ID: 929923859

View in Genome Browser
Species Human (GRCh38)
Location 2:46193442-46193464
Sequence AGTGAGGATCCCTCATTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929923859_929923866 7 Left 929923859 2:46193442-46193464 CCCCCCAATGAGGGATCCTCACT No data
Right 929923866 2:46193472-46193494 GAAAGGAGCATAAGTCTCCAAGG No data
929923859_929923871 27 Left 929923859 2:46193442-46193464 CCCCCCAATGAGGGATCCTCACT No data
Right 929923871 2:46193492-46193514 AGGCAAGGTTCTGGCCCTCAGGG No data
929923859_929923867 12 Left 929923859 2:46193442-46193464 CCCCCCAATGAGGGATCCTCACT No data
Right 929923867 2:46193477-46193499 GAGCATAAGTCTCCAAGGCAAGG No data
929923859_929923870 26 Left 929923859 2:46193442-46193464 CCCCCCAATGAGGGATCCTCACT No data
Right 929923870 2:46193491-46193513 AAGGCAAGGTTCTGGCCCTCAGG No data
929923859_929923868 18 Left 929923859 2:46193442-46193464 CCCCCCAATGAGGGATCCTCACT No data
Right 929923868 2:46193483-46193505 AAGTCTCCAAGGCAAGGTTCTGG No data
929923859_929923864 -10 Left 929923859 2:46193442-46193464 CCCCCCAATGAGGGATCCTCACT No data
Right 929923864 2:46193455-46193477 GATCCTCACTGCAGACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929923859 Original CRISPR AGTGAGGATCCCTCATTGGG GGG (reversed) Intergenic
No off target data available for this crispr