ID: 929921258

View in Genome Browser
Species Human (GRCh38)
Location 2:46173130-46173152
Sequence GTGCAGCCCTAGAATAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929921255_929921258 -8 Left 929921255 2:46173115-46173137 CCACCACCTGCTTTTGTGCAGCC 0: 1
1: 1
2: 10
3: 56
4: 354
Right 929921258 2:46173130-46173152 GTGCAGCCCTAGAATAAGAATGG 0: 1
1: 0
2: 1
3: 15
4: 131
929921252_929921258 3 Left 929921252 2:46173104-46173126 CCAAATCCAGCCCACCACCTGCT 0: 4
1: 16
2: 116
3: 315
4: 939
Right 929921258 2:46173130-46173152 GTGCAGCCCTAGAATAAGAATGG 0: 1
1: 0
2: 1
3: 15
4: 131
929921250_929921258 10 Left 929921250 2:46173097-46173119 CCCAGGGCCAAATCCAGCCCACC 0: 2
1: 6
2: 84
3: 229
4: 670
Right 929921258 2:46173130-46173152 GTGCAGCCCTAGAATAAGAATGG 0: 1
1: 0
2: 1
3: 15
4: 131
929921254_929921258 -7 Left 929921254 2:46173114-46173136 CCCACCACCTGCTTTTGTGCAGC 0: 1
1: 2
2: 14
3: 55
4: 367
Right 929921258 2:46173130-46173152 GTGCAGCCCTAGAATAAGAATGG 0: 1
1: 0
2: 1
3: 15
4: 131
929921253_929921258 -3 Left 929921253 2:46173110-46173132 CCAGCCCACCACCTGCTTTTGTG 0: 1
1: 10
2: 28
3: 139
4: 642
Right 929921258 2:46173130-46173152 GTGCAGCCCTAGAATAAGAATGG 0: 1
1: 0
2: 1
3: 15
4: 131
929921251_929921258 9 Left 929921251 2:46173098-46173120 CCAGGGCCAAATCCAGCCCACCA 0: 1
1: 4
2: 16
3: 59
4: 336
Right 929921258 2:46173130-46173152 GTGCAGCCCTAGAATAAGAATGG 0: 1
1: 0
2: 1
3: 15
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929921258 Original CRISPR GTGCAGCCCTAGAATAAGAA TGG Intronic
901309872 1:8261046-8261068 GTGCAGCCCTAGGACTAGAGAGG - Intergenic
903235559 1:21948563-21948585 ATACAGCCCTGGAATGAGAAGGG + Intergenic
908817355 1:68047900-68047922 GTGCAGCCCCAGAAGAGGCATGG + Intronic
909584467 1:77274153-77274175 ATGGAGTACTAGAATAAGAATGG - Intergenic
909606728 1:77515604-77515626 CTGCAGCCCAAGAGTAAGACAGG + Intronic
911846214 1:102754402-102754424 GTACAACTCTAGAATTAGAAAGG + Intergenic
921141982 1:212317094-212317116 GTCAAGTCCTAGAATAAAAAGGG - Intronic
1071755044 10:88527899-88527921 GTGCATCCAGAAAATAAGAAAGG + Intronic
1073938911 10:108670743-108670765 GTAGAGCCCTAGAATTAAAATGG - Intergenic
1074122788 10:110505615-110505637 TTCCTGCCCTGGAATAAGAACGG - Intronic
1079080780 11:17412352-17412374 ATGCAGCCCGACTATAAGAATGG - Intronic
1079345918 11:19652262-19652284 GAGCAGCCCTGGAATGAGGATGG - Intronic
1082869808 11:57933764-57933786 CTGCAGCTCTTGGATAAGAAGGG + Intergenic
1085106148 11:73844801-73844823 CTTCAGCCCAAGAAGAAGAAGGG + Exonic
1085491369 11:76921337-76921359 GGGCAGCCCTTGAACCAGAATGG + Intronic
1085829904 11:79888424-79888446 GTGCAACACTATAATAATAATGG - Intergenic
1086152867 11:83632082-83632104 GGGCTTCCCTGGAATAAGAAGGG + Intronic
1086592390 11:88531308-88531330 GTGAAGCGGTTGAATAAGAAGGG + Intronic
1088726541 11:112642147-112642169 GTACAGCCCTTGATTAAGAATGG - Intergenic
1089694713 11:120210162-120210184 GTGCACCCCAACAATAAGAAGGG - Intergenic
1092754768 12:11753068-11753090 ATGCAGGCCTAGAAAACGAAGGG - Intronic
1093225319 12:16476149-16476171 ATGCAGCCAAAGACTAAGAAAGG + Intronic
1094131933 12:27083903-27083925 GTGAAGCCCCAGAGTAAGTAGGG + Intergenic
1095915516 12:47474492-47474514 GTGAAGCCCTAGAACAGGACAGG + Intergenic
1097156844 12:57018168-57018190 GTGGAGCCCTTTAATAAAAAGGG - Intronic
1097192441 12:57225983-57226005 GTGCAGCCCCAGAATAGGCGGGG + Exonic
1097913709 12:64997887-64997909 GTGGAGCCCTAGGATGAGACTGG - Intergenic
1099468746 12:83020235-83020257 GTTGAGCCCTAGAATGAAAATGG - Intronic
1107104675 13:36630487-36630509 GTGCTCCCCAAGAAGAAGAATGG + Intergenic
1107263250 13:38520139-38520161 CTGCAGCCATAGAACATGAAAGG - Intergenic
1107723547 13:43274921-43274943 TTGGAGCCCTAGAATAAGTGAGG + Intronic
1109421567 13:62118640-62118662 GTGCAGCAGTAGAGAAAGAAGGG - Intergenic
1110162054 13:72390169-72390191 ATGCAGCCTGAAAATAAGAAAGG + Intergenic
1112299580 13:98217899-98217921 GTGCTGTCCTAGCATAACAAGGG + Intronic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1113491540 13:110696108-110696130 GTGCAGCCATAGAAAAGGATGGG - Intronic
1113852143 13:113423899-113423921 GTGCAGCCTTAGAATAGGTGGGG - Intronic
1114955601 14:27814421-27814443 ATGCAGCCCTAGAAAATGAAAGG - Intergenic
1116221121 14:42088744-42088766 ATGGAGCCCAAGAATATGAATGG - Intergenic
1116299992 14:43166836-43166858 GTACAAGGCTAGAATAAGAAGGG + Intergenic
1117578277 14:57123875-57123897 GTCCAGGCATAGAAAAAGAATGG + Intergenic
1122868210 14:104619755-104619777 GAGCAGTCCAAGAATAAGACAGG + Intergenic
1131205885 15:90446452-90446474 GTGCAGTCATAGAATAAAGAAGG + Intronic
1131480234 15:92774459-92774481 TTGCAGCCATAAAAAAAGAATGG + Intronic
1133187615 16:4111163-4111185 GGGCATCCATAGAATGAGAAGGG - Intronic
1133488904 16:6248222-6248244 TTGGAGGCCTAGAATTAGAATGG + Intronic
1140030893 16:71338357-71338379 GTGGAGCTCCAGAAAAAGAAAGG - Intergenic
1140887075 16:79253635-79253657 GTGGAGCCCAAGATGAAGAAAGG - Intergenic
1143600111 17:7939640-7939662 GGGCTGCCCTAGAAGAAGAACGG + Exonic
1146540301 17:33687682-33687704 CTGCAGCCAGAGAATAAGAGAGG + Intronic
1147651430 17:42064236-42064258 GAGCAGCCCCAGAATAGAAATGG - Intronic
1148210748 17:45807011-45807033 GTTCAGCCCCAGAAGGAGAAGGG - Exonic
1149375506 17:56040016-56040038 GTTCATCCCAAGGATAAGAAAGG - Intergenic
1149620293 17:58039779-58039801 GTGCAGCCACAGAAGAAGGAGGG + Intergenic
1153204842 18:2687640-2687662 ATGCAGCTCTAGAAAGAGAAGGG - Intronic
1153959762 18:10130818-10130840 CTGCAGGCCTAGAGTAGGAAGGG - Intergenic
1157045951 18:44102088-44102110 GTGCAGCATTACTATAAGAAAGG + Intergenic
1162189482 19:8933508-8933530 GTGAACCCCCACAATAAGAAGGG - Intronic
1162673210 19:12276207-12276229 GTGCAGACACAGAATAAGAGTGG - Intronic
925382998 2:3440051-3440073 GTGTGGTCCTAGAAAAAGAACGG - Intronic
925831589 2:7901281-7901303 GTCAAGCCACAGAATAAGAAAGG + Intergenic
928014265 2:27640104-27640126 GTGCTGCCGAAGAATATGAAAGG + Exonic
928249891 2:29666392-29666414 GTTGAGTCATAGAATAAGAAAGG + Intronic
929921258 2:46173130-46173152 GTGCAGCCCTAGAATAAGAATGG + Intronic
929926076 2:46210914-46210936 TTGGAGTCCTAGAAGAAGAAGGG - Intergenic
930805175 2:55483278-55483300 GTGCAGTTCTGGAATAAGATAGG - Intergenic
931334230 2:61322559-61322581 GTGGTGCCCTAGAACCAGAAGGG + Intronic
933289573 2:80423285-80423307 GTACAGCACTAAAATAAGAAAGG - Intronic
934561865 2:95317693-95317715 GGGGAGTCCTAGAAAAAGAAAGG + Intronic
941633004 2:167904911-167904933 AAGCAGCCCTAGAAAGAGAAAGG + Intergenic
942143025 2:172996999-172997021 GGGCAGCCCTAGCAAACGAATGG - Intronic
942825241 2:180167886-180167908 ATGCAGTCCTGGAAAAAGAATGG + Intergenic
943398868 2:187378698-187378720 GTGAAGACATATAATAAGAAGGG - Intronic
943603656 2:189950853-189950875 GGGCAGCCCTAAACCAAGAAGGG - Intronic
943794152 2:191970684-191970706 TGGCAGCCCTAGAAAAAGTAGGG + Intronic
946466139 2:219913822-219913844 GTGCAGCCCAATCATCAGAATGG + Intergenic
947784830 2:232807604-232807626 GAGCAGCCCAAGAGGAAGAAGGG - Intronic
1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG + Intronic
1173083491 20:39892200-39892222 CTGCAGCTCTAGAAGAAGCATGG + Intergenic
1173207400 20:41005884-41005906 GGGTAGTCCTAGAATAGGAAGGG - Intergenic
1177300814 21:19243858-19243880 ATGCAGCCTTAGAAGAATAAAGG - Intergenic
1181858280 22:25798496-25798518 GGGCAGCTCTAGAATATGCAAGG + Intronic
950065239 3:10107054-10107076 GGGCTGCCTTAGAATGAGAAAGG + Intronic
951046582 3:18046332-18046354 GTCCAGCCCAAGCACAAGAAAGG - Intronic
951485826 3:23208805-23208827 GTTCAGCCCAAGAAAAAGGAGGG + Exonic
954384947 3:50239051-50239073 GAGCATCCCTAGAATAGGACTGG - Intronic
955218091 3:57001434-57001456 GTGATTCCCTAGAACAAGAATGG - Intronic
955289169 3:57674782-57674804 ATGCAGCCATAAAAAAAGAATGG + Intronic
956091753 3:65674981-65675003 GTGCAGCTCTGGAATATCAATGG - Intronic
957116630 3:76035151-76035173 GTCCAGCCATAGAAAAAGATAGG - Intronic
966259196 3:177955323-177955345 TTGCAGACTTGGAATAAGAAAGG + Intergenic
967209103 3:187150732-187150754 GTGCAGCCCTAGAACACTCAAGG - Intronic
970023061 4:11590650-11590672 GAGCTGCCCTATAATAAGAGAGG + Intergenic
971457256 4:26857163-26857185 ATGAAGCCCTAGCATAAAAATGG - Intergenic
971588749 4:28439670-28439692 GTGCAGCCAACAAATAAGAATGG + Intergenic
976742881 4:88375445-88375467 GTTCAGCCATAAAAAAAGAATGG + Intergenic
977626785 4:99196491-99196513 CTGCAGCCCCAGAAAGAGAATGG - Intergenic
979784922 4:124704575-124704597 CTGAAGCTCTTGAATAAGAAAGG - Intronic
982333936 4:154213082-154213104 GTGCAACGCTAGATTAATAATGG - Intergenic
986835167 5:11629077-11629099 GTGGATCCCTAGAGTAGGAAAGG - Intronic
987726759 5:21712173-21712195 CTGAAGCACTAGAATTAGAAGGG + Intergenic
988124548 5:27012446-27012468 GTACAGCCCCAGAATATTAACGG - Intronic
992726167 5:79609351-79609373 CTGCAGCCCCAGAAAGAGAATGG - Intergenic
997117841 5:131145244-131145266 ATGCAGCCATAAAAAAAGAATGG + Intergenic
997667481 5:135643297-135643319 GTTCAGCCCCAGACTGAGAAGGG - Intergenic
998656739 5:144189594-144189616 TTGCAGACCTAGGTTAAGAATGG + Intronic
1003142992 6:3487185-3487207 GTGCAGGCCTGGAATGGGAAAGG - Intergenic
1003521656 6:6863313-6863335 TTGCAACCCCAGAATAAGAAGGG - Intergenic
1007651769 6:43427072-43427094 ATGCAGCCCTAGAATAATAAGGG + Intergenic
1007858321 6:44880665-44880687 GGGCAGCCAGAGAGTAAGAAAGG + Intronic
1009619263 6:66051585-66051607 GTGCAGAACTAGACTAAGTAAGG - Intergenic
1011383969 6:86773631-86773653 TTGCAGCCCTGGAAGAAGAAGGG + Intergenic
1014596860 6:123354469-123354491 TTACAGCCCTAAAATAAGATTGG - Intronic
1017488178 6:154921789-154921811 ATGCAGCCCAAGAATGAGAAAGG - Intronic
1017805716 6:157943763-157943785 GAGGAGCCAAAGAATAAGAAAGG - Exonic
1021707726 7:23384552-23384574 ATGCAGCCCTTTAAAAAGAATGG + Intronic
1022193864 7:28044671-28044693 CTCCAGCCATAGAATCAGAAAGG - Intronic
1024657195 7:51460899-51460921 ATGCAGCCGTGGAATAATAAAGG + Intergenic
1026547971 7:71340547-71340569 GTCCTGCTCTAAAATAAGAAAGG + Intronic
1030886771 7:114948231-114948253 GTGCAGCCTGGGAGTAAGAAGGG - Intronic
1031919746 7:127591829-127591851 TTCCAGCCCAAGAATAAGGAGGG - Intronic
1034020496 7:147636875-147636897 GAGCAGCTGTAGAATAGGAAAGG + Intronic
1035154811 7:156903834-156903856 TTGCAGACCTAGAATTAGGATGG - Intergenic
1035239469 7:157520414-157520436 GTGCAGCCCCAGCATAGGGAGGG - Intergenic
1037873408 8:22521483-22521505 GTGGAGCCCAAGACTAGGAAGGG - Intronic
1039154248 8:34537144-34537166 GTGCAGCCAGAGAAAAAGATTGG + Intergenic
1044069026 8:87732809-87732831 GTGTAGCTCTAGAAAAAGATAGG - Intergenic
1044966925 8:97582786-97582808 GTGCAGCTCTAGAATGAGGTGGG - Intergenic
1045359066 8:101415218-101415240 GTGCAGCCCTGGAATGAAACTGG + Intergenic
1046681106 8:117171232-117171254 GGGCAGCTCTACAAAAAGAAGGG - Intronic
1047178474 8:122565007-122565029 ATGCAGCCCTAGGATAAAATGGG - Intergenic
1052150859 9:25113616-25113638 GTGCAACCCTAACATGAGAAAGG + Intergenic
1053676160 9:40430460-40430482 ATGCAGCCCTAGAAAATGAAAGG - Intergenic
1053925933 9:43056572-43056594 ATGCAGCCCTAGAAAATGAAAGG - Intergenic
1054287560 9:63194433-63194455 ATGCAGCCCTAGAAAATGAAAGG + Intergenic
1054289228 9:63265984-63266006 ATGCAGCCCTAGAAAATGAAAGG - Intergenic
1054387261 9:64570531-64570553 ATGCAGCCCTAGAAAATGAAAGG - Intergenic
1054508462 9:65945834-65945856 ATGCAGCCCTAGAAAATGAAAGG + Intergenic
1055177837 9:73342154-73342176 GTGCTGCCCTAGAATAAAGTGGG - Intergenic
1055855203 9:80677908-80677930 GTGCAGTCTTAGTATAAAAATGG + Intergenic
1056569029 9:87799688-87799710 GGGCAGACCTAGAAGAAGCAGGG + Intergenic
1059650505 9:116311997-116312019 TTGAAGCCCAAGAATAAGCAAGG + Intronic
1187469638 X:19557368-19557390 GTGTAGCTCAAGAATAAGAGAGG + Intronic
1190213102 X:48462807-48462829 CTGCAGCCCTTGAAAATGAATGG + Intronic
1190644239 X:52510090-52510112 GTGCATCCCAAGAATAATGAAGG + Intergenic
1193736025 X:85157517-85157539 GTGAATCCTTAGAAAAAGAAAGG - Intergenic
1194938885 X:99985456-99985478 TTCCAACCCTAGAAGAAGAAAGG - Intergenic
1200178068 X:154132169-154132191 CAGCTGCCCTAGAACAAGAAAGG - Intergenic