ID: 929932450

View in Genome Browser
Species Human (GRCh38)
Location 2:46269462-46269484
Sequence GTGTGTGAGGTGGGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929932450_929932463 26 Left 929932450 2:46269462-46269484 CCACCCACCCCCACCTCACACAC No data
Right 929932463 2:46269511-46269533 GCCTCTGCCTCCTGGAGGTAAGG No data
929932450_929932462 21 Left 929932450 2:46269462-46269484 CCACCCACCCCCACCTCACACAC No data
Right 929932462 2:46269506-46269528 TTAATGCCTCTGCCTCCTGGAGG No data
929932450_929932461 18 Left 929932450 2:46269462-46269484 CCACCCACCCCCACCTCACACAC No data
Right 929932461 2:46269503-46269525 TCTTTAATGCCTCTGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929932450 Original CRISPR GTGTGTGAGGTGGGGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr