ID: 929936337

View in Genome Browser
Species Human (GRCh38)
Location 2:46297072-46297094
Sequence GGGGAGAGGCAGCCTGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 438}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929936337 Original CRISPR GGGGAGAGGCAGCCTGCGCA GGG (reversed) Intronic
900732146 1:4269081-4269103 GAGGAGAGGCAGCCAGGGCCCGG + Intergenic
900780405 1:4614171-4614193 GGGGAGAGGCGGCGTGACCACGG + Intergenic
901099495 1:6708380-6708402 GGGAAGAGGCAGGCTGGGGAGGG + Intergenic
901183328 1:7356618-7356640 GGGGACAGACAGCCTGCTGATGG - Intronic
901303665 1:8217324-8217346 GGGGAGCGGCCGCCCGCGCACGG + Intergenic
901535756 1:9882126-9882148 GGGGAGAGGCTGGCTGCCAATGG + Intronic
902246223 1:15122602-15122624 GGGGAGAGGAAGCCTGTGTTGGG - Intergenic
902255851 1:15188190-15188212 GGGGAGAGGCTGCCTGAGGAGGG - Intronic
902643034 1:17778964-17778986 GGGGAGAGGCAGGCAGGGCCTGG - Intronic
902671503 1:17977652-17977674 CGGAAGAGGAAGCCTGAGCAGGG + Intergenic
902756620 1:18553214-18553236 GGGGTCAGGCAGCCTGCAGAGGG - Intergenic
903409116 1:23125608-23125630 GGGAAGAGGCAGCCTCTGAATGG - Intronic
903623224 1:24713229-24713251 GGAGAGGGGCAGCCTGGGCACGG - Intergenic
903626042 1:24730782-24730804 GAGGAGACGCAGCAAGCGCAGGG - Intergenic
904422988 1:30405997-30406019 GAGGTTAGGCAGCCTGCCCAAGG + Intergenic
904744258 1:32701744-32701766 TGGCAGAGGCAGGCTGCCCAGGG - Intronic
905309807 1:37041467-37041489 AGGCAAAGGCAGCCTGGGCAGGG + Intergenic
905868897 1:41391767-41391789 GGGCAGAGGCATCCTCCCCAGGG + Intergenic
905974282 1:42163964-42163986 GGGGAAAGACAGCCTGGGCTTGG - Intronic
906331979 1:44893277-44893299 GGGGATAGGCAGCCATGGCAAGG - Intronic
906559841 1:46748433-46748455 TGGGACAGGCAGCAGGCGCATGG + Intergenic
906781606 1:48577636-48577658 GGTGAGAGGCAGTCAGCCCAAGG + Intronic
907409611 1:54274894-54274916 GGCGAGAGGGAGCCTGTGCCAGG - Intronic
907879131 1:58528188-58528210 GGGCACATGCAGCCTGCTCATGG - Intronic
911401370 1:97379257-97379279 GGGGAGAGGCAGGCAGGGCAGGG + Intronic
911611849 1:99967018-99967040 GAGAAGAGGCAGGCTGGGCACGG + Intergenic
913600975 1:120420947-120420969 GGGGAGTGGGAGCCAGTGCAAGG + Intergenic
914086081 1:144455686-144455708 GGGGAGTGGGAGCCAGTGCAAGG - Intronic
914362112 1:146944389-146944411 GGGGAGTGGGAGCCAGTGCAAGG + Intronic
914489514 1:148142566-148142588 GGGGAGTGGGAGCCAGTGCAAGG - Intronic
914589880 1:149097587-149097609 GGGGAGTGGGAGCCAGTGCAAGG - Intronic
914826683 1:151142540-151142562 GGGGAAAGGCGGCCTGAGTATGG + Exonic
915529721 1:156496405-156496427 GGGCAGAGGCAGGCTGTGCCAGG + Intronic
915841336 1:159215881-159215903 GGGCAGAGGGAGCCTGGGAAAGG - Intergenic
915962520 1:160279073-160279095 GGGGAGAAACAGCCTGGGCTGGG - Exonic
916414047 1:164576441-164576463 CGGGAGAGGGAGCCGGTGCAAGG - Intronic
916793476 1:168144918-168144940 GTGGAGAGAAAGCCTGCTCAGGG - Intergenic
917091287 1:171355939-171355961 GGGGAGAGGAAGCCTGCAGGAGG - Intergenic
918984695 1:191608803-191608825 GGGGAGACGAAGACTGCACAAGG + Intergenic
920532301 1:206712560-206712582 TGGGAGAGGCAGTCTGTGCTAGG - Intronic
922782467 1:228264034-228264056 GGGGAGAGAAGGCCTGGGCAGGG - Intronic
922908841 1:229198367-229198389 GGGGAGAAGCAACTTGCCCAAGG + Intergenic
922950200 1:229552821-229552843 AGAGAGAGGGAGCCTACGCAAGG + Intronic
923052244 1:230396816-230396838 GCGGAGAGGCACCCTCCCCATGG + Intronic
923342871 1:233022409-233022431 GGGGAGAGGAATGCTGGGCATGG + Intronic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1064097835 10:12436948-12436970 GGGGAGAGGCACCAGGGGCAGGG + Intronic
1064348803 10:14557776-14557798 GGGGATTAGCAGCCTGCCCATGG + Intronic
1064591094 10:16891460-16891482 GGGGTGAGGAAGCCTGCAGAGGG + Intronic
1067091578 10:43268297-43268319 AGGGAGAGGGAGCCAGCGAAGGG + Intergenic
1068052965 10:51975305-51975327 GGACAGAAGCAGCCTTCGCATGG + Intronic
1068981991 10:63072032-63072054 GGGGGGAGGCAACATGCTCATGG - Intergenic
1069661019 10:70123549-70123571 GGGCAGAGCCAGGCTGCCCACGG + Intronic
1070734767 10:78855948-78855970 AGGGTGAAGCAGCCTGCCCAAGG + Intergenic
1070825487 10:79388096-79388118 GGGGACAGGTGGCCTGCCCAAGG - Intronic
1071520523 10:86329268-86329290 GGGGAGAGGCAGCCTGGCCAAGG - Intronic
1072270129 10:93768306-93768328 GGAGAGAGGAAGCCTGAGCCTGG + Intronic
1074703175 10:116110041-116110063 GGAGAGAGGCAGCGGGCACAGGG - Intronic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1075830731 10:125408687-125408709 GGGGAGAAGCAGCCTTTGCCAGG + Intergenic
1076014221 10:127014939-127014961 AGGGAGATGCAGCCAGCGCCAGG + Intronic
1076300151 10:129419567-129419589 GGGAGGACGCAGCCGGCGCACGG - Intergenic
1076612512 10:131735619-131735641 CAAGAGAGGCAGCCTGCACAGGG - Intergenic
1076695955 10:132247520-132247542 GGGGAGAGGACGCCTGTGCTGGG + Intronic
1076827283 10:132975382-132975404 GAGGAGACACAGCCTGCGCCGGG - Intergenic
1077182965 11:1224592-1224614 GGGGAGGGGCTGCCTGCGGCGGG + Intronic
1078413159 11:11144040-11144062 GGTGAGGGGCAGCCTGTGCCAGG - Intergenic
1078864948 11:15288722-15288744 GGCGAGGGGCAGTCTGAGCATGG + Intergenic
1078950257 11:16123877-16123899 GTGGAGAGGCAGCCTAGGCTAGG - Intronic
1079118131 11:17653654-17653676 TGGGACAGGCAGCCTGCAGACGG + Intergenic
1080683415 11:34496294-34496316 GAGGAGAGGGAGCCTCCGCAGGG - Intronic
1081615949 11:44591283-44591305 GGGGAGAAGGAGCCTGCCCAAGG - Intronic
1081813849 11:45927938-45927960 GGGGCTGGGCAGCCGGCGCAAGG + Exonic
1081856586 11:46307972-46307994 GGGGATGGGCAGCCTGGACAAGG - Exonic
1081989455 11:47329921-47329943 AGGGAGAGACAGCCTGGGTATGG + Exonic
1083265718 11:61546071-61546093 GGGGAGAGGCCGCTGGCGGACGG - Exonic
1083309301 11:61776294-61776316 GAGGAGAGGCAGGGTGCTCAGGG - Intronic
1083616670 11:64029633-64029655 GGGGCGAGGCCAGCTGCGCAGGG - Intronic
1083764062 11:64833740-64833762 GGGCCGACGCAGCCTGCGCATGG - Exonic
1084485059 11:69443383-69443405 GGGGGGAGGCGGCCCCCGCAAGG + Intergenic
1084604596 11:70165171-70165193 GGGAAGAGGCAGCGTGAACATGG - Intronic
1084641587 11:70429615-70429637 GTGCAGAGGCAGCCTGCTCTCGG + Intronic
1085402213 11:76241821-76241843 GGGGGCAGGCAACCTGGGCATGG + Intergenic
1085454140 11:76656263-76656285 GGGGAGAGGCAGTCAGGGAAGGG + Intergenic
1085779310 11:79393974-79393996 GGGGAGAAGAAGCCTTGGCAGGG + Intronic
1086413793 11:86568964-86568986 TGGGAGAAGCAGCTTGCCCAAGG - Intronic
1089063089 11:115642315-115642337 GGGAACAGGCAGCCTGCTGAGGG - Intergenic
1089076494 11:115742752-115742774 CGGGAGAAGAAGCCTGCTCAGGG + Intergenic
1089534420 11:119151880-119151902 GCGGGTAGGCAGCCTGCCCAAGG - Intronic
1090043322 11:123309784-123309806 GGGTGGAGGCAGCCTGGGGAAGG + Intergenic
1090242923 11:125196657-125196679 GAGGTGAGGCAGCTTGCCCAAGG - Intronic
1091306267 11:134538193-134538215 TGGGAGAGGCAGGCAGCGGATGG + Intergenic
1091722238 12:2821663-2821685 GGGGAGAGGCAGGCTGAGTGTGG - Intronic
1091781057 12:3214927-3214949 GGTGAGAGGCAGGCAGCGCCAGG - Intronic
1091828733 12:3534384-3534406 GGGGGAAGGCAGCCTGCAGAGGG - Intronic
1092538667 12:9406655-9406677 GGGGAGAGGCACCCCCCGCGAGG + Intergenic
1092968279 12:13666727-13666749 GTGGAGATACAGCCTGTGCATGG + Intronic
1093327919 12:17802683-17802705 GGGGAGAAGAAGCATTCGCAGGG + Intergenic
1093444675 12:19243092-19243114 TGAGAGAGGCAGCATGTGCATGG + Intronic
1095921893 12:47540212-47540234 GGGGTGAGGAAACCTGCCCAAGG + Intergenic
1096024708 12:48350823-48350845 GGGGAGGGGCAGGCGGCGCCCGG - Intronic
1096707346 12:53430521-53430543 GAGGAGAGACAGGCTGGGCAAGG - Intronic
1097188471 12:57208375-57208397 GGGCAGAGGCAGCATGGGGAGGG - Intronic
1097327085 12:58289104-58289126 CGGGAGAGGCAGACTGGGGAGGG + Intergenic
1098994065 12:77097817-77097839 GGCGAGAGACAGCATGTGCAGGG + Intergenic
1101295958 12:103424162-103424184 GGGAAGAGGCACCATGTGCAGGG - Intronic
1101511043 12:105392559-105392581 CTAGAGAGGCAGCCTGCCCATGG - Intronic
1101928070 12:108989704-108989726 GGGGAGTGCCAGCCTGCTAAAGG + Intronic
1102014607 12:109639544-109639566 GGGGAGAGTCAGCCCGCCGAGGG + Intergenic
1102300229 12:111766356-111766378 GGAGAGAGGCGGCCAGGGCAAGG - Intronic
1102466862 12:113135228-113135250 GGCGAGAGGCCGCATGCCCATGG - Intronic
1102781967 12:115573206-115573228 CGGGAGAGGGAGCCTGCGGGAGG - Intergenic
1103402517 12:120652937-120652959 GGTGAGAGGCAGCCTGCACCAGG + Intronic
1103477445 12:121229201-121229223 GGGGACCGGCAGCCTGCCCTTGG - Intronic
1103612939 12:122135146-122135168 GCAGAGAGGCAGCCTCTGCAGGG + Intronic
1103800480 12:123534112-123534134 GGGGAGGGGCGGCCGGGGCACGG - Intergenic
1104497901 12:129257804-129257826 GGGGAGATGCTGTCTGGGCATGG + Intronic
1104860377 12:131920348-131920370 GGGGCGAGGCAGGATGCACATGG - Intronic
1104943154 12:132404218-132404240 GAGGAGAGGCCGCCTATGCAGGG + Intergenic
1105241129 13:18610283-18610305 GGGGAGTGGCCACCTGCGCCAGG + Intergenic
1105280351 13:18959494-18959516 TGAGAGAGGCAGGCTGCACATGG + Intergenic
1105816877 13:24044116-24044138 GGGGAGTGGCTGCCTGAGCCTGG + Intronic
1106077743 13:26475689-26475711 GGGGAGAGGCAGCCTCTCTAAGG + Intergenic
1106246392 13:27953919-27953941 GGGGAGCGGGAGGCTGAGCAGGG - Intergenic
1106444125 13:29809236-29809258 GGGGAGAGGGAGCTTGAGAAAGG + Intronic
1108396766 13:49997315-49997337 GGGGAGGAGCGGCCTGCGGAGGG + Intronic
1109546175 13:63840396-63840418 GGGGGGAGGCACCCTCCGCGAGG + Intergenic
1109546660 13:63842166-63842188 GGGGGGAGGCACCCTCCGCGAGG + Intergenic
1109651539 13:65333681-65333703 GGGGAGAGGAAACCAGTGCAAGG + Intergenic
1113795024 13:113051806-113051828 GGGGAGAGTGAGCCAGCCCAGGG + Intronic
1114559321 14:23579002-23579024 GGGGAGATGCAGCCTGAGAGAGG + Intergenic
1115442755 14:33454891-33454913 GAGGAGAGGCAGCGTGCCCCCGG + Intronic
1116658172 14:47675799-47675821 CGGGAGCGGCCGCCTGCGGAGGG + Intergenic
1116770865 14:49125532-49125554 GGGGACAGGCTGCCTGGTCAGGG + Intergenic
1119485242 14:74982518-74982540 GGAGAGAGCCAGCCTGGGCAAGG - Intergenic
1119639602 14:76304880-76304902 GGGGAGAGGGAGTCTGGGCCTGG + Intergenic
1120882944 14:89428781-89428803 GGGGCGTGGAGGCCTGCGCAGGG - Intronic
1121112823 14:91324137-91324159 GGGCTGAGGCTTCCTGCGCAGGG + Intronic
1122142147 14:99668795-99668817 GGGGAGATGGAGCCGGCGAAGGG - Intronic
1122171586 14:99880427-99880449 GGGTCAAGGCAGCCTGAGCATGG - Intronic
1122268618 14:100558329-100558351 AGGGAGAGGCAGCATGTGCCTGG - Intronic
1122583075 14:102783825-102783847 GGGGCCAAGCAGCCTGCCCAAGG - Intronic
1122882946 14:104698166-104698188 GGGGAAGGGTAGCCTGCCCAGGG + Intronic
1122898375 14:104771686-104771708 GGGGAGGGGCAGGCTGGGAACGG + Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123110210 14:105863686-105863708 GGGGAGAGGGACCCTTCGAATGG - Intergenic
1123490225 15:20774864-20774886 GGGGAGTGGCCACCTGCGCCAGG - Intergenic
1123546726 15:21343951-21343973 GGGGAGTGGCCACCTGCGCCAGG - Intergenic
1124103795 15:26718884-26718906 GGGGAGAGGCAGGCTGAAGAGGG - Intronic
1124371732 15:29108016-29108038 GGGCAGAGGCACCCTGCGCATGG + Intronic
1126166399 15:45657718-45657740 GAGAAGAGGAAGCCTGCACAAGG - Intronic
1127681368 15:61301897-61301919 GGAGAGAGGAAGCATGTGCAGGG - Intergenic
1128325649 15:66722471-66722493 GGGGATAGGCAGAGTGGGCATGG - Intronic
1128550774 15:68596685-68596707 GGGCAGAGGCAGCAGGCACAGGG + Intronic
1129271627 15:74422136-74422158 GGGAAGATGCAGCCTGTCCAAGG + Intronic
1129685707 15:77685055-77685077 GGCCAGAGGCAGCTTGAGCAAGG + Intronic
1129926032 15:79365051-79365073 GGGGAGAGGGAGCATGCAGAGGG - Intronic
1131067360 15:89442853-89442875 GGGCAGATGCAGCCCTCGCAGGG - Intergenic
1202955057 15_KI270727v1_random:71166-71188 GGGGAGTGGCCACCTGCGCCAGG - Intergenic
1133848940 16:9483656-9483678 GGGGAGAAGCAGCATGGGAAGGG + Intergenic
1134518830 16:14908544-14908566 GGGCAGAGCCAGCCTGGGCAGGG - Intronic
1134555098 16:15157680-15157702 GGGCAGAGCCAGCCTGGGCAGGG + Intergenic
1134706501 16:16307199-16307221 GGGCAGAGCCAGCCTGGGCAGGG - Intergenic
1134961039 16:18404925-18404947 GGGCAGAGCCAGCCTGGGCAGGG + Intergenic
1134965341 16:18487528-18487550 GGGCAGAGCCAGCCTGGGCAGGG + Intronic
1135641555 16:24123960-24123982 GGGGAAAGGCAGCTTTGGCAAGG + Exonic
1136297284 16:29310913-29310935 TGGGAGAGGCTGCCTGTGGAGGG + Intergenic
1136784174 16:32925055-32925077 GGTGAGGGGCAGCCTGGGGAGGG + Intergenic
1136885610 16:33928751-33928773 GGTGAGGGGCAGCCTGGGGAGGG - Intergenic
1138497368 16:57416539-57416561 GGGGAGAGGGAGCCAGGGCCAGG - Intergenic
1139306834 16:65993759-65993781 AGGGAGAGGCAGCATGAGCCTGG - Intergenic
1139545760 16:67648819-67648841 GGGGAGGGGCAGGCGGCCCACGG - Intronic
1139683395 16:68582798-68582820 AGGGAGAAGCAGCCTTCCCAGGG - Intergenic
1140193569 16:72838316-72838338 GGCAAGAGGCAGCCTGGGAAGGG + Intronic
1141000506 16:80303044-80303066 GGTGAGAGACAGCTTGTGCAGGG - Intergenic
1141173759 16:81706325-81706347 AGGGGGAGGCACCCTGAGCAGGG + Intronic
1141452854 16:84117173-84117195 GGGGGCAGGGAGCCTGCGCCAGG - Intergenic
1141959153 16:87392713-87392735 GGGAGGAGGCAGCCGGCGGAGGG + Intronic
1141968583 16:87464177-87464199 GGGGAGAGGAGGGCTGAGCAGGG + Intronic
1142029143 16:87829766-87829788 GGGGGCAGGCAGCCTGCGCAGGG - Intergenic
1142119061 16:88377013-88377035 GCTGAGAGCCAGCCTGCGCTGGG - Intergenic
1142204528 16:88776577-88776599 GGGGAGAGGCTGTGTGCTCAGGG + Intronic
1203086829 16_KI270728v1_random:1189061-1189083 GGTGAGGGGCAGCCTGGGGAGGG + Intergenic
1142535612 17:615854-615876 GGGAAGGGGCTGCCTGGGCAAGG - Intronic
1142889153 17:2931813-2931835 GGGAAGAGGAAGGCTGAGCAAGG - Intronic
1143317713 17:6045229-6045251 AGGGAGAGGAAGCCTGTGCTTGG + Intronic
1143474811 17:7196524-7196546 GGGCAATGGCAGCCTGCTCATGG + Exonic
1143514207 17:7411312-7411334 GAGGAGAGGAAGCCTGGGTAAGG + Intronic
1143524844 17:7466097-7466119 GGGGAGGGGCCGCCGGGGCAGGG + Exonic
1143712865 17:8745918-8745940 GAGAAGAGGGAGCCTGCGCCTGG - Intergenic
1144539115 17:16121909-16121931 GGGGTGAGGCAGCTTGTCCAGGG - Intronic
1144740848 17:17581414-17581436 GAGCAGAGCCAGCCTGAGCAAGG + Intronic
1145761322 17:27426763-27426785 CTGGGGAGGCAGCCTGGGCAGGG - Intergenic
1146173746 17:30651692-30651714 CGGGAGAGGCAGGCTGAGCAGGG - Intergenic
1146269661 17:31476687-31476709 GTGGGGAGGCAGGCTGCTCATGG - Intronic
1146347202 17:32067713-32067735 CGGGAGAGGCAGGCTGAGCAGGG - Intergenic
1147320392 17:39642420-39642442 CAGGAGAGGCAGCCTGGGCAGGG + Intronic
1147843448 17:43388740-43388762 GGGCAGAGGGAGGCGGCGCATGG + Intergenic
1148220501 17:45858480-45858502 GAGCAGAGGCAGCCAGCCCAGGG - Intergenic
1149300944 17:55304288-55304310 GGGGAGAGGCTCCCGGCCCAGGG + Intronic
1149461857 17:56834802-56834824 GCGGAGAGGCGGCCGGCGCCGGG + Exonic
1151066873 17:71161099-71161121 GGAGTGAGGGAGCCTGCCCATGG + Intergenic
1151173532 17:72268402-72268424 GGCGAGATGCAGCCAGCACAAGG + Intergenic
1151366071 17:73617240-73617262 GGGGAGAGGCCTCCTGCAGAGGG + Intronic
1151366087 17:73617285-73617307 GGGGAGAGGCCTCCTGCAGAGGG + Intronic
1151366097 17:73617310-73617332 GGGGAGAGGCCTCCTGCGGAGGG + Intronic
1152240485 17:79158322-79158344 GGGCATAGGAAGCCTGCCCAGGG - Intronic
1152606691 17:81295041-81295063 GGGGATGGGCAGCCTGAACACGG + Exonic
1152630715 17:81409639-81409661 GGGGAGAGGCAGCCCTCCCCAGG - Intronic
1152915793 17:83034752-83034774 TGAGAGAGGCAGCTTGTGCAGGG - Intronic
1154447829 18:14449618-14449640 GGGGAGTGGCCACCTGCGCCAGG - Intergenic
1155064266 18:22255108-22255130 AGGGAGAGGCAGTCTGGGAAGGG - Intergenic
1157593265 18:48848703-48848725 GGGCACAGGCAGGCTGCCCAAGG - Intronic
1159943394 18:74426045-74426067 GGGGAGTGGCGGCCTCTGCATGG - Intergenic
1159965297 18:74589145-74589167 GGGGTGAGGGAGCCAGTGCAGGG - Intergenic
1160164322 18:76496233-76496255 GGGGAGCTGCGGCCTGCGGAGGG + Intronic
1160896167 19:1402881-1402903 GGAGAGAGGCTGTCTGGGCAAGG - Intergenic
1160967600 19:1753479-1753501 GGGGAGCGGCCGCCGGCGCCCGG - Exonic
1161274314 19:3407033-3407055 GGGCAGAGGCGGGCTGTGCAGGG + Intronic
1161357624 19:3827665-3827687 GGTGAGAGGCAGCCTGGGCGGGG + Intronic
1161393575 19:4033392-4033414 GGGGAGGGGCTGCGTGAGCAGGG - Intronic
1161466157 19:4431777-4431799 GAAGAGGGGCAGCCAGCGCATGG + Intronic
1161479163 19:4502039-4502061 GGAGAGGGGCAGCCTGAGCTCGG - Exonic
1162206469 19:9059897-9059919 GGTGAGAGGCAGGCTGGACACGG + Intergenic
1162455664 19:10782933-10782955 GGGGAGAGGCAGTCAGGTCAGGG - Intronic
1162838964 19:13341598-13341620 AGGGAGGGACAGCCTGTGCAAGG - Intronic
1162898100 19:13777546-13777568 GGGCAGAGGCAGTCTGGGAAAGG + Intronic
1162988671 19:14288348-14288370 CGGGAGAGGCAGGCTGAGCAGGG + Intergenic
1163668518 19:18614048-18614070 GGGGAGAGGTGGCCTGGGAAGGG + Intronic
1163698957 19:18777645-18777667 GGGGCGAGGGAGCCAGTGCAGGG - Exonic
1164240514 19:23384309-23384331 GGGGAGCTGCAGCCTGGCCAGGG + Intronic
1164616850 19:29672411-29672433 GGGAAGAGGCTGCCTGAGCTGGG + Intronic
1165685589 19:37817300-37817322 GGGGAGTTGCAGCCTGGGCTAGG - Intronic
1165803860 19:38568443-38568465 GGGGTGAGGGAGGCTGGGCACGG + Intronic
1166591491 19:44003244-44003266 GGAGAGAGGCAGGCTGAGCGAGG - Intronic
1167597571 19:50435570-50435592 GGGGTGAGGGAGCCTGGCCAAGG + Intronic
925276900 2:2656538-2656560 GGGGCCAGCCAGCCTGCCCACGG + Intergenic
926169957 2:10546807-10546829 GGAGAGAGAAAGCCTGCGCCTGG - Intergenic
928174547 2:29024775-29024797 CTGCAGAGGCAGCCTGAGCATGG + Intronic
929127402 2:38534351-38534373 GGGGGGAGGCTGGCTGTGCAGGG + Intergenic
929557306 2:42933720-42933742 GGGAAGACGCAGCTTGAGCAAGG + Intergenic
929936337 2:46297072-46297094 GGGGAGAGGCAGCCTGCGCAGGG - Intronic
930066664 2:47332791-47332813 AGGGAGAGGCAGACCACGCATGG + Intergenic
931177486 2:59868594-59868616 AGGTAGAGGCAACCTGCACAGGG - Intergenic
932837437 2:75050629-75050651 GGGGAGAGCCATCCTGCAGATGG - Intronic
933819269 2:86094954-86094976 GGTGAGAGGGTGCCTGTGCAGGG - Intronic
934475810 2:94592607-94592629 GGGGAGAGGTAGACAGAGCAGGG + Intronic
935381261 2:102453096-102453118 GGGGAGATGCAGTCTGTGCCAGG + Intergenic
936462815 2:112724692-112724714 GGGGAGAGGCAGGCTGTGGTGGG + Intronic
937117837 2:119421461-119421483 GGGAAGTGGCATCCTGGGCATGG + Intergenic
937365841 2:121260703-121260725 GGAGAGGGGCAGCCTGCTCTGGG - Intronic
937932743 2:127219316-127219338 GGGGAGGGGCAGCGGGCGCCTGG - Intronic
937939066 2:127271051-127271073 GGTGAGAGGGAGCCAGGGCAAGG - Intronic
938065622 2:128280536-128280558 GGGGAGGGGCTGCCTGCCCTTGG - Intronic
940412114 2:153377167-153377189 GGGGAGAGGCAGCAAGAGGATGG + Intergenic
943071597 2:183147382-183147404 GGTGAGAGGCAGGCTGCATATGG + Intronic
946196248 2:218034383-218034405 TGGGGGAAGCAGCCTCCGCATGG + Intergenic
946426546 2:219601453-219601475 GGGAAGAGGCAGGATGTGCAAGG + Intronic
947667644 2:231917363-231917385 GGGGTGAGGCAGGCTGCTCTAGG + Intergenic
947790795 2:232867700-232867722 GGAGGGAGGCAGGCTGCCCAGGG - Intronic
947996144 2:234529502-234529524 GGACAGAGGCAGCCTGTGCCGGG - Intergenic
948305741 2:236945570-236945592 GGGGAGCTCCAGCCTGCCCAGGG + Intergenic
948561569 2:238857129-238857151 GGGGAGGGGCACCATGGGCATGG + Intronic
948615124 2:239193539-239193561 GGGCAGGGGCTGCCTGAGCAAGG + Intronic
948754333 2:240150389-240150411 GGGCCGAGGCTTCCTGCGCAGGG - Intergenic
948861905 2:240756828-240756850 GGGGTGAGGCTGCCTCCGCTAGG + Intronic
948889327 2:240899250-240899272 GGGGAGGGGCAGCAAGCACAGGG - Intergenic
1169020343 20:2326367-2326389 TGGCAGAGGCAGCCTGCCTAAGG - Intronic
1169945014 20:10978965-10978987 GGGGAGAGGGAGACGGGGCAGGG - Intergenic
1170351436 20:15446356-15446378 AGGCATAGGCAGCCTGTGCAAGG + Intronic
1171009123 20:21498383-21498405 GCGGAGAGGCTGCCTGTGCAGGG - Intergenic
1171134395 20:22683995-22684017 GTGGAGAGGCAGCCAGGGCTTGG - Intergenic
1171266048 20:23773123-23773145 TGGGAGGAGCAGCCTGTGCAAGG + Intergenic
1171291506 20:23985375-23985397 GGAGAGGGGAAGCCTGAGCAGGG + Intronic
1172008284 20:31831978-31832000 GGGGAGAGGCAGCATGGTGACGG - Intronic
1172972416 20:38883176-38883198 GGGGAGATGCAGCTTGCCCAAGG + Intronic
1173088042 20:39943281-39943303 GTGGAGAGCTGGCCTGCGCACGG + Intergenic
1173549924 20:43925613-43925635 AGAGAGAGGAAGCCTGCGCTGGG - Intronic
1174158080 20:48529449-48529471 GGGGAAAGGCACGCTGGGCAGGG + Intergenic
1174456047 20:50649567-50649589 GGGGACAGGCAGGCTGGGCCAGG - Intronic
1174525160 20:51164694-51164716 AGGGAGAAGCAGCTTGCCCAAGG - Intergenic
1175781986 20:61688665-61688687 CGGGAGAGGCGGCATGCACATGG - Intronic
1175876414 20:62232308-62232330 GGGGGAAGGCAGTCTGCCCAGGG - Intronic
1175978381 20:62725070-62725092 GGGGAGAGGCAGCAGGCACCAGG + Intronic
1178917053 21:36710838-36710860 GAGCAGAGGCCGCCTGGGCAGGG - Intronic
1179286106 21:39978554-39978576 TGGGAGAGACAGCATGAGCAGGG + Intergenic
1180098706 21:45574375-45574397 GGGGTGGGGCAGGCTGCTCAGGG - Intergenic
1180765890 22:18345718-18345740 GGAGAGGGGAAGCCTGAGCAGGG - Intergenic
1180780423 22:18516660-18516682 GGAGAGGGGAAGCCTGAGCAGGG + Intronic
1180813139 22:18773981-18774003 GGAGAGGGGAAGCCTGAGCAGGG + Intergenic
1181035393 22:20167604-20167626 GGGGAGCGGCAGCCGCAGCAGGG - Intergenic
1181040932 22:20192359-20192381 GGGGAGAGGAAGGCTGCTCTGGG - Intergenic
1181199316 22:21208297-21208319 GGAGAGGGGAAGCCTGAGCAGGG + Intronic
1181400445 22:22647560-22647582 GGAGAGGGGAAGCCTGAGCAGGG - Intronic
1181519761 22:23438484-23438506 GGGGCAAGGCAGGCTGCACAGGG - Intergenic
1181534079 22:23532881-23532903 GGGCAGAGACAGCCTGGGGAAGG + Intergenic
1181540328 22:23569559-23569581 GGGAGGAGGCAGCTTGCCCAGGG - Intergenic
1181648922 22:24248231-24248253 GGAGAGGGGAAGCCTGAGCAAGG + Intergenic
1181702424 22:24628658-24628680 GGAGAGGGGAAGCCTGAGCAGGG - Intronic
1182567351 22:31210324-31210346 GGGTAGAGAAAGCCTGGGCAGGG - Intergenic
1183095064 22:35547054-35547076 GAGGATGGACAGCCTGCGCATGG - Exonic
1183454787 22:37916687-37916709 GAGGAGCTGCAGCCTGCTCAGGG + Intronic
1183869170 22:40728283-40728305 GGACAGAGGCAGGCTGCACACGG - Intergenic
1184085236 22:42258327-42258349 GGTGAGAAGCAGGCTGCGCATGG - Intronic
1184380183 22:44140475-44140497 GAGGAGAGGCAGCCAGCACATGG + Intronic
1185419885 22:50729325-50729347 GGGGGGACTCAGCCTGGGCAGGG + Intergenic
1203227509 22_KI270731v1_random:86609-86631 GGAGAGGGGAAGCCTGAGCAGGG - Intergenic
949571154 3:5294415-5294437 GGAGAGAGTCAGCCAGTGCAGGG + Intergenic
950160892 3:10760221-10760243 TGGGAGAGGCTGCCTGAGGAAGG - Intergenic
950202740 3:11056579-11056601 GAGGAAAGGCAGCCTGTTCAGGG - Intergenic
950283395 3:11725728-11725750 GGGAAGAGTCAGGCTGGGCATGG - Intergenic
950473347 3:13199826-13199848 GTGGAGAAGCAGCCCCCGCAAGG + Intergenic
950544618 3:13630970-13630992 GTGGAGAGGCAATCTGCCCAAGG - Intronic
950764309 3:15262001-15262023 GGGGAAAGAGAGCCTGAGCAGGG + Intronic
951140115 3:19148453-19148475 CGGGAGAGGGAGCCTGCGCCGGG + Exonic
953878715 3:46680722-46680744 GGAGGGAGGCAGCCTGGGAAGGG + Intronic
954535744 3:51358162-51358184 GGAGAGAGGGAGCCTGGGCAGGG + Intronic
954711726 3:52508203-52508225 GAGCAGAGGCAGCCTGGGCAGGG + Intronic
956892359 3:73624914-73624936 GGGGAGAGCCAGCGAGCGCGCGG - Exonic
961678115 3:128580490-128580512 GGGGACAGGCTGCCTGAGAATGG + Intergenic
962285724 3:134084358-134084380 AGGGAGAGGCAGCCTGGGAAGGG + Intronic
962497976 3:135961878-135961900 GGGGAGGGGCATCCTGAACATGG + Intergenic
962675930 3:137758531-137758553 GGGGAGAGCCAGCCTTCTGAAGG - Intergenic
963600540 3:147374629-147374651 GGGGAGAGGCATTCTCTGCATGG - Intergenic
965881725 3:173395874-173395896 GGGGAGAGGGAGGCAGCGGAGGG + Intergenic
966912235 3:184566079-184566101 TGGGAGAGGCCCCCTGCCCAAGG + Intronic
967217396 3:187222073-187222095 GGGGAGAGGAAGCCAGGGCAGGG + Intronic
968599706 4:1503205-1503227 GGGGAGAGCTGGCCTGCCCACGG + Intergenic
968938165 4:3624404-3624426 GGGGAGGGGCAGCCTGGGAGGGG + Intergenic
968938184 4:3624457-3624479 GGGGAGGGGCAGCCTGGGAGGGG + Intergenic
976633659 4:87265783-87265805 GGGGATATGCAGCCTACACAAGG + Intergenic
976934116 4:90607471-90607493 GGGGAGAGGCAGCCCTCAGAAGG - Intronic
980941623 4:139280194-139280216 GTGGAAGGGCAGCCTGCGCCTGG - Exonic
985039965 4:185880136-185880158 GGGTCGAGGCAGCCTGCACAGGG - Intronic
985580985 5:695005-695027 GAGGAGAGGCAGCGGGCGCGGGG + Intergenic
985595610 5:786337-786359 GAGGAGAGGCAGCGGGCGCGGGG + Intergenic
985622612 5:963352-963374 GGGGAGAGGAAGCCAGTGCAAGG - Intergenic
985926924 5:3026265-3026287 AGGGAGAGGCAGGGTGGGCAGGG - Intergenic
985956232 5:3268209-3268231 GGGGAAAGGCAGGCAGAGCAAGG - Intergenic
986100888 5:4610002-4610024 GATGAGGGGCAGCCTGTGCAAGG - Intergenic
986272475 5:6245875-6245897 GGGGATAGGCTGGCTGGGCAAGG + Intergenic
992485392 5:77189717-77189739 GTGGAGAGCCAGGCTGCTCAGGG + Intergenic
995068270 5:107887684-107887706 GGGTGGAGGGAGCCTTCGCAGGG - Intronic
997377162 5:133405509-133405531 GGGGAGCGGCAGCCCTCGCCTGG + Intronic
997440743 5:133907150-133907172 GTGGGGAGCCTGCCTGCGCAGGG + Intergenic
997492593 5:134290580-134290602 GGGGAGAGGCATACTGTGTAGGG + Intronic
997638686 5:135434515-135434537 GGGGAAAGTCAGCCTGCAGAAGG + Intergenic
997647127 5:135489098-135489120 GGGGAGAGGACGGCTGGGCAAGG + Intergenic
998416047 5:141946653-141946675 GGGGAGGGGCTGCCTGTCCAAGG + Intronic
999113570 5:149142157-149142179 GAGGTGAGGGAGCCTGCGCTCGG + Intronic
999316641 5:150588444-150588466 GGGGACAGGCAGCCTGAGGCTGG - Intergenic
999770280 5:154770449-154770471 CGGGAGAGGTAGCCTAGGCAGGG - Intronic
1000328315 5:160188532-160188554 GGGGAGAGGCCGCCGCCGCGCGG + Intronic
1000611333 5:163378371-163378393 GGGGAGAGGCAGACAGAGCTGGG - Intergenic
1001081465 5:168670862-168670884 GGGCAGACTCAGCCTGTGCAAGG - Intronic
1001084002 5:168687187-168687209 GGGGAGAGGCCACCTGCTGAGGG - Intronic
1001547990 5:172582379-172582401 TGGGAGAGGGAGCCTGGGGAAGG + Intergenic
1002335060 5:178471820-178471842 GGGGCGAGGCAAGCTGAGCAGGG - Intronic
1002428067 5:179187375-179187397 GGAGACAGGCTGCCTGTGCAAGG - Intronic
1002575064 5:180169852-180169874 GCGGGAAGGCAGCCTGCACAGGG - Intronic
1002868686 6:1146900-1146922 GGGGAGAGACAGACAGAGCAGGG + Intergenic
1004020352 6:11770969-11770991 GGGGAGAGGCCGCCTCCGCCCGG + Intronic
1005990175 6:30897563-30897585 GGGGACGGGCAGGCTGCGCAGGG + Exonic
1006195905 6:32242226-32242248 GGGGAGACGCGACCTGCCCAAGG + Intergenic
1006373758 6:33660421-33660443 GGACTGAGGCAGCCTGAGCAGGG - Intronic
1006547577 6:34792372-34792394 GGAGAGAGGCAGACTGGGCCCGG - Intronic
1006580944 6:35077689-35077711 GGAGAGAGTCAGGCTGCCCAGGG + Intronic
1007575565 6:42923367-42923389 GGGGACAGGGAGCATCCGCAAGG - Intronic
1011749413 6:90440128-90440150 GGGGCGAGGGAGCCTTCTCATGG - Intergenic
1012180398 6:96145710-96145732 GGCCTGAGGCAGGCTGCGCACGG + Intronic
1014517752 6:122400048-122400070 GGGGAGGGGCGGCCCGCGCGGGG + Intronic
1016714057 6:147203934-147203956 GGGGCGAGGCAGGCGGCGCGGGG + Intergenic
1017701485 6:157077415-157077437 TGGCAGAGGCAGGCTGCGCATGG - Intronic
1017914077 6:158818710-158818732 GGGGAGAGGGAGCGCGCGCCTGG + Intronic
1018220116 6:161569645-161569667 GGGGAGAGAAAGCCTGGCCAGGG - Intronic
1018328783 6:162705209-162705231 GGGGAGAGGCAGTCTAAGAAAGG - Intronic
1018606025 6:165598961-165598983 CTGGAGAGGCAGTCTGCGTAGGG - Intronic
1019470064 7:1214748-1214770 GGGGAGAGCCTGCCTGCGTTCGG + Intergenic
1019478256 7:1254501-1254523 GGGGAGAGGAAGGCTTCCCATGG - Intergenic
1019591500 7:1837794-1837816 GGGGCAAGGCAGGCTGCACAGGG + Intronic
1019681138 7:2350303-2350325 GGAGAGAGGCTGCCTGAGCCCGG - Intronic
1023281267 7:38572861-38572883 GGGCAGAGGAAGCGTGAGCATGG + Intronic
1023827554 7:44019629-44019651 CGGTATAGGCAGCCTGGGCAGGG - Intergenic
1023864580 7:44232698-44232720 GGGGAGGGGCGGCCAGGGCATGG + Intronic
1024505677 7:50159301-50159323 GGAGAGAGGCGGGCTGGGCAGGG - Exonic
1024945789 7:54806297-54806319 GCGGGGGGGCAGCCTGCCCATGG - Intergenic
1025997269 7:66535876-66535898 AGGGAGACGCAGCCAGCGAAGGG - Intergenic
1026859792 7:73778379-73778401 GGGGAGAGGCATGGTGCGCTGGG - Intergenic
1026966078 7:74440959-74440981 GGAGAGAGGCAGGCAGCTCAGGG + Intergenic
1026990129 7:74580349-74580371 AGGGAGACGCAGCCAGCGAAGGG - Intronic
1027232562 7:76281411-76281433 GGAGAGAGGCAGACAGGGCACGG - Intronic
1029583414 7:101453573-101453595 GGGGACACGCATCCTGAGCAAGG - Intronic
1029738728 7:102479398-102479420 CGGTATAGGCAGCCTGGGCAGGG - Intergenic
1029755854 7:102573055-102573077 CGGTATAGGCAGCCTGGGCAGGG - Intronic
1029773796 7:102672128-102672150 CGGTATAGGCAGCCTGGGCAGGG - Intergenic
1030364109 7:108626733-108626755 GGGGACAGGCAACCTCCGAACGG + Intergenic
1032239245 7:130148325-130148347 GGGAAGAGGCACACTGCCCACGG - Intergenic
1032387288 7:131533545-131533567 GGGGAAGGGCAGCCTTCGCTTGG + Intronic
1033591113 7:142809180-142809202 GGGGAGGGGAGGCCTGCACATGG - Intergenic
1034303768 7:150035825-150035847 GGGGAGAGGCAACCCCCGCAAGG - Intergenic
1034801407 7:154058480-154058502 GGGGGGAGGCACCCTCCGCGAGG + Intronic
1034802480 7:154062405-154062427 GGGGGGAGGCACCCTCCGCTAGG + Intronic
1034802538 7:154062567-154062589 GGGGGGAGGCACCCTCCGCTAGG + Intronic
1034802593 7:154062730-154062752 GGGGGGAGGCACCCTCCGCGAGG + Intronic
1034895212 7:154872142-154872164 GGGGAGAGGGTGCCGGCCCATGG - Intronic
1034936660 7:155204464-155204486 GTGGAGAGGCGGCGTGCACATGG - Intergenic
1034978202 7:155459843-155459865 GGAAAGAGGCAGCATTCGCAGGG + Intronic
1035050367 7:155995318-155995340 GGGGACAGGCTCCCTGGGCATGG + Intergenic
1035169195 7:157008648-157008670 GGGGAGATGCAGGCAGAGCAGGG - Intronic
1035232282 7:157472521-157472543 GGGGAGAGGGAGCCCGTGCCTGG + Intergenic
1035781399 8:2230786-2230808 GGGGAGAGACAGCGTGTGGAAGG + Intergenic
1036206792 8:6811509-6811531 GGGGCGATGCAGGCTGGGCAGGG + Exonic
1037930893 8:22879662-22879684 GAGGACAGGGAGCCTGCCCAGGG + Intronic
1039239946 8:35545472-35545494 CTGGAGAGGCAGCCTGCTGAGGG + Intronic
1039955930 8:42207267-42207289 GGGGAGAGGCAGTCGGGGAAAGG - Intronic
1041195836 8:55400585-55400607 GCAGAGAGACAGCCTGAGCAAGG + Intronic
1041902345 8:62996272-62996294 GGAGAGAGACAGAGTGCGCAGGG + Intronic
1042733452 8:71962354-71962376 GGGGCGAGGCAGCCACAGCATGG - Intronic
1044714501 8:95088200-95088222 GGTGAGAGGCAGCCTGTGGGAGG - Intronic
1045062835 8:98423904-98423926 AGGGAGAGGCACCCTGGGAAGGG - Intronic
1046827924 8:118712070-118712092 GGGGAAAGGCAGCCAGAGAATGG + Intergenic
1047066070 8:121284488-121284510 GGGGAGAGGAAGCAGGGGCAAGG + Intergenic
1047208053 8:122819250-122819272 GTGGTCAGGCAGCCTGCTCAAGG - Intronic
1047910890 8:129528071-129528093 GGGGAGGGGCAGCATGGTCAAGG - Intergenic
1048472388 8:134714795-134714817 GGGGAGAGGAACACTGGGCATGG - Intergenic
1048967699 8:139626307-139626329 GGGGAGAGGTAGACAGAGCAGGG + Intronic
1049100447 8:140575137-140575159 TGGGAGATCCAGCCTGGGCAGGG + Intronic
1049343671 8:142127253-142127275 GGGGAGAGGTTGCCTGTGCTGGG - Intergenic
1049463025 8:142738898-142738920 GGGGAGCGGCGGCCTGGGCCTGG - Intergenic
1049832756 8:144712880-144712902 GGGAAGAGGCGCCCTGGGCATGG - Intergenic
1050612388 9:7366586-7366608 TGTGAGTGGCAGCCTGCACATGG - Intergenic
1052736172 9:32344796-32344818 GTGGAGAGGCAGCCTGTGGGAGG - Intergenic
1052854244 9:33397310-33397332 GGGGAGAGGTAGACAGAGCAGGG - Intronic
1052904139 9:33818296-33818318 GGGCAGTTCCAGCCTGCGCAGGG - Intronic
1053272377 9:36759269-36759291 GGGGAGAGGCAGTCCCCACAGGG + Intergenic
1053428767 9:38028104-38028126 GAGGGGAGGCAGCCTGCACTAGG - Intronic
1053737027 9:41108403-41108425 GGGGAGAGGCACCCCTCGCGAGG + Intergenic
1053932237 9:43121798-43121820 GGGGAGAGGTAGACAGAGCAGGG - Intergenic
1054295353 9:63328971-63328993 GGGGAGAGGTAGACAGAGCAGGG - Intergenic
1054393371 9:64633475-64633497 GGGGAGAGGTAGACAGAGCAGGG - Intergenic
1054428020 9:65138689-65138711 GGGGAGAGGTAGACAGAGCAGGG - Intergenic
1054453008 9:65413301-65413323 GGGGAGGGGCAGCCTGGGAGCGG - Intergenic
1054502358 9:65882855-65882877 GGGGAGAGGTAGACAGAGCAGGG + Intronic
1054691321 9:68322914-68322936 GGGGAGAGGCACCCCTCGCGAGG - Intergenic
1054691347 9:68322994-68323016 GGGGAGAGGCACCCCTCGCGAGG - Intergenic
1054691620 9:68324140-68324162 GGGGAGAGGCACCCCCCGCGTGG - Intergenic
1054813068 9:69450171-69450193 TGGGAGGGGGAACCTGCGCATGG - Intronic
1056298147 9:85214141-85214163 GGTGAGAGGAAGCCAGAGCAGGG + Intergenic
1056779979 9:89541984-89542006 GGTGACAAGCAGCCTGCCCAGGG - Intergenic
1056960326 9:91117456-91117478 GGGGAGGGGCGGCCAGCTCACGG - Intergenic
1057226350 9:93295279-93295301 GGGGAGCGGCTGCGTGGGCAGGG - Intronic
1060476036 9:123987444-123987466 GAGGAGAGGCAGCCAGCCCAGGG - Intergenic
1060519982 9:124288818-124288840 GTGGAGAGGCAGCAAGCTCAGGG - Intronic
1060925879 9:127454754-127454776 GGGGAGAAGCACCCTTGGCAGGG - Intronic
1061306643 9:129736370-129736392 GGGGAGCGGCTGCCTGGGGAGGG - Intergenic
1061820561 9:133225337-133225359 GGGGAGAGGGACCTTGCCCACGG + Intergenic
1061838207 9:133342843-133342865 GGAGAGAGGGAACCTGCTCACGG - Intronic
1061910422 9:133719452-133719474 GAGGAGAGGGAGACTGAGCAAGG + Intronic
1062044107 9:134417327-134417349 GGTGAGTTGCAGCCTGTGCAGGG + Exonic
1062052932 9:134456838-134456860 GGGTAGATGCAGGCTGAGCAGGG - Intergenic
1062242659 9:135548504-135548526 GGGGAGAGGAGGCCTGAGAATGG - Intronic
1062268784 9:135699505-135699527 GGGGCGGGGCTGCCTGCGGAAGG - Exonic
1062339962 9:136089524-136089546 GGGGAGAGGCCCCCAGCGCTGGG - Intronic
1062428476 9:136516786-136516808 GGGGAGTGGGAGCTTGCCCAGGG - Intronic
1062572574 9:137192413-137192435 GGGGACAGGCAGCCTGGGAGGGG - Intronic
1062612128 9:137380119-137380141 GGAGGGAGGCAGGCAGCGCAAGG - Intronic
1185460735 X:331849-331871 GGGGGGACCCAGCCTGCGGAGGG - Intergenic
1185955956 X:4489242-4489264 GGAGAGAGACAGTATGCGCAGGG - Intergenic
1188495750 X:30781431-30781453 GGGGAGAGGCATCATGGGGAAGG - Intergenic
1189129696 X:38485398-38485420 GGGGAGAGGCAGATTGGGGAAGG + Intronic
1189129760 X:38485542-38485564 GGGAAGAGGCAGAGTGCGGAGGG + Intronic
1189211223 X:39285477-39285499 TGGGAGAGGGAGCCTGAGGAAGG - Intergenic
1189348491 X:40260191-40260213 GGGGAGGGGATGACTGCGCAGGG - Intergenic
1190058490 X:47195968-47195990 GGGGAGAGGCAGCCTCCATCAGG - Intronic
1191750409 X:64536093-64536115 GGGAAGTGCCAGCCTGCCCATGG - Intergenic
1192212703 X:69137711-69137733 TGGGAGAGGCAGCCTGGGGTGGG - Intergenic
1197903135 X:131394564-131394586 GGGTTGGGGCAGCCTGCCCATGG + Intronic