ID: 929920483

View in Genome Browser
Species Human (GRCh38)
Location 2:46167904-46167926
Sequence GGAGCCTGCTGTGCTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929920483_929920489 25 Left 929920483 2:46167904-46167926 CCTGTTCCAGCACAGCAGGCTCC 0: 1
1: 0
2: 3
3: 28
4: 270
Right 929920489 2:46167952-46167974 CAGTGGAGCATCTTTGACTCTGG 0: 1
1: 0
2: 0
3: 8
4: 123
929920483_929920487 8 Left 929920483 2:46167904-46167926 CCTGTTCCAGCACAGCAGGCTCC 0: 1
1: 0
2: 3
3: 28
4: 270
Right 929920487 2:46167935-46167957 TCTAAGCGAAACAGCCTCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929920483 Original CRISPR GGAGCCTGCTGTGCTGGAAC AGG (reversed) Intronic
900604918 1:3519663-3519685 GCCGCCTGGTGTGCTGGAGCCGG - Intronic
900640449 1:3685786-3685808 GGAAGCTGCTGTGCTGGGGCTGG + Intronic
901828317 1:11877270-11877292 GCAGACAGCTCTGCTGGAACTGG - Intergenic
902617709 1:17632907-17632929 GGAGCCTGGTTTGCTGGTTCTGG + Intronic
904436650 1:30502990-30503012 GGAGCCTGCTGGGCTCCACCTGG + Intergenic
905707213 1:40069832-40069854 GGAGCCAGCTGTACTTGAACTGG + Exonic
906952990 1:50349523-50349545 GGGCCCTGCTGTGGTGGACCAGG - Intergenic
907300634 1:53484481-53484503 GGACCCTGATCTGCTGGAAGAGG + Intergenic
907850410 1:58250031-58250053 GGAGCCTCCTGGGTGGGAACTGG - Intronic
910468840 1:87529194-87529216 GGTGCCTGCTGGGCTTGATCAGG - Intergenic
911063662 1:93768956-93768978 GAAGCCTGCTGTCCTTGAGCAGG - Intronic
911292254 1:96071380-96071402 GGACTCTGCAGTGCTGGTACTGG - Intergenic
912430553 1:109626364-109626386 GGAGCGTGATGTGCTGGAACGGG + Exonic
912457957 1:109811442-109811464 GGAATCTGCTGTGCTGCAAGAGG - Intergenic
912568193 1:110604033-110604055 GAAGCCGGCTTTGCTGGGACAGG + Exonic
915331453 1:155115225-155115247 TGGGGCTGCTGTGCTGGGACTGG + Intergenic
916921822 1:169477154-169477176 GGAGCCTCCCGTGGAGGAACCGG - Exonic
917798650 1:178551010-178551032 GGACCCTGATGTGCTGGATGAGG + Intergenic
919466216 1:197923323-197923345 GGCCCCTGCTGTGCTGGGGCAGG + Intronic
919923775 1:202181748-202181770 TGGGCCTGCTGTGCTGGAGGCGG + Intergenic
919931103 1:202222136-202222158 GGAGCGTGCAGAGCTGGAAGAGG - Intronic
920647033 1:207811486-207811508 GGTGCCTGCTGTCCTGCAAGGGG - Intergenic
922516097 1:226209390-226209412 GGACCCTCCTGTGCTGGGATTGG - Intergenic
924521820 1:244812275-244812297 GGAGCCAGGTGTGGTGGCACAGG + Intergenic
1063240399 10:4163541-4163563 GGATACGGTTGTGCTGGAACGGG - Intergenic
1063759454 10:9056796-9056818 GGCGCCTGCTGGGCTTGATCTGG + Intergenic
1065754980 10:28922907-28922929 GGAGACTGCAGGGCTGGAAGAGG - Intergenic
1067135631 10:43605298-43605320 GGAGCCAGCTGTACTTGAACTGG - Intergenic
1067343138 10:45419949-45419971 GGGGCCTGCTGGCCTGGCACTGG + Intronic
1067781308 10:49209343-49209365 TGTGCCTGCTGTGCTGTCACTGG - Intergenic
1069604112 10:69729178-69729200 GGAGCCTGCTGTACCGGCTCAGG - Intergenic
1070748520 10:78949938-78949960 GGAGCATCCTGTGCTGGGGCTGG - Intergenic
1073352407 10:102829302-102829324 GGAGGCTGTTGTGCTGGTCCAGG - Intergenic
1073971401 10:109048116-109048138 GGTGCCTGCTGGGCTTGATCGGG + Intergenic
1075007216 10:118839667-118839689 GTTGCCAGCTGTGCTGGTACTGG - Intergenic
1075021692 10:118956914-118956936 GGGGCCTGAGCTGCTGGAACAGG - Intergenic
1076981698 11:208265-208287 GGCGACTGCTGGGCTGCAACGGG - Intronic
1077261479 11:1623770-1623792 AGTGCCTGCTGTGCTGAAAATGG + Intergenic
1077542899 11:3155854-3155876 AGGGGTTGCTGTGCTGGAACCGG + Intronic
1078190382 11:9089273-9089295 GGAGCCTCCTGAGCTGGTAGGGG + Intronic
1078653370 11:13216307-13216329 GGAGGCTGCTGAGCTTGAAGGGG - Intergenic
1079567713 11:21903099-21903121 GCATCCTGCTGAGCTGGTACAGG - Intergenic
1080720512 11:34843709-34843731 GGAGGCTGCATTGCTGGCACTGG - Intergenic
1081152369 11:39648154-39648176 GCACCCTGCTGCCCTGGAACTGG + Intergenic
1081809181 11:45905760-45905782 GCAGCCAGCTGTCCTGGCACTGG - Exonic
1081908993 11:46688177-46688199 GGAGCTTGCTGTGGTCGAGCTGG + Exonic
1082046306 11:47731628-47731650 GCAGACTGCTGTCCTGGGACAGG - Intronic
1083434070 11:62630750-62630772 CGAGGCTGATGTGCTGGAAGTGG - Exonic
1084329869 11:68424037-68424059 GGAGCTCCCTGTGGTGGAACAGG - Intronic
1084411363 11:69008059-69008081 GCAGCCTGCTGTGCTCCAGCTGG + Intronic
1087962244 11:104366467-104366489 GGAGCCTGCTGGGCTTGATCAGG - Intergenic
1088847299 11:113679409-113679431 GGAGCCTGTTGAGCAGGTACTGG - Intergenic
1091320689 11:134647232-134647254 GGAGGCTCCTGTGCTGGGAGGGG - Intergenic
1095595297 12:43951403-43951425 CGAGACTGCTGTGCTGGTAATGG - Intronic
1098217182 12:68233197-68233219 GGAGCCTATTGTGCTGGACTAGG - Intergenic
1098241773 12:68474592-68474614 GGATCCTGCTTTGCTGCATCCGG + Intergenic
1098603738 12:72364675-72364697 GCAGAATGCTGTGCTTGAACTGG + Intronic
1099348983 12:81540971-81540993 GGTGCCTGCTATCCTGAAACTGG + Intronic
1099537200 12:83858649-83858671 GAAGCCTGCTCTGCTGGGATTGG - Intergenic
1101563146 12:105879396-105879418 GGAGCCTGCTGAGCTGTTCCAGG + Intergenic
1102729475 12:115095560-115095582 ATAGCCTGCTGGGCTGGACCTGG + Intergenic
1102951412 12:117033900-117033922 GAACTCTGCTGTGCTGGAAACGG - Intergenic
1103324457 12:120111192-120111214 GGCGCCTGCTGTGCTGCAGTGGG - Intronic
1103730827 12:123026714-123026736 TGAGCCTGCTGTCCTGGAAAAGG - Intronic
1104477890 12:129085177-129085199 GGAGCTGGCTGTGCTGCACCTGG + Intronic
1104927761 12:132322473-132322495 GGTGCTTGCTGTGCTCGAACTGG - Intronic
1106897589 13:34321383-34321405 GGAGACTGCACTGATGGAACAGG + Intergenic
1108322539 13:49302368-49302390 GGAGGCTCCTGTGCTGGGCCTGG + Intergenic
1108817801 13:54313180-54313202 GGTGCCTGCTGGGCTAGATCAGG + Intergenic
1110260080 13:73475043-73475065 GGAGCCTGCTGTGAAAGACCTGG - Intergenic
1110740931 13:78995662-78995684 GGAGTCTTCTGTAGTGGAACTGG + Intergenic
1111723911 13:91980748-91980770 GGATCCTGGTGTGCTGGTAATGG - Intronic
1113675332 13:112202923-112202945 GGGGCCTGCCCTGCTGGAGCCGG + Intergenic
1113764030 13:112869735-112869757 GGAGGCTGCTGTGCTGTAACTGG - Intronic
1113864562 13:113512561-113512583 GGAGCCCCAGGTGCTGGAACTGG + Intronic
1113864590 13:113512697-113512719 GGAGCCCCAGGTGCTGGAACTGG + Intronic
1113914290 13:113861649-113861671 TGGGCCTGGTGTGCTGGAGCCGG + Intronic
1114629603 14:24150712-24150734 GGGGCATGTTGTGCTGGAATGGG - Exonic
1116490243 14:45496384-45496406 TGAGCCTGATGTGCAGGAAAGGG + Intergenic
1117529805 14:56649058-56649080 GGAGCCTGCAGTGCCTGGACAGG + Exonic
1118216066 14:63809577-63809599 GGAGCCTGGAGTGCTGGGCCTGG - Intergenic
1118300878 14:64614902-64614924 TGAGCCTGCTGGGCTGGGACCGG - Intergenic
1118559150 14:67059352-67059374 GGAGCCTGGTCTCCTGGAACTGG - Intronic
1119034197 14:71215917-71215939 GAAACCTGCTGTGCTTAAACCGG + Intergenic
1120758361 14:88265033-88265055 GGAGGCTGCTGGGCTGGTCCAGG - Intronic
1121276155 14:92669342-92669364 GGAGTTTGCTGTCCTGGGACTGG + Intronic
1121333159 14:93060558-93060580 GGACCCTGCTCTGCTGCAAAAGG + Intronic
1122070010 14:99200225-99200247 AGAGCCTGCTGTCCTGGTGCAGG + Intronic
1122255601 14:100473483-100473505 GGAGCCTGCTGGGCAGCAGCTGG + Intronic
1122544198 14:102513251-102513273 GAAGCCAACTGTGCTGGAGCAGG + Intergenic
1123031936 14:105456066-105456088 GGAGGCCGCTGTGCTGGGTCTGG + Intronic
1126990273 15:54366893-54366915 GTATCCTGCTGTGCTGTAACAGG - Intronic
1128080378 15:64853701-64853723 GGAGTGTGCTGTGCTGGAAAGGG + Intronic
1128887984 15:71305798-71305820 GGGGCCTGCCCTGCTGGGACAGG + Intronic
1128978403 15:72169353-72169375 GGAGCAGGCAGTGCTGGAATAGG + Intronic
1129520600 15:76183693-76183715 GCCGCCTGCTGTGGTGGAACCGG - Intronic
1132711906 16:1272602-1272624 GGAGGCTGCTGGGCTGTGACGGG - Intergenic
1132782359 16:1634561-1634583 GGAGCCTGCTGTGCCAGGTCAGG - Intronic
1134242818 16:12518368-12518390 GGAGCTTGGCTTGCTGGAACAGG - Intronic
1136267979 16:29131996-29132018 GGGCCCAGCGGTGCTGGAACAGG + Intergenic
1139964469 16:70737876-70737898 GGACCCTGCTGGGCCTGAACTGG - Intronic
1141202771 16:81910529-81910551 GGATCCGGCAGTGCTGGACCCGG - Exonic
1141706176 16:85666058-85666080 GGAGCCTGGGAAGCTGGAACAGG + Exonic
1142006135 16:87690373-87690395 GGAGCCCGCCGTGCAGAAACTGG + Exonic
1142071286 16:88092334-88092356 GGGCCCAGCGGTGCTGGAACAGG + Intronic
1142289203 16:89185053-89185075 GGGGTCAGCCGTGCTGGAACCGG + Intronic
1142319303 16:89370728-89370750 GGTGACTGCTGTGCTGGGAAAGG + Intronic
1142319501 16:89371922-89371944 GCAGCCTCCTGTTCTGTAACAGG - Intronic
1142354807 16:89597334-89597356 GGATCCTGGTGTGCTGGGCCTGG - Intergenic
1143150687 17:4806508-4806530 AGAGCCTGCTCAGCTGGAATTGG - Intergenic
1144288852 17:13806278-13806300 GTAGTCTGCTATGGTGGAACAGG + Intergenic
1144619530 17:16808399-16808421 GGGGCCTGCAGAGCTGGGACTGG - Intergenic
1144675447 17:17158684-17158706 GGAGCCTGGGGAGCTGGAGCGGG + Exonic
1144702827 17:17349944-17349966 GGAGCTTGCTGAGGTGGAAATGG + Intergenic
1144792741 17:17870313-17870335 TAAGTCTGCTGTTCTGGAACAGG - Intronic
1147248750 17:39139771-39139793 GGACCGTGCGGGGCTGGAACCGG - Exonic
1147282910 17:39377436-39377458 AGAGCCAGCTGTGCGGGAAACGG - Intronic
1147320020 17:39640471-39640493 GGAGGATCCTGTGCTGAAACCGG + Intronic
1147636595 17:41967781-41967803 GGAGCCTGCGGTTCTGGGACTGG - Intronic
1148180365 17:45600808-45600830 GCAGCCAGCTGTCCTGGCACTGG + Intergenic
1148268535 17:46245086-46245108 GCAGCCAGCTGTCCTGGCACTGG - Intergenic
1152099089 17:78290672-78290694 GGAGCCCGCTGGGCTGGCTCTGG + Intergenic
1152330949 17:79672739-79672761 GGAGCAGGCTGTGCTGGAGGAGG + Intergenic
1152864752 17:82716144-82716166 GGTGCCAGCTGGGCTGGACCAGG - Intergenic
1153339945 18:3963241-3963263 GGAGCCTTTGGAGCTGGAACTGG - Intronic
1153614726 18:6923865-6923887 GGACCCTGCTGTGCAGCAATGGG - Intergenic
1157682710 18:49619449-49619471 GGAGGCAGCTGAGCTGGAAAGGG + Intergenic
1159140744 18:64390982-64391004 GGAGACTGCTGTCCTGAAATTGG + Intergenic
1159189505 18:65023636-65023658 TGAGCCTGATGTTGTGGAACAGG + Intergenic
1159314485 18:66753852-66753874 GGAGCCTGCTAAGCTGGGCCTGG + Intergenic
1160741024 19:685887-685909 GGCCCCTGGTGTGCAGGAACCGG - Exonic
1160949535 19:1658793-1658815 TGAGCCTGCAAAGCTGGAACAGG + Intergenic
1162668894 19:12237992-12238014 GGAAGCTACTGGGCTGGAACAGG + Intronic
1162873804 19:13606015-13606037 TTAGCCTGCTGTGGTGGCACGGG - Intronic
1165080133 19:33302153-33302175 GCTGCCGGCTGTGCTGGAACAGG + Exonic
1165775267 19:38400662-38400684 GGAGGCTGCTGTGATGGTTCAGG + Intergenic
1165899630 19:39163052-39163074 GGAGCCTGCTGTGCCGGGACGGG + Intronic
1165992997 19:39826685-39826707 GGAGCTGGCGGTGCTGGAAGAGG + Exonic
1166002651 19:39887002-39887024 GGAGTCTGCAGAGCTGGAAAGGG + Intronic
1166005437 19:39903254-39903276 GGAGTCTGCAGAGCTGGAAAGGG + Intronic
1166429153 19:42709305-42709327 GGGGCCAGGTGTGCTGGCACAGG + Intronic
1166479772 19:43161392-43161414 GGGGCCAGCTGTGCTGGCACAGG + Intronic
1167428532 19:49441763-49441785 GGAGCCAGGGGTGATGGAACAGG - Intronic
926202548 2:10812423-10812445 GGAGCCTCGTGCGCTGGAGCCGG - Intronic
926337064 2:11871710-11871732 GGAGCCTGGTATCCTGGAGCAGG - Intergenic
927595459 2:24392992-24393014 GGAGGCTGCTGTGTTGGTAGTGG + Intergenic
928793858 2:34992154-34992176 GGTGCCTGCTGGGCTTGATCAGG + Intergenic
929528173 2:42725770-42725792 GGATTCTGCAGTGCTGGAGCAGG - Intronic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
934047727 2:88186227-88186249 GGAGGCTGCTCAGCTGGATCTGG + Exonic
935087240 2:99859874-99859896 GGAGCCTGGTCTGCTAGGACTGG - Intronic
940007279 2:149019526-149019548 GGAGCCTACTGTGCTGTAGATGG - Intronic
941013013 2:160322715-160322737 GGAGCCTCTTGTGCTGGAAGTGG - Intronic
941693549 2:168527104-168527126 GGAGGCTGCTTGGCTGGAAGAGG + Intronic
941909331 2:170747917-170747939 GCAGTCTGCTGTGCTGATACAGG + Intergenic
942316668 2:174702710-174702732 GGAGCCTGGTGTGGTGGTGCCGG - Intergenic
942941463 2:181623677-181623699 GGAGCATGCTGTGTAGGTACGGG + Intronic
944615395 2:201453798-201453820 GGAGTTTGCTGTGCTGCAAAAGG - Intronic
945768354 2:214008596-214008618 TCAGCCTGGTGTGCTGGCACAGG + Intronic
948359923 2:237412866-237412888 GGAGTCTGCTGTGCTGGATGGGG - Intronic
948598623 2:239096048-239096070 GGAGGCTACTGTTCTGGAGCAGG - Intronic
948829842 2:240593276-240593298 GGAGCCTGCTGAGGTGGCAAGGG + Intronic
949001811 2:241619108-241619130 GGAGCCTGCAGGGCTGGGAGGGG - Intronic
1169630747 20:7627922-7627944 GGAGCCTCCTGAGCTGAGACTGG - Intergenic
1170461434 20:16580436-16580458 GGGGCCTGCTTTGCTGTGACTGG - Intergenic
1170479982 20:16755811-16755833 GGAGCCTTCTGAGCTGCAACTGG + Intronic
1170824831 20:19784677-19784699 GGAGCCTGCCTGGCTGGACCTGG - Intergenic
1170942400 20:20859354-20859376 GGAGGCTGCTGTGAGGGCACAGG + Intergenic
1173958277 20:47051642-47051664 GGAGCCAGCTAAGCTGGAAGGGG - Intronic
1175330594 20:58161425-58161447 GGAGCTTTCTGTGCTGGACTGGG - Intergenic
1177198579 21:17929546-17929568 GCAGCCTGCTGAGCTGGGATTGG + Intronic
1178139820 21:29669998-29670020 AGAGGCTGCTGTGCTTGAAACGG - Intronic
1178469604 21:32880485-32880507 GGTGCCAGCTTTGCTGAAACAGG + Intergenic
1179224688 21:39443344-39443366 AGAGCCAGCTGAGATGGAACAGG + Intronic
1179962959 21:44781202-44781224 GGAGCCAGCTGAGCTGGAGACGG + Intronic
1180104840 21:45611550-45611572 TGAGTCTGATTTGCTGGAACCGG + Intergenic
1180125420 21:45786946-45786968 GCAGCCTGCTGGGATGGAAAGGG + Intronic
1180150106 21:45943030-45943052 TGAGCCTGCAGAGCTGGGACAGG - Intergenic
1180831789 22:18910444-18910466 GGTGCCAGGTGTGCTGGGACTGG + Intronic
1182552302 22:31106989-31107011 GGAGCCTCCAGCCCTGGAACCGG + Intronic
1183078871 22:35443689-35443711 GGAGGCTGCAGGGCTGGAAGTGG - Intergenic
1184244338 22:43228333-43228355 GGAGCATGCACTGCTGGAGCCGG - Intronic
1203281869 22_KI270734v1_random:135715-135737 GGTGCCAGGTGTGCTGGGACTGG + Intergenic
949133608 3:536029-536051 GGCGCCTGCTGGGCTTGATCGGG - Intergenic
950520104 3:13493079-13493101 GGAGCCTGACCTGCTGGATCTGG + Intronic
950679196 3:14573418-14573440 GGATCCTGGTGTGCAGGAAGAGG + Intergenic
950833053 3:15894014-15894036 GGGAGCAGCTGTGCTGGAACTGG + Intergenic
953083861 3:39647760-39647782 GGACCCAGCTGAGCTGTAACTGG - Intergenic
953405357 3:42657148-42657170 GGAGGCTGCTGTGGTAGAGCCGG + Intronic
953626904 3:44579285-44579307 GGAGCCTGGGGAGCTGGAGCGGG - Intronic
953899624 3:46832685-46832707 GAAGACTTCTGTCCTGGAACTGG - Intronic
956431800 3:69193852-69193874 GGATCCTGCTTTGCAAGAACTGG - Exonic
957052498 3:75421183-75421205 CGAGCCTACTGTACTGAAACAGG - Intergenic
957146806 3:76434951-76434973 GGAGCCAGCTGTACTTGAACTGG + Intronic
958919507 3:100088182-100088204 GGAGCTTGCTGGGATGGAAAAGG + Intronic
960057892 3:113288784-113288806 GGAGCCCGCTGTGGTGGGACAGG + Exonic
961200032 3:125038328-125038350 AGAGCTTGCTGTGCTGGAGGTGG - Intronic
961816656 3:129554475-129554497 GGAGCCAGCAGGGCTGGAAAGGG + Intergenic
962827498 3:139110699-139110721 GGAGGCTGCTGTGGCTGAACAGG - Intronic
962896726 3:139722121-139722143 GGAGCCTTTTGTCCTGGAAAAGG - Intergenic
965551140 3:169966622-169966644 CGCTCCTGCTGTGCGGGAACTGG - Intronic
967137153 3:186522064-186522086 GGAGCATGATGTGCTGGAAAGGG - Intergenic
967282142 3:187833026-187833048 GGGCCCTGCTGTGCTGGAGCAGG + Intergenic
969116435 4:4873220-4873242 GGCCCCTGCTGTGCTGGGAAAGG + Intergenic
969879211 4:10159090-10159112 GGAGGCCTCTGTGCTGGAGCAGG - Intergenic
971172214 4:24245120-24245142 GCAGCCTGTTGTGCTGTCACTGG - Intergenic
972784632 4:42315316-42315338 GGCGCCTGCTGGGCTTGATCTGG - Intergenic
972790854 4:42369745-42369767 GGCGCCTGCTGGGCTTGATCAGG + Intergenic
975033905 4:69658191-69658213 AGAGCCTGCTGGGCTTGATCAGG - Intergenic
982630241 4:157822110-157822132 GGTGCCTGCTGGGCTTGATCAGG + Intergenic
983660652 4:170127857-170127879 GGCGCCTGCTGGGCTTGATCTGG - Intergenic
985731442 5:1551520-1551542 GGCACCTGCCGTGCTGGAGCTGG + Intergenic
985908808 5:2863436-2863458 GGAGCCTGGTGTCCTGGCACTGG + Intergenic
986284454 5:6349119-6349141 GGAGCCCGGTGAGATGGAACAGG - Intergenic
986903797 5:12468618-12468640 GGAACCTGCTGTACTGGAGGGGG - Intergenic
988898288 5:35702143-35702165 GGATCCTGCTGGTCTGGAAGGGG - Intronic
989070580 5:37506822-37506844 GGGGGCTGCTGTTCAGGAACAGG + Intronic
992106626 5:73453410-73453432 AGAGGCTGCTGACCTGGAACAGG - Intergenic
992323310 5:75635730-75635752 GGAGCATGCTCTCCTGGCACAGG + Intronic
994455230 5:99997352-99997374 GGAGTCTGGTGTTCTGAAACTGG + Intergenic
998568903 5:143239719-143239741 AGTCCCTGGTGTGCTGGAACTGG + Intergenic
1002258917 5:177981045-177981067 GGAGCCAGCCGTGCCGGGACTGG + Intergenic
1004811816 6:19270881-19270903 GGCGCCTGCTGGGCTTGATCAGG + Intergenic
1005599540 6:27412170-27412192 AGAGCTTGGTGTCCTGGAACTGG + Intergenic
1005962346 6:30703232-30703254 AGAGCGGGCTGTGCTGGCACTGG - Exonic
1006727685 6:36211502-36211524 GGATGCAGCTGTGCTGGAGCAGG + Exonic
1007236126 6:40392401-40392423 GGAGGCTGCGGGGCTGGGACGGG - Exonic
1007878987 6:45140661-45140683 GCAACCTGCTGTGCTGGAGGTGG - Intronic
1008511035 6:52276082-52276104 GGATTCTGCTGTGCAGGAATGGG + Intronic
1010864676 6:80960174-80960196 TGTGCCTGATGTGCTGGAATGGG + Intergenic
1011311244 6:85981800-85981822 CTAGCTTGCTGTCCTGGAACTGG - Intergenic
1012668936 6:102015781-102015803 GGGACCTGCTGTGCTGGAGGCGG - Intronic
1012789681 6:103677370-103677392 GGTGCCTGCTGGGCTTGATCGGG - Intergenic
1014049106 6:116930983-116931005 GGAGGCTGCTGTGTTGGTCCAGG + Intronic
1014715424 6:124859534-124859556 GGAGACTGCTGTGGTGACACAGG + Intergenic
1016390066 6:143565779-143565801 GGAGCCTGCCAAGCTGGATCTGG + Intronic
1017017787 6:150115886-150115908 GGCGCCTGCTGGGCTTGATCCGG - Intergenic
1018048281 6:159984445-159984467 GGAGCCTGCAGGACTGGAAGCGG - Intronic
1018787018 6:167116405-167116427 GCTGCCTCCTGTGCTGGAAAGGG - Intergenic
1018899164 6:168042670-168042692 TGAGCCTGCTGTTCCGGTACGGG - Exonic
1019906251 7:4067366-4067388 GGAGCCTGGAGTTCTGGACCAGG + Intronic
1021006169 7:15397260-15397282 GGCGCCTGCTGGGCTTGATCAGG - Intronic
1021692016 7:23239920-23239942 GGAGCCTGTAGTGCTGTAAGAGG - Intronic
1022467327 7:30660669-30660691 GGGGCCTCCTGAGCTGGAACTGG + Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1024222540 7:47299769-47299791 GGAGCCTGGTGTGCTGAAGTTGG + Intronic
1024553871 7:50586089-50586111 GGAGCGTGCTGATCTAGAACAGG - Intergenic
1028209361 7:88054439-88054461 GGAGGGAGCTGTGGTGGAACAGG - Intronic
1031618015 7:123903844-123903866 GCAGCCTGCTGTGGTGGTGCAGG + Intergenic
1032253179 7:130275408-130275430 GGAGCCTGGGGTGCTGGATGGGG - Intronic
1033422949 7:141218871-141218893 GGAGCAGGCTGGGCTAGAACTGG - Intronic
1035238446 7:157515185-157515207 GGAGCCTGCTGAGGGGTAACAGG + Intergenic
1036207367 8:6815137-6815159 GAAGCCTGCTGTGCTGGGAGAGG + Intronic
1036664455 8:10729942-10729964 GGAGGCTCCTCTGCTGGGACAGG - Intronic
1036837653 8:12088865-12088887 GGTGCCTGCTGGGCTTGACCGGG + Intergenic
1036859446 8:12335113-12335135 GGTGCCTGCTGGGCTTGACCGGG + Intergenic
1038215403 8:25557560-25557582 GGAGCATGCTGTGATGGCATTGG + Intergenic
1038258452 8:25972149-25972171 GGAGCATGCTGACCTGGAGCGGG + Intronic
1041411404 8:57560451-57560473 GAAGCCTGCTGTGGTGGAGAGGG + Intergenic
1041710599 8:60890834-60890856 GAAGCCTGCTGTGAGGGAACGGG + Intergenic
1042878462 8:73461790-73461812 AGAGCCTGCAGGGATGGAACTGG + Intronic
1043002086 8:74771849-74771871 GGCGCCTGCTGGGCTTGATCCGG - Intronic
1044457086 8:92401392-92401414 GGGGCCTGCTGGGCTTGATCAGG - Intergenic
1045059646 8:98400572-98400594 GGAGCCAGCAGTGCTGGAAATGG - Intergenic
1045297194 8:100882388-100882410 GGGGCCTGCTGTCCTAGTACCGG - Intergenic
1046055211 8:109071053-109071075 GGCGCCTGCTGGGCTTGATCGGG - Intergenic
1047642212 8:126832873-126832895 GGATCAGGCTGTGCTGGGACTGG - Intergenic
1048371017 8:133776283-133776305 GGAGGCTGCTGGGCAGGAGCTGG - Intergenic
1048703036 8:137115858-137115880 GGCGCCTGCTGGGCTTGATCAGG - Intergenic
1049205116 8:141360056-141360078 TGAGCCTGCTGGGCTGGCCCTGG - Intronic
1049454698 8:142680989-142681011 GGAAGCTGCAGTGCTGGGACTGG - Intronic
1049827182 8:144676696-144676718 GGCGCCTGCTGGGCTTGATCTGG - Intergenic
1050406559 9:5314620-5314642 GTACCCTGCTTTCCTGGAACTGG + Intergenic
1051944416 9:22549806-22549828 GGTGCCTTCTGCGCTGCAACTGG + Intergenic
1052772030 9:32698784-32698806 GGACACTGCTCTGGTGGAACCGG + Intergenic
1053403110 9:37845755-37845777 GCAGATGGCTGTGCTGGAACAGG - Intronic
1053819663 9:41953379-41953401 GGAGTCTGCTGAGCAGAAACGGG + Exonic
1054109930 9:61097032-61097054 GGAGTCTGCTGAGCAGAAACGGG + Intergenic
1054610927 9:67234093-67234115 GGAGTCTGCTGAGCAGAAACGGG - Intergenic
1056899092 9:90582344-90582366 GGAGGCTCCTGGGCTGGAGCAGG + Intergenic
1057689516 9:97271332-97271354 GGCGCCTGCTGGGCTTGATCGGG - Intergenic
1058458511 9:105160641-105160663 GATGGCTGCTGTCCTGGAACAGG - Intergenic
1059053238 9:110952174-110952196 GCAGCCTGCTGTTCTGGGACTGG + Intronic
1060247574 9:121959139-121959161 TGAGCATGCTGAGGTGGAACAGG + Intronic
1060526927 9:124326093-124326115 GGAGCTTGCTGGGTTGGGACAGG + Intronic
1061889849 9:133612947-133612969 GGTGCCAGCTGTGCTGCAAGTGG - Intergenic
1061987825 9:134140366-134140388 GGGGCCTCCTGTGCTGTAGCAGG + Intronic
1062036744 9:134385839-134385861 GCAGCCAGCTGTGGTGGAGCTGG + Intronic
1062663466 9:137653134-137653156 GGAGCTTGCAGGGCTGGAATTGG - Intronic
1185449594 X:275353-275375 GGCGGCTGCTGTCCTGGCACAGG - Intergenic
1189162264 X:38821527-38821549 TGAGCCTGCTGTTCAGGAAAGGG + Intergenic
1189660013 X:43286524-43286546 GCAGCCTGCTGAGCTGGGACTGG - Intergenic
1193953939 X:87835398-87835420 GGAGCCAGCTGTGTAGGTACTGG + Intergenic
1194872192 X:99146380-99146402 GCAGCCTGCTTGGCTGGAATTGG + Intergenic
1196006989 X:110847281-110847303 CGACCCAGCTGTACTGGAACAGG + Intergenic
1196055698 X:111352385-111352407 GAAGCCTGCTGAGATGGAGCTGG - Intronic
1197309377 X:124884585-124884607 GCAGCCTGCTCAGCTGGAATGGG - Intronic
1197654864 X:129106075-129106097 GGAGGCTGCTGTAATGGTACAGG - Intergenic
1199786538 X:151111646-151111668 GGACCCTGCTGTGCTTGAAGGGG + Intergenic
1201354218 Y:13081301-13081323 GCAGCCTGCTTGGCTTGAACTGG + Intergenic
1201486156 Y:14496539-14496561 GGAGGGTGCTGTCCTGGGACAGG + Intergenic
1201926437 Y:19293085-19293107 AGAGCCTGCAGTTGTGGAACTGG + Intergenic