ID: 929934285

View in Genome Browser
Species Human (GRCh38)
Location 2:46282971-46282993
Sequence TGGAAACTTGCAGGTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929934278_929934285 21 Left 929934278 2:46282927-46282949 CCTAAAAATTTATCTTGGGATTT No data
Right 929934285 2:46282971-46282993 TGGAAACTTGCAGGTTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929934285 Original CRISPR TGGAAACTTGCAGGTTTTGG AGG Intergenic
No off target data available for this crispr