ID: 929944605

View in Genome Browser
Species Human (GRCh38)
Location 2:46361009-46361031
Sequence ATCCAGGGGGATGTCCATGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929944605_929944612 8 Left 929944605 2:46361009-46361031 CCCACATGGACATCCCCCTGGAT 0: 1
1: 0
2: 1
3: 6
4: 100
Right 929944612 2:46361040-46361062 CTTCCTGAGCCGCCACAGCATGG 0: 1
1: 0
2: 5
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929944605 Original CRISPR ATCCAGGGGGATGTCCATGT GGG (reversed) Exonic
900160874 1:1222900-1222922 ATCCAGGTAGCTGTTCATGTAGG - Intronic
900531356 1:3155046-3155068 CTCCAGGGGGTGCTCCATGTGGG + Intronic
902090279 1:13897654-13897676 AACCAGTGAGATTTCCATGTTGG + Intergenic
904265409 1:29315827-29315849 ATAAAGGGGCATGTCCATGGAGG + Intronic
904786265 1:32985335-32985357 ATCCAGGGGGATAGGAATGTAGG + Intergenic
905870140 1:41398886-41398908 ATCCAGTGTGAGGCCCATGTAGG + Intergenic
913725486 1:121649106-121649128 ATCAAGGGGGATGTTCAACTCGG + Intergenic
913725983 1:121654702-121654724 ATCAAGGGGGATGTTCAACTCGG + Intergenic
913726807 1:121664030-121664052 ATCAAGGGGGATGTTCAATTCGG + Intergenic
918378095 1:183929161-183929183 AGCCAGGGGGACCTCCATGGAGG + Intergenic
919760267 1:201093711-201093733 AGCAAGGGAGCTGTCCATGTTGG - Intronic
921090539 1:211837994-211838016 ATCCAAGGTGATGCCAATGTTGG - Intergenic
1072691903 10:97577701-97577723 ACCCAGGAGGATGTCTCTGTGGG + Intronic
1077402705 11:2367056-2367078 ATCCAGAGGGAAGGCCAGGTTGG - Intergenic
1077802625 11:5556328-5556350 ATCTAGGGTGCTGTCCATATCGG - Intronic
1078406564 11:11075054-11075076 GTCCAGGGGGATGTCTCTGTGGG + Intergenic
1088697479 11:112380647-112380669 ATCCAGGGGCAGGTCCGTGCAGG + Intergenic
1090076520 11:123583512-123583534 TTCAAGGGGGATGTACATGAAGG + Intronic
1092872035 12:12813700-12813722 ATCCAGGAGGTTGTACATATGGG + Intronic
1093612717 12:21182360-21182382 ACCCAGGGGGTTTTGCATGTTGG + Intronic
1096501023 12:52063922-52063944 ACCCAGGGATCTGTCCATGTTGG - Intergenic
1096805554 12:54138973-54138995 ATGAAGGGGGATGTGCATGTGGG - Intergenic
1099839007 12:87942586-87942608 GGCCAGGGGGATGTCCAAGGCGG + Intergenic
1102082850 12:110112416-110112438 ATCCAGCTGGAGGTCCGTGTGGG - Intergenic
1103634098 12:122288604-122288626 AGCCTGGGGGATGTACATGTGGG - Intronic
1104259946 12:127173172-127173194 ATCCAGGGGAAAGGCCATGGTGG + Intergenic
1107533512 13:41306783-41306805 ATCTGGGTGGATGTCCATGATGG + Intergenic
1111429703 13:88135369-88135391 ATCCAGGGAGAAGTCCATTGTGG - Intergenic
1112713784 13:102160296-102160318 ATCTAGGGGGTTGTCCCTGGGGG - Intronic
1114671654 14:24414937-24414959 ATCCCAGGGGATGCCCAGGTAGG - Exonic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1125522063 15:40353810-40353832 CTCCAGGGAGATTTCCAAGTGGG + Intronic
1125524657 15:40367452-40367474 GTCCAGGTAGATGTCCATGAGGG - Exonic
1127166857 15:56252727-56252749 AGCCCGGGGGATCTCCATGAGGG - Intronic
1129521587 15:76189753-76189775 AACCAGGGGGCTCTGCATGTGGG + Intronic
1129545823 15:76393854-76393876 AGCCAGGGGTCTTTCCATGTGGG - Intronic
1131762849 15:95642864-95642886 ATACAGGGGTTTCTCCATGTTGG - Intergenic
1132321800 15:100930715-100930737 GAGCAGGGAGATGTCCATGTGGG + Intronic
1138093758 16:54196228-54196250 ATGCAGGGGTAGGTCCAGGTGGG - Intergenic
1148480769 17:47958175-47958197 ATCCAGGTGGTGGTCCATGCTGG - Intergenic
1155176101 18:23302621-23302643 CTCCAGGGAGATCACCATGTAGG - Intronic
1155845570 18:30701552-30701574 ATCCATGGGCTTGACCATGTGGG - Intergenic
1157002600 18:43544924-43544946 ATCCAGGGGAATATCCAAGAAGG + Intergenic
1158199639 18:54925616-54925638 ATCCTGTGGGATTTCTATGTAGG - Intronic
1161433547 19:4248466-4248488 ATCCAGGGAGATGACTCTGTAGG + Intronic
1161560519 19:4970041-4970063 TCCCAGGGGGATGTCCACGGGGG - Intronic
1162788725 19:13052157-13052179 ATCCTGGGGCTTGTCCAAGTGGG + Intronic
1163834561 19:19565260-19565282 ACCCAGGGAGATGTCCACATGGG + Intronic
1164760591 19:30725677-30725699 GGCCATGGGGATGCCCATGTTGG - Intergenic
1165090961 19:33388258-33388280 ATCCAGGGGTATGTGCAGGGTGG - Intronic
1166175825 19:41068904-41068926 ATCCAGGAGGAGGTGGATGTTGG - Intergenic
1168679478 19:58304064-58304086 ATTCTGGAAGATGTCCATGTTGG - Intronic
925813460 2:7724110-7724132 CGCCAGGGGGAAGACCATGTAGG + Intergenic
926081817 2:9993411-9993433 ACACAGGAGGATGTCCTTGTTGG - Intronic
927810260 2:26176455-26176477 CTGCAGGGGGATGTCGATCTTGG - Exonic
929944605 2:46361009-46361031 ATCCAGGGGGATGTCCATGTGGG - Exonic
930143215 2:47974263-47974285 ATACAGGTGGATGTCCGTCTGGG + Intergenic
931315481 2:61126810-61126832 AGCCAGGGGGTAGGCCATGTAGG - Intronic
938066250 2:128283501-128283523 AGCCAGGGAGGTGTCCATGGAGG + Intronic
941855649 2:170227718-170227740 ATGAAGGGGTATGTCCAAGTGGG + Intronic
946134566 2:217635246-217635268 ATACAGGGGGATGACCACATAGG - Intronic
947371888 2:229455522-229455544 ATCCAGGGTCATGACCCTGTGGG - Intronic
1169332892 20:4730496-4730518 AGACAGGGGTCTGTCCATGTTGG + Intergenic
1169506733 20:6219747-6219769 ATCCAGGGCCATTTCTATGTTGG - Intergenic
1172303010 20:33863046-33863068 ATCCATGGGGGTGTCCCTGTGGG - Intergenic
1172419914 20:34807489-34807511 ATTCAGCAGGATTTCCATGTAGG - Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1175735641 20:61385287-61385309 ATCCAGGTGGATGGTCTTGTAGG - Intronic
1177746752 21:25223896-25223918 ATTCAGAGGCATGTCCAAGTAGG - Intergenic
1185384782 22:50526670-50526692 ACCCAGGGGCTTGTCCATGGCGG + Exonic
951411647 3:22373224-22373246 TTCCAGAGGGATGGGCATGTGGG - Intronic
953107792 3:39902264-39902286 ATCAAGTGGGAGGTCCAAGTTGG + Intronic
954745188 3:52783816-52783838 ACCCAGGGGGATGTCCGGGAAGG + Intronic
959788263 3:110327825-110327847 ATCAAGGGGGATGTCCAACCAGG - Intergenic
961543031 3:127613107-127613129 ATCCAGGGGGACTTCCCTGTGGG - Intronic
961975537 3:131020917-131020939 ATTCAGTTGGATTTCCATGTGGG + Intronic
976730750 4:88258738-88258760 TTCTGGGGGGATGTCCATTTTGG - Exonic
978125307 4:105128724-105128746 ATCCAGGGCTGTGTCAATGTTGG + Intergenic
981403398 4:144339910-144339932 GTCCAGGGGAATCGCCATGTTGG + Intergenic
985757924 5:1730287-1730309 ATCCAGTGGGATCTCCCTGCTGG + Intergenic
987321321 5:16772317-16772339 AGACAGGGGGTTCTCCATGTTGG + Intronic
990569310 5:57061718-57061740 TTCCAGGGGGATGTGAATTTTGG + Intergenic
991546924 5:67792664-67792686 ATCATGGTGGATGTCCATATAGG + Intergenic
991585668 5:68199263-68199285 ATCAAGGGGGGTATCCATTTTGG - Intergenic
992711660 5:79464301-79464323 ATCAAGGGGGATGTTTTTGTCGG - Intronic
998872426 5:146565967-146565989 AGCCAGGGGTGTGTCCTTGTTGG + Intergenic
999781581 5:154854825-154854847 ATCCAGGGGTTTCACCATGTTGG + Intronic
1004397726 6:15260885-15260907 ATCCTGGGGTATGTCAGTGTTGG - Intronic
1011385143 6:86788283-86788305 AGCCTTGGGTATGTCCATGTAGG + Intergenic
1018283107 6:162208833-162208855 AGCCTGGGGTATGTCCATCTTGG + Intronic
1026727312 7:72879709-72879731 ATCCAGGCGGGTGTCCTTCTCGG - Exonic
1027116544 7:75486018-75486040 ATCCAGGCGGGTGTCCTTCTCGG + Exonic
1027121838 7:75527720-75527742 ATCCAGGCGGGTGTCCTTCTGGG + Intergenic
1027275283 7:76549685-76549707 ATCCAGGTGGGTGTCCTTCTCGG - Intergenic
1028850055 7:95527942-95527964 GGCCAGGGGGGTCTCCATGTGGG - Exonic
1029151078 7:98480928-98480950 ATCCTGTGGCATGTCCCTGTGGG - Intergenic
1029467870 7:100737293-100737315 ATCCAGGGCGATGTCCAGGTAGG - Exonic
1031027848 7:116699953-116699975 CTCCAGAGGCATTTCCATGTAGG - Exonic
1033966382 7:146980015-146980037 TTCCAGGTGGATGTCCTAGTTGG + Intronic
1035551328 8:529180-529202 ATCCTGGGGTATGTCTATGAGGG - Intronic
1035991792 8:4499316-4499338 AACCAGGGAGATGCCCATATGGG + Intronic
1040329908 8:46380610-46380632 ACTCAGGGGGATGTTGATGTAGG + Intergenic
1048073517 8:131043469-131043491 ATCCTGGGAGCTGTCCAGGTTGG - Intergenic
1056676984 9:88684093-88684115 ACACAGAGGGATGACCATGTGGG + Intergenic
1186446781 X:9636536-9636558 GTCCAGGGGAATGTCTATGTTGG + Intronic
1198212717 X:134530423-134530445 AGCCAGTAGGATGTCCACGTGGG - Intergenic
1198379772 X:136072902-136072924 ATGGAAGGGGATATCCATGTTGG + Intergenic
1199700238 X:150370493-150370515 AGTCAGGGGGTTGTCCATGGAGG + Intronic