ID: 929934748

View in Genome Browser
Species Human (GRCh38)
Location 2:46286481-46286503
Sequence GAGGGATCCTGGACCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929934748_929934761 12 Left 929934748 2:46286481-46286503 CCTTCCAGGGTCCAGGATCCCTC No data
Right 929934761 2:46286516-46286538 GAGGCCAGGCCAGGGCCACTGGG No data
929934748_929934756 -2 Left 929934748 2:46286481-46286503 CCTTCCAGGGTCCAGGATCCCTC No data
Right 929934756 2:46286502-46286524 TCTGGATCCTAGGAGAGGCCAGG No data
929934748_929934753 -7 Left 929934748 2:46286481-46286503 CCTTCCAGGGTCCAGGATCCCTC No data
Right 929934753 2:46286497-46286519 ATCCCTCTGGATCCTAGGAGAGG No data
929934748_929934757 3 Left 929934748 2:46286481-46286503 CCTTCCAGGGTCCAGGATCCCTC No data
Right 929934757 2:46286507-46286529 ATCCTAGGAGAGGCCAGGCCAGG No data
929934748_929934758 4 Left 929934748 2:46286481-46286503 CCTTCCAGGGTCCAGGATCCCTC No data
Right 929934758 2:46286508-46286530 TCCTAGGAGAGGCCAGGCCAGGG No data
929934748_929934760 11 Left 929934748 2:46286481-46286503 CCTTCCAGGGTCCAGGATCCCTC No data
Right 929934760 2:46286515-46286537 AGAGGCCAGGCCAGGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929934748 Original CRISPR GAGGGATCCTGGACCCTGGA AGG (reversed) Intergenic
No off target data available for this crispr