ID: 929929877

View in Genome Browser
Species Human (GRCh38)
Location 2:46245554-46245576
Sequence TCGTAGCCACTAAGGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929929877_929929883 16 Left 929929877 2:46245554-46245576 CCCTTTGCCCTTAGTGGCTACGA No data
Right 929929883 2:46245593-46245615 TGAGTTTACATGCAATGGTATGG No data
929929877_929929882 11 Left 929929877 2:46245554-46245576 CCCTTTGCCCTTAGTGGCTACGA No data
Right 929929882 2:46245588-46245610 CTCTATGAGTTTACATGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929929877 Original CRISPR TCGTAGCCACTAAGGGCAAA GGG (reversed) Intergenic
No off target data available for this crispr