ID: 929954463

View in Genome Browser
Species Human (GRCh38)
Location 2:46444852-46444874
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929954457_929954463 10 Left 929954457 2:46444819-46444841 CCATCATGATGGCTCATGACTGT 0: 1
1: 1
2: 31
3: 449
4: 1799
Right 929954463 2:46444852-46444874 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929954463 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr