ID: 929951509

View in Genome Browser
Species Human (GRCh38)
Location 2:46413453-46413475
Sequence GGTAATAAGGAAAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929951498_929951509 26 Left 929951498 2:46413404-46413426 CCTTTTCCAAAAAGAACAACGCT No data
Right 929951509 2:46413453-46413475 GGTAATAAGGAAAAGGAGGCTGG No data
929951499_929951509 20 Left 929951499 2:46413410-46413432 CCAAAAAGAACAACGCTGCATGG No data
Right 929951509 2:46413453-46413475 GGTAATAAGGAAAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929951509 Original CRISPR GGTAATAAGGAAAAGGAGGC TGG Intergenic
No off target data available for this crispr