: 1
1: 0
2: 0
3: 5
4: 54
929915935_929915938 3 Left 929915935 2:46135654-46135676 CCCAGAATGAAATATTATCTTTG 0: 1
1: 0
2: 2
3: 42
4: 471
Right 929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG 0: 1
1: 0
2: 0
3: 5
4: 54
929915933_929915938 16 Left 929915933 2:46135641-46135663 CCCTGGAGATTGGCCCAGAATGA 0: 1
1: 0
2: 1
3: 7
4: 156
Right 929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG 0: 1
1: 0
2: 0
3: 5
4: 54
929915936_929915938 2 Left 929915936 2:46135655-46135677 CCAGAATGAAATATTATCTTTGA 0: 1
1: 0
2: 3
3: 38
4: 448
Right 929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929915938 Original CRISPR CTCGGTTATCAGCACTGCAA TGG Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
916647134 1:166797273-166797295 CTCGGTTGGCAGCACTGAACAGG - Intergenic
922797004 1:228345202-228345224 CTCGGTTATAAGGACTGAACTGG - Intronic
923607157 1:235454383-235454405 CTCCTTTATCATCACTACAAAGG + Intronic
1064611064 10:17103130-17103152 CTGGGTTATCAAAACTGAAATGG - Exonic
1071519632 10:86321417-86321439 CTGGTTTTTCAGCACTGCTATGG - Intronic
1075839984 10:125493554-125493576 CTCAGTTAGCAGCTCTGCAGAGG + Intergenic
1080236833 11:30079672-30079694 CACTGTTATAAGAACTGCAAGGG - Intergenic
1080331371 11:31143596-31143618 CTCAGTTCTCAGCTCTGCATTGG + Intronic
1081487102 11:43539249-43539271 CTGAGTTAGCAGCTCTGCAAAGG - Intergenic
1081675215 11:44964706-44964728 CGGGGTGATCAGCTCTGCAAAGG + Intergenic
1090878995 11:130816781-130816803 CTCGGTTATTATCGATGCAAGGG - Intergenic
1098659461 12:73074100-73074122 CTCTGTTATTTGCTCTGCAAAGG + Intergenic
1100272785 12:93042371-93042393 CTCGGTTATAAGCTCCTCAAAGG - Intergenic
1103631063 12:122261434-122261456 CTCGTCTATCTTCACTGCAAAGG + Exonic
1105623217 13:22088805-22088827 CCCAGATGTCAGCACTGCAAGGG - Intergenic
1108245065 13:48505841-48505863 TTCGGTTCTCAGCTCTGCCAAGG - Intronic
1116549123 14:46211616-46211638 CTCTGTTATAAGAACAGCAAGGG - Intergenic
1125759698 15:42088210-42088232 CTCAGCTATCTGCACTGTAAGGG + Intronic
1129743173 15:78000095-78000117 CGCTGTTATCAAGACTGCAAGGG - Intronic
1138457193 16:57127962-57127984 CTCGGGGATCAGCTCTGGAAAGG + Intronic
1144373709 17:14618170-14618192 CTCGGGTCTCAGCCCTGCCATGG + Intergenic
1145916145 17:28575239-28575261 CACGGTCATCAGCACTGAACAGG + Exonic
1156445139 18:37231066-37231088 CTCAGTTATCATCACTTCCATGG + Intronic
1156914026 18:42444309-42444331 CTCAGTTTTCAGCATTGCAATGG - Intergenic
925093555 2:1175210-1175232 CTGGGTAATCTGCACTGCCACGG + Intronic
928024665 2:27729749-27729771 CTGGGTCATGAGCACAGCAAAGG - Intergenic
928875833 2:36038072-36038094 CTCAGGTTTCTGCACTGCAAAGG + Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
939249674 2:139667640-139667662 CTCGGTTATCAGAAGTGCTAGGG - Intergenic
941167130 2:162094676-162094698 CTTGGATCTCAGCAGTGCAAGGG + Intergenic
943041071 2:182805846-182805868 TTAGGTTATCAGCACTTGAATGG + Intergenic
1170049141 20:12122386-12122408 CTCTGTTATCAGCAATGCATGGG - Intergenic
1177638198 21:23812831-23812853 CTCTGTACTCAGCACTGAAAAGG - Intergenic
1179937283 21:44613601-44613623 CTCGCTTAGCAGCAATGCGAGGG + Intronic
1184017027 22:41794029-41794051 TTCTTTTAGCAGCACTGCAAGGG + Intronic
958895951 3:99829480-99829502 ATAGGTTATCAGAACTGGAAGGG + Intronic
966370595 3:179247555-179247577 CTCGGTTCTCATAACTACAAGGG - Intronic
967937214 3:194738706-194738728 CTCTGTTGCCAGCACTGCACAGG + Intergenic
970977961 4:22062805-22062827 CTCTGATTTCAGCACTGCCAGGG - Intergenic
971477100 4:27082703-27082725 CTCTGTTTTAAGAACTGCAAAGG + Intergenic
975994296 4:80296647-80296669 CTGAGTTATGAGCACTGAAAAGG - Intronic
987853855 5:23392414-23392436 CTTGGTTATAACCAATGCAAGGG + Intergenic
988728425 5:33946525-33946547 CTCTGTTATAAGCACTGCATAGG + Intronic
995938501 5:117548666-117548688 GTCACTTATCAGCACTGAAATGG - Intergenic
1005664251 6:28034581-28034603 CTTGATTCTCAGCACTGCTAGGG - Intergenic
1010258068 6:73783108-73783130 TTCAGTTAGCAGCACTGCCAGGG - Intronic
1012306871 6:97669340-97669362 CTCTATTATCAGCAGTGCACTGG - Intergenic
1012612933 6:101237647-101237669 CTCTGTTATGAGGACTGCACAGG - Intergenic
1014853109 6:126365519-126365541 CTCTGTTATGAGAACAGCAAGGG + Intergenic
1022673713 7:32478958-32478980 CTTGGTTGTCTGCACTTCAATGG - Intergenic
1026110804 7:67457607-67457629 CTCGGTTATCATTTTTGCAAAGG - Intergenic
1030136418 7:106255513-106255535 CTTTGTTTTCAACACTGCAAAGG + Intronic
1037753066 8:21695257-21695279 CTCTGTTATCATCACTGTAATGG + Intronic
1042956882 8:74260414-74260436 CTGGTTTATCTGCTCTGCAAAGG + Intronic
1052458004 9:28725895-28725917 CAAGGTTATAAGCACTGAAAGGG + Intergenic
1055732418 9:79292046-79292068 CTCTGTTACCAGCACTCCATGGG - Intergenic
1061324677 9:129856403-129856425 ACCTGTTATCAGCACTGCACAGG + Intronic
1189804628 X:44722833-44722855 GTGGGTTCTCAGCACAGCAAGGG - Intergenic
1198480067 X:137033097-137033119 TTAGTTTATCAGCAGTGCAATGG + Intergenic