ID: 929954084

View in Genome Browser
Species Human (GRCh38)
Location 2:46442312-46442334
Sequence CTATGGGGAGAAAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 801
Summary {0: 1, 1: 1, 2: 4, 3: 92, 4: 703}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929954084 Original CRISPR CTATGGGGAGAAAGGGAAGA GGG (reversed) Intronic
900193167 1:1360013-1360035 CCATGGGGAGAGAGGGAACAGGG - Intronic
900827371 1:4937580-4937602 CTAAGGACAGAAAGGGAACAAGG + Intergenic
901380511 1:8870639-8870661 TTCTGGGGGGAAAGGGGAGAGGG - Intronic
901595569 1:10382833-10382855 GTTTGGGGAGAAACAGAAGAAGG + Intergenic
901617517 1:10553539-10553561 CTCTCTGAAGAAAGGGAAGATGG + Intronic
901789456 1:11646750-11646772 CTATGGGAGGAAACTGAAGATGG - Intergenic
902439517 1:16420347-16420369 CAAAGGGGAGCAAGGAAAGACGG + Intronic
902488242 1:16762192-16762214 GGATGTTGAGAAAGGGAAGATGG - Intronic
902490144 1:16775530-16775552 ATGTGGGGAGAAACGGGAGAAGG - Intronic
902998903 1:20250344-20250366 TTTTTGGGAGAAAGGGAAGAAGG + Intergenic
903002398 1:20275569-20275591 CTGAGGGGAGGAGGGGAAGAGGG + Intergenic
903808210 1:26020445-26020467 GTATGGGGATAGAGGGATGAAGG + Intronic
903914271 1:26751930-26751952 CTATGTAGAAAAAGAGAAGAGGG + Intronic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
904644821 1:31957829-31957851 TGAGGGGTAGAAAGGGAAGAGGG - Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
904849987 1:33451457-33451479 CTCAGGGGAGAAAGGGTGGAGGG - Intergenic
904961716 1:34338579-34338601 GTAGGGGGAGGAAAGGAAGAGGG - Intergenic
904975449 1:34452565-34452587 CTCTGGGGAGAAATGGGTGAGGG + Intergenic
905030944 1:34884304-34884326 CTATGGGGAGAAAGGGTGTCTGG - Intronic
905488984 1:38328855-38328877 GTATGAGGAGACAGAGAAGAGGG - Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906033939 1:42739486-42739508 CTGTGGGGAGAAGTGGATGAAGG + Intronic
906205780 1:43985634-43985656 CTCTGGGGAGTAAGGGGTGAGGG - Intronic
906864752 1:49405625-49405647 CAAAGGGAAGAAAAGGAAGATGG - Intronic
908151824 1:61310494-61310516 GTATGGGGGGAAAAGGAAGAGGG + Intronic
909278069 1:73714265-73714287 CAAAGGTGAGAGAGGGAAGAAGG + Intergenic
909893607 1:81037730-81037752 CTATAGGGAAAAATGGAACAAGG - Intergenic
910397907 1:86810203-86810225 ATAGGGGGAGAAAGGAAACAAGG - Intergenic
910998205 1:93131856-93131878 AAATGGGGTGAAAGAGAAGATGG + Intronic
911032135 1:93500445-93500467 CTTTGGGGAGAAAGGAAGGGAGG + Intronic
911170965 1:94770538-94770560 GTTTGGGGAGAAGGGGAGGAGGG + Intergenic
911262114 1:95699107-95699129 CTTTTGGGAGAAAAGCAAGATGG + Intergenic
911476930 1:98385135-98385157 CTCTGGGGAGAAAGGAAAAAAGG - Intergenic
911640553 1:100284223-100284245 GTATGGAGAGATAGGGAATAGGG + Intronic
912571533 1:110627861-110627883 TGATGGGGACAAAGTGAAGAGGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912806911 1:112764123-112764145 GAATGGGGAGAATGGGAAGTGGG - Intergenic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
913690320 1:121273560-121273582 GAATGGGGAGAAAGGGAAGGAGG + Intronic
914147222 1:145006399-145006421 GAATGGGGAGAAAGGGAAGGAGG - Intronic
914347053 1:146808839-146808861 CAACGGGGAGAAAGGCGAGATGG + Intergenic
915040145 1:152961481-152961503 CTCTGAGGAGAGAGGAAAGAGGG + Intergenic
915243776 1:154542191-154542213 CTAGAGGAAGAAAGGGAAAAGGG - Intronic
915341368 1:155178649-155178671 TGCTGGGGAGGAAGGGAAGAAGG - Intronic
915588278 1:156856846-156856868 CCAGGGAGAGAAAGGGAAGTGGG - Intronic
916301749 1:163283134-163283156 AAATGGGGAGAAAGGAAAGGGGG + Intronic
916890573 1:169108555-169108577 CTAAGGGGAAAAAGACAAGAAGG - Intronic
917134964 1:171781036-171781058 CTTTGCGGAGAGAAGGAAGAGGG + Intergenic
917514955 1:175699561-175699583 CTAAGGAGGGCAAGGGAAGATGG + Intronic
917537263 1:175883511-175883533 CTATGGGGCTAAAGGGATGAGGG - Intergenic
917908854 1:179618911-179618933 CTATTGGGATGAGGGGAAGAAGG - Intronic
918109675 1:181444419-181444441 CTATGGGGGGAAAGGGAGGAGGG + Intronic
918262240 1:182806518-182806540 CTTTGGGCTGAAAGGTAAGAGGG + Intronic
918329502 1:183444452-183444474 CTTTGGGGAAATAGGAAAGAAGG + Intergenic
918863989 1:189870861-189870883 CTTTGGGGAGAAAAGGAATAGGG - Intergenic
918958127 1:191236974-191236996 CTATGGTGAGAAAGGCCAAATGG + Intergenic
919040585 1:192382793-192382815 CTATGGAGGGAAAGAGAAGATGG + Intergenic
919394314 1:197025128-197025150 GGGAGGGGAGAAAGGGAAGAGGG - Intergenic
919632951 1:199976798-199976820 CTATGCAGAGTAATGGAAGAAGG + Intergenic
920233041 1:204482848-204482870 CGATGGGGGGAATGGGAAGAAGG + Intronic
920383766 1:205552384-205552406 CTATGTGGCGGAAGGGCAGAGGG + Intergenic
920477640 1:206292048-206292070 GAATGGGGAGAAAGGGAAGGAGG + Intronic
921066839 1:211629321-211629343 GAATGGTGAAAAAGGGAAGATGG + Intergenic
921196048 1:212759411-212759433 GCATGGGAAGAAAGGGAAGCAGG + Intronic
922215442 1:223516282-223516304 CTATGGGGACAAAGAACAGATGG - Intergenic
923268490 1:232334651-232334673 TGATGGGGAGAAAGAGGAGAAGG - Intergenic
923275065 1:232388352-232388374 CTCTGGGGAGAAAGAGGAGGAGG + Intergenic
923339533 1:232995842-232995864 TTATAGGAAGAAAGGGAAGAAGG + Intronic
923530294 1:234807000-234807022 ATGTGGGGAGAAACGGGAGAAGG + Intergenic
923532200 1:234820321-234820343 GGATGTTGAGAAAGGGAAGATGG + Intergenic
924307167 1:242701754-242701776 CAATGGGGGGAATAGGAAGATGG + Intergenic
924467545 1:244312110-244312132 CTCTGGGCAGAAAGGGAGGCTGG + Intergenic
924901610 1:248407326-248407348 CTTTGGGGAGAAAAAGAAGCAGG - Intergenic
1062778768 10:181187-181209 CTATGGGTAGAAATGGAGAATGG + Intronic
1063336628 10:5221931-5221953 CTATGGACAGAAAGGAAAGACGG + Intergenic
1063365188 10:5486336-5486358 CTGCGGGAAGAAAGGGAAGGAGG + Intergenic
1064443739 10:15375271-15375293 CTAGGGGAAGAAAGGGAAGAAGG - Intergenic
1064686337 10:17866263-17866285 GAAAGGGGAGGAAGGGAAGAAGG + Intronic
1064698165 10:17988840-17988862 CTTAGGGGTGAAAGGGAAAAGGG - Intronic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1065207448 10:23370535-23370557 CTTGGGAGAGAAAGGGGAGAGGG + Intergenic
1066706335 10:38183053-38183075 CTTTGGGGACACAGGGAAAAGGG - Intergenic
1067172866 10:43922289-43922311 GTTTGGGGAGGAAGGGAGGAAGG - Intergenic
1067402363 10:45988422-45988444 CTGTGGGGAGAAAAGGGAGTAGG + Intronic
1067672312 10:48334222-48334244 CTTAGGGGACAAAGGAAAGAGGG - Intronic
1067845959 10:49721520-49721542 CTATGGGAAGAAAAGGACAAAGG + Intergenic
1067870713 10:49958055-49958077 CTGTGGGGAGAAAAGGGAGCAGG + Intronic
1068830716 10:61491573-61491595 GGAGGGGGAGAGAGGGAAGAGGG + Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069538532 10:69274758-69274780 CTATGGGGAGAACTGGCAGGTGG + Intronic
1069842892 10:71351051-71351073 GTTTGGGGGCAAAGGGAAGAAGG - Intronic
1070391099 10:75971211-75971233 ATGGGGAGAGAAAGGGAAGAAGG - Intronic
1070545028 10:77445604-77445626 GCATTGGGAGAAAGGGAGGAAGG + Intronic
1070735419 10:78860729-78860751 GGGTGGGGAGAATGGGAAGAAGG + Intergenic
1071805435 10:89115326-89115348 CAATGGGGAGGAAGGGCAAAGGG + Intergenic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1073310342 10:102535625-102535647 GTATCAGAAGAAAGGGAAGAGGG - Intronic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1074446648 10:113526108-113526130 CCATGGGGAGAAAGGGGACAGGG + Intergenic
1074813802 10:117130035-117130057 AGGAGGGGAGAAAGGGAAGAAGG + Intronic
1074960239 10:118438133-118438155 ATATGGGAAGAAAGAGAGGAAGG - Intergenic
1075065857 10:119288459-119288481 CTTTGGGGAAACAGGGAAGCAGG - Intronic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075623734 10:123946983-123947005 GTCTTGGGAGAGAGGGAAGAGGG + Intergenic
1075850818 10:125585443-125585465 CTTGGGGGAGAAAGGGGAGAAGG - Intronic
1075935682 10:126339130-126339152 GTAAGGGTAGAAAGGGAAGATGG - Intronic
1076557926 10:131341572-131341594 CTATGTGGAGAAAAGAGAGAAGG + Intergenic
1076854222 10:133108044-133108066 ACATGTGGAGAAAGGGAAGAAGG - Intronic
1076947660 10:133662442-133662464 CTATGCAGAGTAAGGGGAGATGG + Intergenic
1077210768 11:1370078-1370100 CGAGGGGGAGGAAGGGAAGGAGG + Intergenic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077259761 11:1610081-1610103 CGATGGGCAGGAAGGGAAGGCGG - Intergenic
1078229987 11:9432056-9432078 CTATGGGAAGAAAGGAAGTAGGG - Intronic
1078321016 11:10334656-10334678 CCTTGGGAATAAAGGGAAGATGG + Intronic
1078558061 11:12346891-12346913 CTAAAGTGAGAAAGGGAGGAGGG - Intronic
1078841498 11:15079782-15079804 CTATGGGAATAAAGAGAAGAAGG + Intronic
1078925292 11:15869417-15869439 CTATAGGCAGACAGGGCAGAAGG + Intergenic
1079250790 11:18786016-18786038 CAATGGGGACAAAGGAAGGAGGG + Intronic
1079734114 11:23973969-23973991 TTATGAGGAAAAAGGGAGGAGGG + Intergenic
1079976311 11:27095819-27095841 CTATGCAGAGAAATGGAAAAAGG - Intronic
1080897504 11:36458855-36458877 CTGTGGGGAGAAAGGGAGTGGGG - Intronic
1081777478 11:45685364-45685386 CTAATGGAAGAAAAGGAAGATGG + Intergenic
1083179400 11:60974546-60974568 CTAGGGTTAGAAAGGGAAGAAGG - Intronic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1083743088 11:64721478-64721500 CTTTTGGGAGACAGGGGAGAAGG - Intronic
1083989532 11:66238352-66238374 CTCTGGGGATAAAGGGCTGAAGG - Intronic
1084054524 11:66623987-66624009 TAAAGGGGAGAATGGGAAGAAGG + Intronic
1084110838 11:67013407-67013429 CTGCAGGGAGAAAGGGGAGAAGG - Intronic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1085144373 11:74180120-74180142 GAAAGGGGAGAAAGGGAAGGAGG - Intronic
1085482905 11:76837595-76837617 CTCGGGGGAGATGGGGAAGAGGG - Intergenic
1085567848 11:77530915-77530937 AAAAGGGGAGGAAGGGAAGAGGG - Intronic
1086058510 11:82676100-82676122 ATATGGTGACAAAGAGAAGAGGG + Intergenic
1087346535 11:96978717-96978739 CTGTTGGGAAAAAGGGAAGGTGG - Intergenic
1087417015 11:97870285-97870307 CAATAGGGAGGAAGGAAAGAAGG - Intergenic
1087501191 11:98956082-98956104 CTATGGGAAGGAAGGAAGGATGG - Intergenic
1087793021 11:102427369-102427391 CTATGAGGAACAAGGGGAGAAGG + Intronic
1087804071 11:102537101-102537123 TTATGCAGAGAAAGGGAAGGTGG + Intergenic
1088153803 11:106780158-106780180 CTATGGAGAGAAAGAGAGAAAGG - Intronic
1088183048 11:107133763-107133785 CTATGGGGAGACAGAGGAAAAGG + Intergenic
1088368358 11:109062356-109062378 CCATGGGGAGAAGGTGATGAAGG + Intergenic
1088409091 11:109513678-109513700 CTCTGGGGAGACAGTGTAGATGG + Intergenic
1088926538 11:114308513-114308535 GTATGGGGAGGAAGGGAGGGAGG - Intronic
1088987079 11:114918572-114918594 CTCTTTGGAGAAGGGGAAGATGG + Intergenic
1088993626 11:114976797-114976819 CTTTGGGTAGAAAGAAAAGAAGG + Intergenic
1089039420 11:115432310-115432332 GGATGGGGAGAAAGGGACAATGG - Intronic
1089362618 11:117901059-117901081 CTATGGAGAGAAAGCTAACATGG - Intronic
1089619598 11:119714647-119714669 CGATGGGGAGAGAGGGGACAGGG - Intronic
1089740232 11:120577351-120577373 CTATGGGAAGAGTGGGATGATGG + Intronic
1090056301 11:123428022-123428044 CTATGGGCAGCTTGGGAAGAGGG - Intergenic
1090552906 11:127842316-127842338 GTTTAGGGAGAAAGGGAAGAAGG - Intergenic
1091114739 11:133002710-133002732 GTATAGGGAGAAAGAGAGGAGGG + Intronic
1091204298 11:133809097-133809119 AGCTGGGGAGAAAGTGAAGACGG - Intergenic
1091410547 12:236502-236524 CTGGAGGGAGGAAGGGAAGAGGG - Intronic
1092947882 12:13473707-13473729 CTCTGGGGAGAGGAGGAAGATGG + Intergenic
1093475382 12:19548938-19548960 CTAAAAGGAGGAAGGGAAGAAGG - Intronic
1093931257 12:24956974-24956996 GTAGGGGGAGGAAAGGAAGAAGG - Intergenic
1095168083 12:38998384-38998406 CAAGGGGGAGAAAGGGAAGGGGG - Intergenic
1095679588 12:44958530-44958552 GTATGGGGAGAGGGGGACGACGG + Intergenic
1095843978 12:46726074-46726096 CTATGGGTTGAATGGGGAGAGGG - Intergenic
1096307814 12:50493754-50493776 AAATGGGGAGACAGGGAATATGG - Intergenic
1096682906 12:53268691-53268713 CTAACTGGAGGAAGGGAAGAGGG - Intronic
1097275119 12:57807830-57807852 CCAGAGGGAGAAAGGGAACATGG - Intronic
1097506811 12:60483996-60484018 CCATGGGGTGAAAAGGAAGAAGG - Intergenic
1097765504 12:63522031-63522053 CTCTAGGCAGAAAGAGAAGAGGG + Intergenic
1097872591 12:64613456-64613478 GAATGGGGAGAAAGGGGTGAGGG + Intronic
1098166532 12:67704282-67704304 CTCTGGGGAGAAGGGGCAGCTGG - Intergenic
1098480609 12:70954947-70954969 AGATGAGGAGAAAGGGAAGGTGG + Intergenic
1098501470 12:71197670-71197692 CTAAGGTGAGACATGGAAGAGGG - Intronic
1098763958 12:74461328-74461350 GCAAGGGGAGAAAAGGAAGATGG - Intergenic
1098981623 12:76962678-76962700 TAAGGGGGAGAAAGGGGAGAGGG + Intergenic
1099304160 12:80934855-80934877 CAAAGGAGAGGAAGGGAAGAAGG - Intronic
1099845872 12:88027876-88027898 CAAGGGGGAGAGAGTGAAGATGG - Intronic
1100149591 12:91719955-91719977 GGAGGGAGAGAAAGGGAAGAAGG + Intergenic
1101523800 12:105508956-105508978 CCAAGGGGAGAAAGGGAGAATGG - Intergenic
1101763474 12:107677942-107677964 GAATGAGGAGACAGGGAAGAGGG - Intergenic
1102107644 12:110339065-110339087 CTATAGAGAAAAAGGGAAGGGGG - Intronic
1102409452 12:112704599-112704621 CTCTGGGAAGAAAGAGATGATGG - Intronic
1102457964 12:113082470-113082492 CTATGAGGGGAAAGGGATGGAGG + Intronic
1102588619 12:113940722-113940744 CTCTGGTGAGAAAGGGATGCAGG - Intronic
1102615492 12:114150545-114150567 CTTTGGGGAGAATGGGATAAAGG - Intergenic
1102706069 12:114881616-114881638 CTCTGGGGTGAAAGGGAGGAAGG - Intergenic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103216773 12:119207773-119207795 ATTTGGGGAGAAAGGGATGTGGG - Intronic
1103848915 12:123918415-123918437 ATATGGGAAGAAAAGGGAGAGGG + Intronic
1104083582 12:125455219-125455241 CTAGGGGGAGAGAGAGGAGAGGG + Intronic
1104244885 12:127029405-127029427 CTATGGGGAAAAAAGAATGATGG - Intergenic
1106184409 13:27396456-27396478 CTTTGGGGAGAAAAAGAATAAGG + Intergenic
1106478508 13:30118483-30118505 ATATGGAGAGAAGGGGAAGGAGG + Intergenic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1108633106 13:52305871-52305893 ATATGGGGAGAAAGAAAAGAGGG - Intergenic
1108653585 13:52506689-52506711 ATATGGGGAGAAAGAAAAGAGGG + Intergenic
1109737145 13:66500890-66500912 CTATGTGGATATAGGGAAAAAGG - Intronic
1110471548 13:75865661-75865683 CTTTGGGGAGGAGGGGAAAAAGG - Intergenic
1110508133 13:76314392-76314414 ATATGGGCAGAGAGGGAAAAGGG + Intergenic
1111827235 13:93282694-93282716 GAAGGGGGAGAAAGGGATGATGG - Intronic
1111827246 13:93282855-93282877 GAAGGGGGAGAAAGGGATGATGG - Intronic
1111827257 13:93283016-93283038 GAAGGGGGAGAAAGGGATGATGG - Intronic
1112778865 13:102875801-102875823 CGATGGAGGGAAAGAGAAGATGG + Exonic
1113403021 13:110012282-110012304 CTATGAGGAGCAAGAGAAGTAGG + Intergenic
1114053393 14:18943084-18943106 CTTTGAGGAGAAAAGCAAGATGG + Intergenic
1114109166 14:19458842-19458864 CTTTGAGGAGAAAAGCAAGATGG - Intergenic
1114123326 14:19694330-19694352 CTATTGGGGGATAGGGATGAGGG + Intergenic
1114491099 14:23102486-23102508 CTAACTGCAGAAAGGGAAGAAGG + Intergenic
1115729482 14:36252980-36253002 CTATGGGTGGAAGGGGAAGAGGG + Intergenic
1115730271 14:36260956-36260978 ATGTGGGGAGAAATGGAAGGTGG + Intergenic
1116059939 14:39910218-39910240 CTAGGGTGAGAAAGAGCAGAAGG - Intergenic
1116974862 14:51104969-51104991 CTCAGGAGAGAAAGAGAAGATGG - Intergenic
1118118744 14:62811470-62811492 CTAGACAGAGAAAGGGAAGATGG - Intronic
1118399278 14:65364597-65364619 CTATGGGGGACAAGGCAAGATGG - Intergenic
1118653157 14:67919393-67919415 TTTAGGGGAGAAAGGGAGGAGGG - Intronic
1118765179 14:68904737-68904759 CTAGAGGGAGAAAAGGAGGAAGG + Intronic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1119610313 14:76056326-76056348 CTGTTGGGAGAAAAGGGAGAGGG + Intronic
1120159675 14:81131786-81131808 CTATGGGGAAAAGGGGAACAGGG - Intronic
1120384218 14:83823719-83823741 CTCTGGTGAGAAGAGGAAGAGGG - Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1120969601 14:90196351-90196373 TTATTGGGAGAAAAGGAAAAAGG - Intergenic
1121408083 14:93731191-93731213 CTAGGTGGAGAATGAGAAGAGGG + Intronic
1121481114 14:94275409-94275431 GTATTAGGAGAAAAGGAAGATGG - Exonic
1121510697 14:94510923-94510945 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1121688902 14:95860629-95860651 GGGTGGGGAGAAAGGAAAGAAGG + Intergenic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1124218789 15:27831897-27831919 CTATGGGGATAAAGAGGAGAAGG - Intronic
1124681777 15:31738207-31738229 GGATGGGGAGAGAGGGAGGAGGG + Intronic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125399846 15:39290169-39290191 CTATGGGTAAAAAGTGAAAATGG + Intergenic
1125440120 15:39692847-39692869 GAATGGGAAGAAAGGGGAGAAGG + Intronic
1125618131 15:41034333-41034355 CCCTGGGGAGTAAGAGAAGAAGG + Intronic
1125702816 15:41703385-41703407 ATATGGAGAGAAAGGGAGGGTGG - Intronic
1126080101 15:44952134-44952156 CTATGGAGTAAAAGGGGAGATGG - Intergenic
1126577311 15:50209810-50209832 CCAAGAGGTGAAAGGGAAGAAGG - Intronic
1127176760 15:56366346-56366368 TTAGGGGGAAAAGGGGAAGAGGG - Intronic
1127187746 15:56497181-56497203 CCATGAGGAGAAAGTGGAGAGGG + Intergenic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127513385 15:59666247-59666269 TTTTGGGGAGCAGGGGAAGAAGG - Intronic
1127537239 15:59901245-59901267 CTATGGGACAAAAGGGAAGAGGG - Intergenic
1127762142 15:62149925-62149947 CCATGGGGAACAAGAGAAGAAGG - Intergenic
1128255645 15:66194649-66194671 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1129055118 15:72813849-72813871 CTCTGGGGAGCTAGGGAAGGAGG - Intergenic
1129693065 15:77724648-77724670 CTATGGTGAGGAATGGATGAGGG + Intronic
1129756704 15:78103226-78103248 CTAAGGAGAGAAGGGGAAGAAGG - Intronic
1130436610 15:83905850-83905872 GTATGGGGAAAAAGGCAAGCTGG - Intronic
1130632318 15:85581533-85581555 TGATTGGGAGAAAGGGAAGCTGG + Exonic
1130994998 15:88898793-88898815 CTATGGGGAGAAAGGGAGCGAGG - Exonic
1131227604 15:90638466-90638488 CTGTGGGCAGAAAGGAAAGTTGG - Exonic
1132697899 16:1210108-1210130 CTGTGGGGAGAAGAGGTAGAGGG - Exonic
1133382797 16:5345330-5345352 CAATGGAGAGGAAGGGAAAAGGG - Intergenic
1134229459 16:12417652-12417674 GTAAGAGGAGGAAGGGAAGAGGG - Intronic
1134516858 16:14894468-14894490 CTATTGGGAGAAAGGGAGAATGG + Intronic
1134704528 16:16293122-16293144 CTATTGGGAGAAAGGGAGAATGG + Intronic
1134782911 16:16914875-16914897 CTATGGGGTCAAATTGAAGAAGG + Intergenic
1134829814 16:17313866-17313888 CTACAGGGAGAATGGGAATAAGG + Intronic
1134963014 16:18418992-18419014 CTATTGGGAGAAAGGGAGAATGG - Intronic
1134967309 16:18501591-18501613 CTATTGGGAGAAAGGGAGAATGG - Intronic
1135324599 16:21518506-21518528 CTTTGGGGAGAAGGGGGAGGGGG - Intergenic
1135910890 16:26559611-26559633 CTGAGGGGGGATAGGGAAGAGGG - Intergenic
1136336086 16:29611776-29611798 CTTTGGGGAGAAGGGGGAGGGGG - Intergenic
1136342713 16:29655421-29655443 CTATGGGGAGAAAGCAAGGAGGG + Intergenic
1137290099 16:47046658-47046680 GTATGGGGAGATGGGGAGGAAGG + Intergenic
1137721981 16:50632822-50632844 ATATGAAGAGAAAGGGGAGAAGG - Intronic
1137728781 16:50674621-50674643 CTGGGAGGAGAAAGGGCAGAGGG + Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137949851 16:52773357-52773379 CTATGGGGAGAAATAGGAGGGGG + Intergenic
1138165895 16:54801294-54801316 CTCTGGGGAGAAATGCCAGATGG - Intergenic
1138544393 16:57707012-57707034 CTATGGAAGGAAAGGAAAGAAGG - Intronic
1138894822 16:61190803-61190825 GAAGGGGAAGAAAGGGAAGAAGG - Intergenic
1138932079 16:61671287-61671309 CTAAGGGAAGAAATGGAATACGG - Intronic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1139477922 16:67212133-67212155 CTCTGGGGAGAGGGAGAAGAGGG + Intronic
1139986932 16:70906431-70906453 CAACGGGGAGAAAGGCGAGATGG - Intronic
1140578632 16:76202501-76202523 TAATGGGAAGAAAGGAAAGACGG - Intergenic
1140731865 16:77863761-77863783 ACCTGGGGGGAAAGGGAAGAAGG + Intronic
1140911871 16:79461672-79461694 CTATTTGGAGAAATGGGAGAGGG + Intergenic
1141105716 16:81232059-81232081 ATGTGGGGAGAATGGGATGAGGG - Intergenic
1142763350 17:2053585-2053607 CTATGGGGAGACATGGGAGAGGG + Intergenic
1142781252 17:2182858-2182880 GTAGGGGAAGAAAAGGAAGAGGG + Intronic
1142946828 17:3436559-3436581 ATTTGGGGAGAAAGGGAACGAGG + Intergenic
1143278313 17:5731106-5731128 CCTGAGGGAGAAAGGGAAGAAGG - Intergenic
1143563347 17:7707935-7707957 CTATGGGGAGGAGGGTAAGGTGG - Intronic
1143565967 17:7720848-7720870 CTAGGAGGAGTAGGGGAAGATGG + Intronic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143792514 17:9308768-9308790 CCTTGGGCAGAAAGGGAAGCAGG + Intronic
1144053204 17:11515512-11515534 AGATGGGGAGAAAAGAAAGAAGG + Intronic
1144697553 17:17315475-17315497 CTTTGGGTAGAATGGGAAGCTGG + Intronic
1144875781 17:18396457-18396479 CTTTGGGAAGGAAGGAAAGAAGG - Intergenic
1145156447 17:20547964-20547986 CTTTGGGAAGGAAGGAAAGAAGG + Intergenic
1146449950 17:32964990-32965012 CCAAGGGGACAAAGGAAAGAGGG + Intergenic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1148510837 17:48168292-48168314 CTTTTGGGAAAAAAGGAAGAAGG + Intronic
1148638719 17:49169027-49169049 GTCTGGGGAGAAAGGGGAAAGGG - Intronic
1148878762 17:50708789-50708811 CCCTGGGGAGGAAGGGAGGAAGG + Intergenic
1149141331 17:53436356-53436378 CTGGTGGGAGAAGGGGAAGAAGG - Intergenic
1150905826 17:69336123-69336145 CCATGGGAAAAAAGGGAAAATGG - Intergenic
1151110265 17:71668075-71668097 CTATGGGTAGAAAGGAGACATGG + Intergenic
1151622105 17:75252460-75252482 GGATGAGGAGAGAGGGAAGAAGG - Intronic
1152289711 17:79432960-79432982 GTAGGGGGAGCAAGAGAAGAGGG - Intronic
1152645579 17:81467114-81467136 CTGTGGCAAGAAAGGAAAGACGG + Intergenic
1153002119 18:465056-465078 TTCTGGGAAGAAAGGGGAGATGG + Intronic
1153015982 18:582959-582981 ATATGGGGACAAGGGGAGGAGGG + Intergenic
1155029453 18:21971603-21971625 TTTTTGGGAGACAGGGAAGAGGG - Intergenic
1156169812 18:34469163-34469185 CTATGGGGGGATAGAGAAAAGGG - Intergenic
1156219886 18:35040911-35040933 CTATTTGGAGAAAGGGAGAAAGG + Intronic
1156460399 18:37318455-37318477 TTCTGGGGAGAAGGGGAAGGGGG - Intronic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157254443 18:46125867-46125889 CACTGAGGAGAAAGGAAAGAAGG - Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157349750 18:46873871-46873893 GTAGGGGGAGAAAGGCAAGGAGG - Intronic
1157386680 18:47263863-47263885 CTAGGCTGAGAGAGGGAAGAGGG - Intergenic
1157430399 18:47619828-47619850 CTATGGGGAGCTATGGTAGATGG + Intergenic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1158311701 18:56166426-56166448 CTATAGGAAGAGAGGGAAGGGGG + Intergenic
1158514371 18:58119178-58119200 AGATGGGGACAAAGGGAAGGTGG - Intronic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1159169865 18:64752039-64752061 CAATGGGGAGAAAGGGGTGGAGG - Intergenic
1159658459 18:71061894-71061916 CCATAGGGAGAAAGGAAAGCTGG - Intergenic
1159695937 18:71556523-71556545 CCATGGGAAGAATGGGGAGAAGG + Intergenic
1159825387 18:73202341-73202363 CTCTGGGGAGCAAGGGGAGTAGG - Intronic
1160007553 18:75079135-75079157 CCATGGGGAGAAACGGAATTAGG + Intergenic
1160758660 19:771742-771764 GGAGGGGGAGAAAGGGAGGAGGG - Intergenic
1160758759 19:772030-772052 AGAGGGGGAGACAGGGAAGAGGG - Intergenic
1161257349 19:3316675-3316697 CTGTGGGGAGAAAGGGTGGCTGG + Intergenic
1161268070 19:3374341-3374363 TGATGGGGAGAAGGGGAACAAGG - Intronic
1161273402 19:3402875-3402897 TGAGGGGGAGAGAGGGAAGAGGG + Intronic
1161274298 19:3406994-3407016 CGAGGGGGAGAGAGGGACGAGGG + Intronic
1161277472 19:3426684-3426706 CGACGGGGAGAGAGGGAGGAGGG - Intronic
1161316324 19:3619243-3619265 CTGTGGGGAGCAGGGGAAGGTGG + Intronic
1161431281 19:4233687-4233709 CAAGGGGGAGACAGGGAGGAGGG - Intronic
1161503820 19:4633221-4633243 CTAGGGGTAGAGAGGGAGGAGGG + Intergenic
1161619209 19:5289577-5289599 GGAGGGGGAGAAAGGGAGGAGGG - Intronic
1161644504 19:5444725-5444747 CAAGGGGGAGACAGGGAGGAGGG - Intergenic
1161664214 19:5565143-5565165 CAAGGGGGAGAGAGGGAGGAAGG - Intergenic
1161846929 19:6717064-6717086 CGAGGGGGAGAGAGGGAGGAGGG + Intronic
1162085614 19:8247254-8247276 CAAGGGGGAGAGAGGGAGGAGGG - Intronic
1162323841 19:9986713-9986735 CCAGGGGGAGAAAGGCGAGAAGG - Exonic
1163023277 19:14495224-14495246 CTCTGGGGAGAAGGGAAAGGAGG + Intronic
1164521276 19:28982126-28982148 AGATGGGGAGGAAGGGAGGAAGG + Intergenic
1164768318 19:30788540-30788562 CTAGGGGGAGAAAAGCAGGAGGG + Intergenic
1165084145 19:33331201-33331223 GTATGTGGACAAAGGGTAGAGGG + Intergenic
1165212965 19:34250189-34250211 CTTTTAGGTGAAAGGGAAGAAGG - Intergenic
1165765175 19:38346043-38346065 CTCTGGAGAGAAATGGAACAGGG + Intronic
1165934921 19:39383476-39383498 CTGTGGTAAGAAAGGGAGGAAGG - Intronic
1166040359 19:40198582-40198604 CTCTGGGGAGTAAGGGAGGGAGG + Intronic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166646130 19:44533078-44533100 GGATGGGGAGGAGGGGAAGAGGG - Intergenic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166914116 19:46182922-46182944 GTATGAGGAGAAAGGGAGAAAGG - Intergenic
1167117277 19:47495595-47495617 CTCTGGAGAGAAAGGGAGGTGGG + Exonic
1167579086 19:50331534-50331556 AGATGGGGAGAAGGGGAAGAAGG - Intronic
1167579098 19:50331574-50331596 AGATGGGGAGAAGGGGAAGAAGG - Intronic
1167579110 19:50331614-50331636 AGATGGGGAGAAGGGGAAGAAGG - Intronic
1167623203 19:50569900-50569922 CTCCGAGGAGAAGGGGAAGAGGG - Intergenic
1167660535 19:50793661-50793683 CTGTGGGGAGACAGGACAGATGG - Intronic
1168582397 19:57566507-57566529 GTATGGGAAGAAAGAGAAGTGGG - Intergenic
1202702955 1_KI270713v1_random:2048-2070 GGATGTTGAGAAAGGGAAGATGG + Intergenic
925689539 2:6506882-6506904 CAATGGAGAGAAAGCGGAGAGGG + Intergenic
925733511 2:6941021-6941043 CCATAGGGAGAAATGGGAGAAGG - Exonic
926964721 2:18397246-18397268 CTATGGAGAAAAATGGAGGAAGG - Intergenic
927287308 2:21369986-21370008 GGAGGGGGAGGAAGGGAAGAAGG - Intergenic
927422395 2:22947351-22947373 CTATGGGGAGAAATGCAAGTTGG - Intergenic
927686540 2:25175070-25175092 CTATGGAGAGAGAATGAAGAAGG - Intergenic
928055899 2:28054287-28054309 GTAGGGGGAGAAAGAGAAGAAGG - Intronic
928200730 2:29246214-29246236 GGAGGGGGAGAGAGGGAAGAAGG + Intronic
928219995 2:29395592-29395614 CTTGGGGGAGAAAGGGGAGCAGG - Intronic
928439316 2:31278813-31278835 CAAAGGGGTGAAAGGGAGGAAGG - Intergenic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929262766 2:39884019-39884041 CTATGAGGCTGAAGGGAAGATGG + Intergenic
929928743 2:46235940-46235962 GTATGGGGAGAAAGGAGAGCAGG + Intergenic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930630226 2:53745625-53745647 CTAGGGGTAGAAAGTGAATATGG - Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931493422 2:62775025-62775047 CTATGGAGAAAAAAGGAAGAGGG + Intronic
932177007 2:69611989-69612011 CTTGGGGGAGAAAGGGAATAGGG + Intronic
932307923 2:70716935-70716957 TTATGGGGAGACAGAGAGGAAGG + Intronic
932594693 2:73086724-73086746 CTAGGGGAAGATTGGGAAGAAGG - Intronic
933177387 2:79190915-79190937 CTATGGGTAGAGTGAGAAGATGG - Intronic
933654003 2:84872533-84872555 CTAGAGGGAGGGAGGGAAGAAGG + Intronic
934570203 2:95365807-95365829 CTATGGGGAGGAGGGAAATAGGG - Intronic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
936810047 2:116387595-116387617 ATATGGGTAGAAAGTTAAGAGGG - Intergenic
936959332 2:118057000-118057022 GCATGGGGAGCAAGGGAAAAAGG - Intergenic
937005305 2:118506771-118506793 CTATGTGGGGAAAGAAAAGAAGG + Intergenic
937081815 2:119145626-119145648 CTGTTTGGAGAAAGCGAAGAAGG + Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937464112 2:122114795-122114817 AGAAAGGGAGAAAGGGAAGAAGG - Intergenic
938278444 2:130048620-130048642 CTTTGGGGAGAATGGGAGGAGGG + Intergenic
938329419 2:130439479-130439501 CTTTCGGGAGAATGGGAGGAGGG + Intergenic
938360529 2:130682024-130682046 CTTTCGGGAGAATGGGAGGAGGG - Intergenic
938436932 2:131288732-131288754 CTTTCGGGAGAATGGGAGGAGGG - Intronic
938890154 2:135696337-135696359 TTATGGGGAAGAAGGGAAGGTGG + Intronic
939262706 2:139830949-139830971 CTATGGGGAGAAAAGACTGAGGG + Intergenic
939495809 2:142926543-142926565 TTATGGGGTGATAGGGAAGAAGG + Intronic
939787749 2:146537952-146537974 AAATGGGGAGAAGGGGTAGATGG + Intergenic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
940084765 2:149846811-149846833 CTAGGAGGAGAAAGGAATGATGG + Intergenic
940261898 2:151789793-151789815 ATATGAGGAGAAAGAGAGGAAGG - Intronic
940368040 2:152870520-152870542 CCGTGGGGAAAAAGAGAAGAGGG + Intergenic
941346737 2:164378431-164378453 AGATGGGAAGAAAGGGCAGAAGG - Intergenic
942022491 2:171880704-171880726 CTAGAGGGAGAAAGGAAGGAGGG - Intronic
942837114 2:180313866-180313888 CTATGGGTAGAAGGAGCAGAAGG + Intergenic
942941876 2:181628327-181628349 CTATTGGGAGAAGAGAAAGAGGG + Intronic
943312350 2:186342333-186342355 CTTTAGGCAGAAAGAGAAGAGGG + Intergenic
943543008 2:189241191-189241213 TTAAGGGAAAAAAGGGAAGATGG - Intergenic
943572749 2:189593202-189593224 CTTTGGGGATAAGGGGGAGAGGG + Intergenic
943731720 2:191309195-191309217 CCAAGGTGAGAAAGAGAAGAGGG - Intronic
943750053 2:191501405-191501427 CGAAGGGGAGAAATGGAAGCTGG + Intergenic
944176160 2:196831177-196831199 CCTAGGGGACAAAGGGAAGAGGG - Intergenic
944873535 2:203938302-203938324 CAATGGGGAGAACGGTATGAAGG + Intronic
945224464 2:207519397-207519419 TTATGGGGAAAGAGGGAGGAAGG - Intergenic
945474478 2:210264911-210264933 ATATGGGAAGCAAGAGAAGAAGG + Intergenic
945583540 2:211627754-211627776 ATATCAGGAGAAAGGTAAGATGG + Intronic
946048050 2:216837575-216837597 TTATGGGCAGCAAGTGAAGATGG - Intergenic
946537803 2:220650359-220650381 CTCTGATGAGAAAGGGGAGAGGG - Intergenic
946543055 2:220706962-220706984 CTCTGGGAGGAAAGGGCAGAGGG - Intergenic
946637934 2:221751053-221751075 CTAGGAGGAGGAAGTGAAGAAGG + Intergenic
947202129 2:227623170-227623192 CCATGGGGGGAAAGGGTAAATGG - Intronic
947258012 2:228187578-228187600 CTAAGGAGAGGTAGGGAAGAAGG + Intergenic
947778578 2:232735839-232735861 CTTTGGGGAAAAAGGAAGGAGGG - Intronic
947996678 2:234533835-234533857 CTTTGGTGAGGAAGGAAAGATGG + Intergenic
948078267 2:235183924-235183946 CTGTGGAGAGACAGGGAGGAAGG - Intergenic
948381398 2:237552314-237552336 CTTTGGGGAAAACAGGAAGAGGG - Intronic
948997857 2:241592873-241592895 GTACGGGGAAAAAGGGAAAATGG + Intronic
1169143223 20:3237714-3237736 CCCTAGGGAGAAAGGGAAGCAGG + Intronic
1170101918 20:12710909-12710931 CTGTGGGGAGAAAGGGAGAGAGG - Intergenic
1170396181 20:15927840-15927862 CTTTAGGAAGAAAGGAAAGAAGG - Intronic
1170463812 20:16604539-16604561 GTATGCTGAGAAAGGTAAGATGG - Intergenic
1170604042 20:17862830-17862852 TTATGGTGAGAAAGGGAGGAAGG + Intergenic
1172387207 20:34542341-34542363 CTAGGGGGACTAAGGGAAGGTGG - Intergenic
1172786025 20:37469484-37469506 CTCTGGGAAGCAAGGGAGGAGGG - Intergenic
1173427882 20:42958395-42958417 GAATGGTGGGAAAGGGAAGAAGG + Intronic
1173790000 20:45822397-45822419 CTATGGGAAGAAAGAGAGGGAGG + Intergenic
1174020826 20:47526771-47526793 CCATGGGGAGAGAGGGGAGAGGG + Intronic
1175499886 20:59442173-59442195 GAGTGGGGAGAAAGGGAAGGAGG - Intergenic
1175889335 20:62309474-62309496 CTCTGGGGGCACAGGGAAGATGG + Exonic
1175998537 20:62821898-62821920 GTTGGGGGAGAAAGGGAAAAGGG - Intronic
1177624543 21:23643721-23643743 CTATCGGGAGAACAGCAAGAGGG + Intergenic
1178022884 21:28430137-28430159 CCATAGGGAGAAAGTGAAAATGG + Intergenic
1178446506 21:32648267-32648289 GTTTGGGGGGAAAGAGAAGAGGG - Intronic
1179501748 21:41813468-41813490 CTCTGGGGAGCAGGGGAGGAAGG + Intronic
1179902406 21:44401016-44401038 CCGTGAGGAGAAAGGGAAGGAGG - Intronic
1180471862 22:15665459-15665481 CTTTGAGGAGAAAAGCAAGATGG + Intergenic
1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG + Intronic
1181716937 22:24737858-24737880 CTATGTGTAGAAAGAGAAGGGGG + Intronic
1182280267 22:29214365-29214387 CCATGGGGAGAAGCGGAGGAAGG + Intronic
1182298339 22:29323826-29323848 ATCTGGGGAAAAAGGGAAGTTGG + Intergenic
1182299888 22:29331449-29331471 CTTTGTGGAGGACGGGAAGATGG - Exonic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1182617448 22:31597267-31597289 CTCTGGAGAAAAAGGGCAGAGGG + Intronic
1183136023 22:35888625-35888647 CTCATGGCAGAAAGGGAAGAGGG + Intronic
1183290260 22:36997653-36997675 CTATGGGGAGAATGGACATAGGG - Intronic
1183499312 22:38168944-38168966 CTATATGGACAAAGGGAAGAAGG - Intronic
1183502845 22:38191402-38191424 CTGTGGCGAGACAGGGAGGAAGG - Intronic
1183608295 22:38879926-38879948 CTATGGGGAGAGAGGGTGGTGGG - Intergenic
949225922 3:1695911-1695933 CTATGGGGAGAGAGACAGGAAGG - Intergenic
950134268 3:10569712-10569734 CTCTGGGGTGAAAGTGAAGGAGG + Intronic
950157544 3:10734479-10734501 CTATGGGGAGGAATGGAATGAGG + Intergenic
950266307 3:11575705-11575727 CCATAGGGAGAATGGAAAGATGG - Intronic
950433697 3:12966546-12966568 TTATGGAGAGAAAGGGAGAAAGG - Intronic
950499621 3:13355355-13355377 CTGTGGAGAGAAAGGGAATGTGG - Intronic
950504269 3:13384297-13384319 CTTTGGGGAGAAGCGGCAGAGGG + Intronic
951952148 3:28211923-28211945 TTATGCAGAGAAAAGGAAGAGGG + Intergenic
952155773 3:30641933-30641955 AAAGGGAGAGAAAGGGAAGAAGG - Intronic
952197886 3:31095202-31095224 CTATTGGGAGACAGGAAGGATGG - Intergenic
952289884 3:32004924-32004946 CTATGGGGAGAAACATAAGTGGG - Intronic
953237545 3:41119682-41119704 CAAGGAGGAGGAAGGGAAGAGGG - Intergenic
953278204 3:41525238-41525260 GCATGGTGAGAAAGGGAAGCAGG + Intronic
953879427 3:46683936-46683958 TCATGGGGGTAAAGGGAAGAAGG + Intronic
954441033 3:50522055-50522077 GGCTGGGGAAAAAGGGAAGAGGG - Intergenic
954850348 3:53594748-53594770 CTAACGTGAGAAAGGTAAGAAGG - Intronic
954881087 3:53836402-53836424 CCCTGGGGAGGAAGGGAAGGTGG - Intronic
955166227 3:56516548-56516570 GAAAGGGGAGAAAGGGAAGAAGG + Intergenic
955527447 3:59836013-59836035 CTATGGGGAGTGAGGGAAAATGG - Intronic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
956329309 3:68087630-68087652 CAAAGGGAAGAAAGGAAAGAAGG - Intronic
956664642 3:71631054-71631076 TTATGGAGTGAATGGGAAGAGGG - Intergenic
956760644 3:72440664-72440686 CTATAGGTAAAAAGGGAAGTGGG + Intronic
956834668 3:73086827-73086849 CCATGAGGAGGAAGGGGAGAGGG + Intergenic
956921852 3:73938127-73938149 CCATAGGGAGACAGGGAAGAAGG + Intergenic
957192797 3:77031312-77031334 CAATGGGGATGATGGGAAGATGG + Intronic
957210310 3:77250368-77250390 CTATGGAGACAATGGGAAAAAGG - Intronic
958558435 3:95709757-95709779 AAATGGGGAAAAAGGGAAGTTGG + Intergenic
958813760 3:98893072-98893094 AATTGGGGATAAAGGGAAGAGGG + Intronic
959019509 3:101173174-101173196 CTATGGGAGGACAGAGAAGAAGG - Intergenic
959369995 3:105511421-105511443 CTTTGAGGAGAAAGGAGAGATGG - Intronic
959539594 3:107523930-107523952 ATAGGGGGAGAGGGGGAAGAGGG + Intronic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
959995131 3:112672201-112672223 TGATGGGGAGAAAAGGCAGAAGG + Intergenic
960523609 3:118683541-118683563 CTATGGGAAGAATGGGGCGAGGG + Intergenic
960737495 3:120796772-120796794 CTCTGGGGAGAAATGGTACATGG - Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961382462 3:126504794-126504816 CTAAGGAGAGGAAGGGAAGTCGG - Intronic
961666804 3:128497821-128497843 CTCTGGGGAGATAGGGAAAATGG - Intergenic
962029504 3:131584427-131584449 ATATAGGGAGTAAGGGAAGGAGG - Intronic
962053699 3:131846490-131846512 GAATGGGGATAAAGGGAAGCTGG - Intronic
963116659 3:141736132-141736154 GCATGGGGAGAAAGGAAAGCAGG - Intergenic
963258468 3:143169792-143169814 CACTGGGGAGAAAGGCATGATGG - Intergenic
963550087 3:146709341-146709363 GTAAGGGGAGGAAGGAAAGAAGG - Intergenic
963642618 3:147878259-147878281 TTATGGTGAGGAAGAGAAGAAGG + Intergenic
964389367 3:156181717-156181739 GTGTGGGGAGAAATGGAAGGAGG + Intronic
964574636 3:158151484-158151506 TTCAGGGGAGAAGGGGAAGAGGG + Intronic
964884709 3:161468346-161468368 GGATGGGGACAAAGGGAGGAAGG + Intergenic
965486336 3:169283159-169283181 ATTTAGGGAGAAAGGGATGAGGG + Intronic
966097335 3:176220136-176220158 CAAAGGGAAGAAAGAGAAGACGG + Intergenic
966175718 3:177136006-177136028 CTATTGGAGTAAAGGGAAGATGG - Intronic
966476524 3:180354609-180354631 CTGTGGGGACAAAGGCAAAATGG - Intergenic
966657403 3:182374781-182374803 TTTTGGAGAGAAAAGGAAGAGGG - Intergenic
967341635 3:188405210-188405232 GTATGTGGAAAAGGGGAAGAGGG - Intronic
967532570 3:190566057-190566079 AGATGGAGAGAAAGGAAAGAAGG - Intronic
967631050 3:191743214-191743236 CCTAGGGGACAAAGGGAAGAGGG - Intergenic
967701064 3:192592729-192592751 CTCTGGAGATAAAGAGAAGATGG - Intronic
968135232 3:196215918-196215940 CTATGTGGAGAGAGAGAAAAGGG + Intronic
969359178 4:6650839-6650861 CCATGAAGACAAAGGGAAGAAGG - Intergenic
969933580 4:10658584-10658606 CTTTGGGGAGATAGGGAGGCTGG - Intronic
970011784 4:11467634-11467656 CTGAGGGGTGAAAGGGAAGAAGG + Intergenic
970142473 4:12997124-12997146 CTATGGTGAGACAGGGAGAATGG + Intergenic
970781579 4:19744173-19744195 TTATGGGGAGAGGGAGAAGAAGG - Intergenic
970810780 4:20091617-20091639 TTAAGGGGAGAAAAGAAAGAAGG + Intergenic
971254818 4:25004652-25004674 CTATGTGGTGAAAGGGCAGAGGG - Intronic
971454120 4:26828002-26828024 CTATGGGGTTAAAGGGTAGATGG + Intergenic
972138920 4:35930885-35930907 ATATCAGGAGAAAGGAAAGATGG - Intergenic
972245168 4:37238943-37238965 GAATGGTGAGAAAAGGAAGATGG + Intergenic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
973218416 4:47697770-47697792 CCATGAGGAGAAAGGGGAGCTGG + Intronic
974162813 4:58161864-58161886 TCTTGGGGAGAAAGGGAAGCAGG + Intergenic
974747380 4:66093095-66093117 ATATGGAGAGAAAGGAGAGATGG + Intergenic
975008234 4:69317681-69317703 CTGTGAGGAGAAAAGGAACATGG - Intronic
975612975 4:76219611-76219633 CTGAGGGGAGAAAGGGGGGATGG + Intronic
976009973 4:80475288-80475310 TTATGGGGAGAAATAGAAGCAGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976361519 4:84184018-84184040 CTATGGGATGAAAGGGTAGAAGG - Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
977371614 4:96144504-96144526 CCATGGGGATATTGGGAAGAGGG - Intergenic
977840672 4:101699839-101699861 AGAAGGAGAGAAAGGGAAGAAGG - Intronic
978697118 4:111595816-111595838 GTTTGGGGAGAAATGGAAGGAGG - Intergenic
978879505 4:113684649-113684671 TTCTGGGCAGAAAGGCAAGATGG - Intronic
979464237 4:121017920-121017942 GCATGGGGAGCAAAGGAAGAAGG - Intergenic
981220671 4:142229836-142229858 TTTTGGGGGGATAGGGAAGAAGG + Intronic
981425650 4:144600112-144600134 GTAAGGGGAAAAAGGGAATAAGG + Intergenic
981514017 4:145587731-145587753 GGATGGGGAGAAGGGGAAGTAGG + Intergenic
982182745 4:152765056-152765078 AAATGTGGAGAAAGGAAAGAGGG - Intronic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
982720523 4:158855048-158855070 CTTTGGGGAGAAAGAGGAGTAGG + Intronic
983096794 4:163572103-163572125 CCATGGTGAGAAAAGCAAGAAGG - Intronic
984580269 4:181502705-181502727 CCATAGGGAAAGAGGGAAGAAGG + Intergenic
985277396 4:188251216-188251238 CTATGGAGAGGAAGGGAAATGGG - Intergenic
985341575 4:188960293-188960315 GGATGGAAAGAAAGGGAAGATGG - Intergenic
985451118 4:190063237-190063259 CTATGCAGAGTAAGGGGAGATGG + Intergenic
985543975 5:500112-500134 CTGTGGGTTGAAAGGGCAGAGGG + Intronic
986008473 5:3688161-3688183 CTAGGGGGAGAGAGGGAGAAAGG - Intergenic
986034486 5:3924903-3924925 CTATGTGGACAATGGGAACACGG - Intergenic
986196105 5:5537439-5537461 CTGTGGGGAGAAGAGGGAGATGG + Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
986827548 5:11538242-11538264 CTAATGGGAGAGTGGGAAGAAGG + Intronic
987264173 5:16235188-16235210 CAAGGAGGAGAAAGGGGAGATGG - Intergenic
987368631 5:17172772-17172794 CTATGGGGAGAAACACAAGATGG + Intronic
987526471 5:19057050-19057072 ATATGGGAAGAAAGGAAGGAAGG + Intergenic
989185141 5:38616517-38616539 CTGTGGGGAAACTGGGAAGAAGG - Intergenic
989604124 5:43227629-43227651 CTGAGGGGAGAAAGGGAATTGGG + Intronic
989685772 5:44085288-44085310 CAATATGGAGAAAGGGAAGGTGG - Intergenic
989941278 5:50153503-50153525 CTATGGAGGGAAAGGAAATATGG - Intergenic
990287549 5:54314879-54314901 CACTGGAGAGAAAGGGAAAAAGG - Intergenic
990704798 5:58515814-58515836 CAATCGGGAGGAACGGAAGAGGG - Intergenic
990727710 5:58774954-58774976 CTCTGGGGAAAATGGGAAGCTGG + Intronic
991362095 5:65831507-65831529 CTTTGGGGAGAAAGGAAGGGTGG - Intronic
992109991 5:73483959-73483981 TTATGGTGAGAAATGGCAGATGG - Intergenic
992552144 5:77868984-77869006 CACTGGGGAGAAGGGGAAGCTGG + Intergenic
993135597 5:83957624-83957646 CCATGTTGAGAAAGGGAAGGAGG + Intronic
994060565 5:95472257-95472279 CTATAGGGAGGAAGGAATGAAGG - Intronic
994236135 5:97365272-97365294 CTATGGGAGGAAAGGGAAAGTGG + Intergenic
994675510 5:102816407-102816429 CTAAGGGGAGAAAAGAAATAGGG - Intronic
995420914 5:111965590-111965612 CTAGGGGAAGATAGGGGAGATGG - Intronic
996652200 5:125892629-125892651 CTATGGGAAGGAAAGGAAAAAGG + Intergenic
997582713 5:135027656-135027678 CTGTGGGTAGAAAGGGAACCGGG - Intergenic
997690295 5:135823512-135823534 GTATTGGAAGAAAGGAAAGAAGG - Intergenic
997741627 5:136260011-136260033 GTATGTGGAGGAAAGGAAGAAGG + Intronic
997809990 5:136957643-136957665 CTATGAGTAGCAAGGCAAGAGGG + Intergenic
997924260 5:138013898-138013920 CTATAGGGGATAAGGGAAGATGG - Intronic
998102411 5:139445352-139445374 CTATGAGGAGTAAGGGAAGTAGG + Intergenic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998318816 5:141210029-141210051 CTCTGGGGACAACGGAAAGATGG + Exonic
998368067 5:141644059-141644081 CTATGGGGGGGCAGGGAAAAGGG - Intronic
998471328 5:142386228-142386250 CCATGGGGATGAAGGGAAGGAGG + Intergenic
998608870 5:143666027-143666049 CTCAGGGGGGAAAGGGCAGATGG + Intergenic
999379011 5:151106931-151106953 GTGGGAGGAGAAAGGGAAGAGGG + Intronic
1000583066 5:163057352-163057374 CAATGGGGAGAAAGGGACCTTGG - Intergenic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1001626955 5:173144322-173144344 ACATGGAGAGGAAGGGAAGAGGG - Intergenic
1002017494 5:176336697-176336719 CTGTGTGGAGAAGAGGAAGAGGG - Intronic
1003094472 6:3131677-3131699 GGATGAGGAGAAAGGGGAGATGG - Intronic
1003116139 6:3284969-3284991 CAACGGGGAGAAAGAGAAAATGG + Intronic
1003217706 6:4129952-4129974 GTATAGGGAGAAAGGAGAGAAGG - Intronic
1003777947 6:9390357-9390379 CTATGGGGAGGATGGAAATACGG - Intergenic
1004285697 6:14318564-14318586 CTAAGGGGAGAGAAGGAACAGGG - Intergenic
1004341592 6:14812762-14812784 GTATGGGGAGAAAGGGCTGCTGG - Intergenic
1004785168 6:18960531-18960553 CTTTGGGGAGAGAGAGAAAAAGG - Intergenic
1005029428 6:21494904-21494926 CTAGAAGGAGAAGGGGAAGAGGG - Intergenic
1005048669 6:21665075-21665097 GGATGGGGAGAAAGGAAAGAGGG + Intergenic
1005390702 6:25330403-25330425 TTTTGGGGAGCCAGGGAAGAAGG + Intronic
1005795293 6:29354085-29354107 GTATGGGAAGAAAAAGAAGACGG + Intergenic
1005878224 6:30032030-30032052 TTCTGGGGACAAAGGGAAGGTGG + Intergenic
1006183973 6:32170020-32170042 CTATGGGGACAATGGGAACCTGG + Exonic
1006663800 6:35674024-35674046 AGAGAGGGAGAAAGGGAAGAAGG - Intronic
1006950083 6:37814676-37814698 CGACGGGGAGAAAGGGAGGAGGG - Intergenic
1007231017 6:40347857-40347879 CTGTGGGGAGGAGGGGAGGAGGG - Intergenic
1007724996 6:43910790-43910812 ATATGGGGAGTGATGGAAGAAGG + Intergenic
1007760599 6:44131360-44131382 CTGAGGGGAGGAGGGGAAGATGG - Intronic
1007831004 6:44638273-44638295 CTGTGGGGAGAAAGGGACAGGGG + Intergenic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1008338294 6:50333385-50333407 CTATGAGGAGGAAGGAAAAAAGG + Intergenic
1009035444 6:58112329-58112351 GTATGGGGAGGTAGGGAAGTGGG - Intergenic
1009211259 6:60865921-60865943 GTATGGGGAGGTAGGGAAGTGGG - Intergenic
1010552852 6:77244326-77244348 GGATGGAGAGAAATGGAAGAGGG + Intergenic
1011907146 6:92385982-92386004 CTAGTGGGAGAAATGGAGGATGG - Intergenic
1012306086 6:97659540-97659562 TTATAGGGAGAAAGGGGACAGGG + Intergenic
1013299882 6:108794996-108795018 CTTTGGGGACAAAAGGAGGAAGG + Intergenic
1014657744 6:124129252-124129274 GAAGGAGGAGAAAGGGAAGAAGG + Intronic
1015459536 6:133473397-133473419 CAATAGTGAGAAAGGGAAAATGG + Intronic
1015584671 6:134763350-134763372 CAATGGGTAGAAAGGGCAGATGG + Intergenic
1015771580 6:136773581-136773603 ATCTAGTGAGAAAGGGAAGATGG - Intronic
1015936499 6:138410081-138410103 CTAGGTGGAGAAATTGAAGAAGG - Intronic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016011664 6:139143463-139143485 CTATGATAAGAAAGAGAAGATGG - Intronic
1016231208 6:141806631-141806653 TTCTGGGGAGAACGGAAAGAGGG - Intergenic
1016675127 6:146756274-146756296 CTCTGGGGAGAATGGTAGGAAGG - Intronic
1017193242 6:151675486-151675508 CGGTGGGGAGGAGGGGAAGAAGG - Intronic
1017676094 6:156815460-156815482 GTGTGGGGAGAAAGGGAGAAAGG - Intronic
1018159878 6:161029070-161029092 CTATTGGGGGAAAGAGAGGAGGG - Intronic
1018423544 6:163660997-163661019 ATATTGAGAGAAAGAGAAGATGG - Intergenic
1019113746 6:169739484-169739506 CTGTGGGGAGAATGGGAAGTTGG + Intergenic
1019612166 7:1942075-1942097 CTAAGGGAAGAAAGGAAGGATGG - Intronic
1019624747 7:2010292-2010314 TCACGGGGAGGAAGGGAAGACGG + Intronic
1020011415 7:4807744-4807766 GGAGGGGGAGAAAGGGAGGAGGG - Intronic
1020026837 7:4905424-4905446 GAAGGGGAAGAAAGGGAAGAAGG + Intergenic
1020359292 7:7310158-7310180 CTAAAGAGAGAAAGGGAAAATGG - Intergenic
1021006247 7:15397599-15397621 AGGTGGGGAGAAAAGGAAGAAGG - Intronic
1021092548 7:16500799-16500821 CTATGGGGAGTAAGCGGTGATGG - Intronic
1021262670 7:18477834-18477856 CCATTGGCAGAAAGGGCAGATGG - Intronic
1021402790 7:20228835-20228857 CTTTGGGGATAATGGAAAGAGGG + Intergenic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021807053 7:24367849-24367871 CCATGGGGAGGAGGGAAAGAAGG + Intergenic
1021889336 7:25172317-25172339 GAAAGGGGAGTAAGGGAAGAGGG + Intronic
1022526890 7:31043785-31043807 CTATCTGGAGACAGGGAAGGTGG + Intergenic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022681713 7:32554605-32554627 CTAAGGGATGAAAGGAAAGATGG + Intronic
1022781009 7:33583218-33583240 AAATAGGGAGAAAGGGTAGAGGG - Intronic
1023039621 7:36160756-36160778 CTCTGGGGAGATGGGGAAGTGGG + Intronic
1023650177 7:42361216-42361238 CTATGGGGAGATATGTAAGCAGG - Intergenic
1023771725 7:43562803-43562825 CCAACTGGAGAAAGGGAAGAAGG + Exonic
1024192719 7:47029158-47029180 CTATGAGAAGAAAGGGGAAAAGG + Intergenic
1024485596 7:49914515-49914537 CTATGAGGAGAGAGGAATGAGGG - Exonic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025048692 7:55715474-55715496 CTAGGAGGAGAAAGAGAAGAGGG - Intergenic
1025255302 7:57380856-57380878 TTAGAGGGAGAAAGGGCAGAAGG - Intergenic
1025522087 7:61748550-61748572 CTATGGTGAAAAAGGAAATATGG - Intergenic
1026354782 7:69547883-69547905 GAAGGGGGAGAAAAGGAAGAGGG + Intergenic
1026669482 7:72375910-72375932 GGATGGGGAGAAGGGGAAAATGG - Intronic
1027246910 7:76373718-76373740 CAAGGTGGAGAAAGGAAAGAAGG + Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028174972 7:87645006-87645028 CTATGATGACAAAGGGAAAAAGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028480746 7:91301855-91301877 ATATGGGGAGGAAAAGAAGAAGG - Intergenic
1028637145 7:93002050-93002072 ACTTGGGGAGAAAGGGAAGAAGG - Intergenic
1029539910 7:101176585-101176607 CTATGGGGAAGAGGGGCAGAAGG - Intronic
1029919158 7:104244082-104244104 GAGAGGGGAGAAAGGGAAGAGGG - Intergenic
1030189254 7:106794371-106794393 CTATGGAGAGAAGGGGAGGGTGG + Intergenic
1030341504 7:108385896-108385918 CTATGGAGAGAGAGGGAGGGAGG + Intronic
1030485086 7:110155422-110155444 CTATGGGGGGAAGTGGAATATGG + Intergenic
1031923915 7:127620438-127620460 CTTTCCGGAGAAAGAGAAGAAGG - Intergenic
1032252251 7:130268178-130268200 CTACGTGGAGAAAGGCTAGAAGG + Intronic
1032408953 7:131678937-131678959 CAATGGGGAAGAAGGGGAGAGGG + Intergenic
1032646992 7:133835591-133835613 CTAAAGGGAGAAAGCGAAGCTGG - Intronic
1032977373 7:137241146-137241168 CTATCAGGAGAACGGCAAGAGGG + Intronic
1033233604 7:139620782-139620804 CTATATGGAGAAAGGGTAGTAGG - Intronic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1034113301 7:148559386-148559408 CTATGGGGAAGAAGGGAATAGGG - Intergenic
1034368200 7:150570150-150570172 CCATGGGCAGAAAGTGCAGAGGG - Intronic
1034875831 7:154724221-154724243 CTCTGGGGAGGAGGGGGAGATGG - Intronic
1035861622 8:3034921-3034943 CACTGTGGAGAAAGGGAAGGAGG + Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036034939 8:5008388-5008410 CTAATGGTAGAAATGGAAGATGG - Intergenic
1037578187 8:20227820-20227842 TTCTGGAGAGAAAGGGGAGATGG - Intergenic
1039096005 8:33886136-33886158 CTACAGGGAGGGAGGGAAGAGGG + Intergenic
1039446641 8:37638427-37638449 GTAGGGGGAGGAATGGAAGAAGG + Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040554335 8:48466032-48466054 CTAGGTTTAGAAAGGGAAGACGG + Intergenic
1040747277 8:50660476-50660498 CAGAGGGGAGAAAGGAAAGAAGG + Intronic
1041206239 8:55500659-55500681 TTATGGGGGCAAAGAGAAGACGG + Intronic
1041219439 8:55634026-55634048 CCATGGGGCCAAAGGGAGGATGG - Intergenic
1041577131 8:59411213-59411235 TTATGGGGAGCAAGGGAGGATGG + Intergenic
1041697360 8:60750033-60750055 CTATGGGGTGAAAGGACAGATGG - Intronic
1041779405 8:61561033-61561055 GTAAGGGAAGGAAGGGAAGAAGG + Intronic
1041880486 8:62744090-62744112 CCTTGGGGAGAAAGGAAAGCAGG + Intronic
1042020546 8:64369300-64369322 CTCTAGGGAGAAAGGGGAGGGGG + Intergenic
1042180924 8:66087280-66087302 CTATTGTGAGAATGGGATGAGGG + Intronic
1042654495 8:71081347-71081369 GAATGGGGATAAAGGGAAGGAGG - Intergenic
1042935424 8:74053420-74053442 CTACAGGGAGTAGGGGAAGATGG - Intergenic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1042960337 8:74296718-74296740 TTAAGTTGAGAAAGGGAAGAGGG - Intronic
1043211308 8:77521977-77521999 CTATCGTGAGAACAGGAAGAGGG + Intergenic
1044212242 8:89563293-89563315 ATCTAGGAAGAAAGGGAAGATGG - Intergenic
1044560514 8:93607398-93607420 CAATGGGAAGAAATGGAAAAGGG + Intergenic
1045139780 8:99267762-99267784 TTCTGGGGAGAAAGTGAAGCTGG + Intronic
1045344121 8:101279480-101279502 CAATGGGGAGCAGGGGAAGAGGG - Intergenic
1045351731 8:101347250-101347272 CTGAGAGGAGAAAGGGAGGAAGG + Intergenic
1046117492 8:109801525-109801547 AGATGGGGAGAAAGAGGAGAGGG - Intergenic
1046401337 8:113708102-113708124 ATAAGAGGAGAAAAGGAAGAGGG - Intergenic
1047037920 8:120959993-120960015 CTATGTTTAGAAAGGGTAGAAGG + Intergenic
1047176015 8:122541059-122541081 CAATGGGCAGAAAGGGGAAAGGG + Intergenic
1047415798 8:124663546-124663568 GTGTGGGGAGAAAGGGGAGGTGG - Intronic
1048144913 8:131832017-131832039 TGAAGGGGAGAAAGGGAGGAAGG + Intergenic
1049133129 8:140867238-140867260 CAATGGGGACCAAAGGAAGAAGG + Intronic
1049764955 8:144350878-144350900 CCCTGGGGAGAAAGGAAAGGGGG - Intergenic
1050091108 9:2016829-2016851 CAAACGGGAGGAAGGGAAGACGG - Intronic
1050567259 9:6899227-6899249 ATGTGGGGAGAAGGGGAATATGG - Intronic
1051276001 9:15399296-15399318 CTATAGAAAGAAAGGGAATAAGG - Intergenic
1051302743 9:15670636-15670658 CTATGGAAAGGATGGGAAGAGGG - Intronic
1051357632 9:16254374-16254396 ACCTGGGGAGAAAGGGAAGCTGG - Intronic
1051824564 9:21205669-21205691 ATATGGGGAGCAAGTGGAGAGGG - Intergenic
1052356378 9:27509267-27509289 CTATAGGAAGGAAGGGAGGAAGG + Intronic
1052393847 9:27913738-27913760 CTGTCGGGAGGAAGGGAGGAAGG - Intergenic
1052494882 9:29213289-29213311 TTAAGGGGAGAAAGGGGGGAGGG - Intergenic
1053030318 9:34770713-34770735 TTAGGTGGAGAAAGGGAAGAGGG + Intergenic
1053055998 9:34993431-34993453 GTATGGGGAGGAAGGTAAGAGGG + Exonic
1053466840 9:38314748-38314770 ATAAAGGGAGAAAGGAAAGAAGG - Intergenic
1053533707 9:38905619-38905641 CTATGGGGAGAGGGTGGAGAAGG + Intergenic
1054205933 9:62130048-62130070 CTATGGGGAGAGGGTGGAGAAGG + Intergenic
1054632427 9:67458322-67458344 CTATGGGGAGAGGGTGGAGAAGG - Intergenic
1055790045 9:79913968-79913990 CTAAGGGGAGAATTGAAAGAGGG + Intergenic
1055869984 9:80865297-80865319 CTATGGGAAGGAAGGGAGGGAGG - Intergenic
1056665250 9:88576577-88576599 CTGAGGGGAGAAGGGGAAGAGGG + Intronic
1057503984 9:95617829-95617851 CCTTGGGGAGAGACGGAAGAGGG + Intergenic
1057919606 9:99086130-99086152 CTAAGGGAAGAAGGGGAGGATGG + Intergenic
1058337006 9:103842403-103842425 CTATGGGGAGAAAAGGAAACTGG - Intergenic
1058415059 9:104778787-104778809 CTATGGGAAGAAAGGACAGTAGG - Intergenic
1058866705 9:109167384-109167406 AGATGGGGAGAATGGAAAGAAGG - Intergenic
1058913150 9:109539727-109539749 ACCTGGGGGGAAAGGGAAGACGG - Intergenic
1059021757 9:110583255-110583277 ATATGGGGAAAGATGGAAGAGGG + Intergenic
1059221109 9:112619552-112619574 TTTTGGGGGGAAAGGGTAGAAGG + Intronic
1059343671 9:113613822-113613844 CCATGGGGAGAGAAGGTAGATGG - Intergenic
1059630095 9:116112524-116112546 TAATGGTGAGAATGGGAAGATGG + Intergenic
1060386237 9:123231784-123231806 ATATGGGGAGTCAGGGAAGGTGG - Intronic
1060982331 9:127800565-127800587 CCCTGGGGAGACAGGGAAGGAGG + Intronic
1060987329 9:127827187-127827209 CTATGGGAAGACAGGGAGAAAGG + Intronic
1061305489 9:129730353-129730375 CTACAGGGAGACAGGGAGGAGGG - Intergenic
1061788347 9:133044489-133044511 CCATGGGGAGCAAAGGAAGTAGG - Intronic
1062255751 9:135619919-135619941 GTAGGGGGAGAAGGGGGAGATGG - Intergenic
1062255779 9:135619989-135620011 GTAGGGGGAGTAGGGGAAGAAGG - Intergenic
1062445162 9:136590592-136590614 CTATGGGGAGGCAGAGATGATGG - Intergenic
1203408017 Un_KI270538v1:65896-65918 CTATGGGGAGTGGGTGAAGATGG + Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1185683742 X:1910110-1910132 CTAGGAGGAGAGAGAGAAGAGGG - Intergenic
1186051194 X:5597452-5597474 CTATGGGGAGCATGTGAAAACGG + Intergenic
1186306465 X:8264954-8264976 ATATGGGCAGAAAGGAGAGAAGG - Intergenic
1186334302 X:8570195-8570217 CTATGGCCAGACAGGTAAGATGG + Intronic
1186967779 X:14806514-14806536 CTAAGGGGTGACAGGGAAGCAGG + Intergenic
1187410644 X:19048025-19048047 CTTTGGCCAGAACGGGAAGAAGG + Intronic
1187618852 X:21028109-21028131 TTAAGAGGAGAAAGGGAAGGTGG - Intergenic
1188590095 X:31823073-31823095 CAATGGGGGGAAAGGGTACAGGG + Intronic
1189446539 X:41085834-41085856 CTGAGGGGAGAAGGGGAAGAGGG + Exonic
1189724443 X:43954435-43954457 AAATGGGGAGAGAGGGAGGAGGG - Intronic
1189749773 X:44208487-44208509 AAAGGGGGAGAAAGGGAGGAAGG + Intronic
1189904058 X:45739499-45739521 GTGTGGGGAGTAAGGGAAAATGG + Intergenic
1190497518 X:51040811-51040833 CCAGAGGGAGAAAGGGCAGAGGG + Intergenic
1190942649 X:55057141-55057163 CTGTGGTGGGAAAGGGGAGAGGG + Intergenic
1191796402 X:65026189-65026211 CTTTGGGGAGGAAGGAATGAAGG + Intronic
1191955278 X:66637321-66637343 CTAGGGGCAGAGAGGGAACAAGG - Intronic
1192297843 X:69869103-69869125 CTATGGTGAGAAAGGCCAAATGG - Intronic
1192547118 X:72023358-72023380 CCTTGGGGAGAAATGGGAGAAGG + Intergenic
1193047581 X:77068931-77068953 CTAAGGGAACAAAGGAAAGAGGG + Intergenic
1193223287 X:78952525-78952547 CTATGGAGAGAAGGGCAGGAAGG + Intronic
1193527515 X:82611903-82611925 CTCTGGGGAGGAATGGAAGGTGG + Intergenic
1193674123 X:84426648-84426670 ATATGGGGGAAATGGGAAGATGG + Intronic
1195530872 X:105956124-105956146 CTATGGCGACAAAGGGGAAAAGG + Exonic
1195578799 X:106478884-106478906 ATATGGGGTGGAGGGGAAGAAGG + Intergenic
1195989676 X:110670271-110670293 ATATAAGGAGAAAGGGAACATGG + Intergenic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic
1196316295 X:114228626-114228648 CTATGGGGATAATGGGAATTTGG + Intergenic
1196325699 X:114399743-114399765 ATATAGGGAGAAAGAGAAGTAGG + Intergenic
1196785328 X:119417044-119417066 CTATGGGGAGGAAGCTAAGCTGG - Intronic
1196834645 X:119802937-119802959 TTATGGGGAGAGAGTGAAGTAGG - Intergenic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1197520050 X:127486291-127486313 CTATCAAGAGAAAGGAAAGATGG + Intergenic
1197993719 X:132348601-132348623 CTAGAGGGAGAAAGGAAGGATGG + Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198482802 X:137056295-137056317 ATATGGGGAAAAAGGGAAAGGGG + Intergenic
1199137506 X:144270503-144270525 TTACGGGGAGAGTGGGAAGAGGG + Intergenic
1199142898 X:144333326-144333348 CTATAGGGAGAAAAGGAACCCGG + Intergenic
1199223533 X:145344340-145344362 CAATGGGGAGAAAGGCATGATGG - Intergenic
1199253527 X:145692670-145692692 CTGTGGGGTGAAAAAGAAGAAGG - Intergenic
1199666491 X:150100278-150100300 CCATGAGGAGAAAGTGAGGAGGG + Intergenic
1199711460 X:150472661-150472683 TAATGGGGAGAGAGGGAGGAGGG + Intronic
1199834881 X:151579678-151579700 TTATTGGGAGAAAGTGAAGATGG + Intronic
1199841932 X:151658043-151658065 GTAGGGGGAGAGGGGGAAGAGGG - Intronic
1200118415 X:153779256-153779278 CAATGGGGAGAGGGGGAAGGAGG - Exonic
1200162361 X:154016094-154016116 CTACCTGGAGAGAGGGAAGAGGG + Exonic