ID: 929954872

View in Genome Browser
Species Human (GRCh38)
Location 2:46449374-46449396
Sequence CAGGCTGTGGATTAGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 869
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 816}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929954872_929954879 5 Left 929954872 2:46449374-46449396 CCCCCTTCCTAATCCACAGCCTG 0: 1
1: 0
2: 2
3: 50
4: 816
Right 929954879 2:46449402-46449424 TCTCTCCAGACAGTAAAGTATGG 0: 1
1: 1
2: 1
3: 15
4: 180
929954872_929954881 15 Left 929954872 2:46449374-46449396 CCCCCTTCCTAATCCACAGCCTG 0: 1
1: 0
2: 2
3: 50
4: 816
Right 929954881 2:46449412-46449434 CAGTAAAGTATGGAAACTGTAGG 0: 1
1: 0
2: 1
3: 21
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929954872 Original CRISPR CAGGCTGTGGATTAGGAAGG GGG (reversed) Intronic
900250243 1:1665092-1665114 CAGGGTGTGGAAGAGGTAGGGGG + Exonic
900611505 1:3546493-3546515 CAGCCTGTGGGCCAGGAAGGAGG + Intronic
900645394 1:3706600-3706622 CCGCCTCTGGATTTGGAAGGAGG + Intronic
900695224 1:4005533-4005555 CAGGCTGGGCATGAGGGAGGGGG + Intergenic
900840898 1:5047682-5047704 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
900847585 1:5115957-5115979 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
901767401 1:11511957-11511979 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
902137225 1:14319634-14319656 CAGGCTGTCGAGAAGGGAGGAGG - Intergenic
902156050 1:14487423-14487445 GAGGCTGGGGATGAGAAAGGAGG - Intergenic
902570581 1:17344654-17344676 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
902731961 1:18375599-18375621 GAGGCTGTGCACAAGGAAGGAGG + Intronic
903201454 1:21743163-21743185 CAGGCTGTGGGTAAGGAAGAGGG + Intronic
903609086 1:24596979-24597001 CAGGCTGTGGTTCTGGCAGGTGG + Intronic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
903947396 1:26972325-26972347 CAGGTTGGGGAATAGGAAGGAGG + Intergenic
904292983 1:29499536-29499558 CTGGATGTGGATTTGGTAGGTGG + Intergenic
904398123 1:30236651-30236673 CAGGATGGGGAATTGGAAGGGGG + Intergenic
904422358 1:30402456-30402478 CAGCCCATGGATTTGGAAGGAGG + Intergenic
904996384 1:34634833-34634855 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
905271075 1:36787824-36787846 CACGCTGTGGCAGAGGAAGGAGG + Intergenic
905474727 1:38217927-38217949 CAGGCTGTTGATTCTGCAGGAGG + Intergenic
905909843 1:41646240-41646262 CAGCCTATGGAGAAGGAAGGAGG + Intronic
906154289 1:43605084-43605106 CCGGCTGTGGAGCAGGAATGTGG + Intronic
907091846 1:51732206-51732228 CACGCTGTTGATTAAGAAAGGGG + Intronic
907503471 1:54900744-54900766 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
907521365 1:55025430-55025452 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
907742034 1:57176102-57176124 GAGGCTGTATATTAGGATGGGGG + Intronic
908461606 1:64352843-64352865 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
908591848 1:65644753-65644775 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
908624795 1:66028249-66028271 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
908835378 1:68224405-68224427 GAGGATGTGGAATAGGAAGATGG - Intronic
908852515 1:68389099-68389121 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
909222564 1:72982717-72982739 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
909223553 1:72990691-72990713 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
909550926 1:76897649-76897671 GAGGCTTTGGATTGGGAAGAAGG + Intronic
909717696 1:78728957-78728979 GAGGCAGTGAATTAGAAAGGAGG - Intergenic
909776582 1:79491443-79491465 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
909788167 1:79641606-79641628 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
909792888 1:79699239-79699261 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
909978345 1:82070392-82070414 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
911210006 1:95129053-95129075 CAGACATTAGATTAGGAAGGAGG - Intronic
911501916 1:98697201-98697223 CAGGCCTAGGATCAGGAAGGTGG + Intronic
911570494 1:99512454-99512476 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
912263590 1:108132466-108132488 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
912279469 1:108297866-108297888 CAGGCTGTGGCTTCAGAAGGTGG - Intergenic
912280904 1:108312394-108312416 GAGTCAGTGGATTAGGGAGGGGG + Intergenic
912288757 1:108396491-108396513 CAGGCTGTGGCTTCAGAAGGTGG + Intronic
912451301 1:109769238-109769260 CATGCTATGGATTAGAATGGGGG + Intronic
912581124 1:110721893-110721915 AAGGATGTGAATTAAGAAGGTGG + Intergenic
912881997 1:113424416-113424438 CTGGATGTGGGGTAGGAAGGAGG - Intronic
912907094 1:113718696-113718718 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
913489214 1:119363313-119363335 CAGGCTGTGGCTTCAGAAGATGG - Intergenic
913530495 1:119730858-119730880 CAGGCTGTTGATGAGAATGGTGG - Intronic
913599207 1:120406723-120406745 CAGGCTGTGTTTTGGGAGGGAGG - Intergenic
913688028 1:121252641-121252663 CAGGGTGTGGATTGGGGTGGTGG + Intronic
914039885 1:144040281-144040303 CAGGGTGTGGATTGGGGTGGTGG + Intergenic
914088170 1:144472897-144472919 CAGGCTGTGTTTTGGGAGGGAGG + Intergenic
914149574 1:145027639-145027661 CAGGGTGTGGATTGGGGTGGTGG - Intronic
914310441 1:146461313-146461335 CAGGCTGTGTTTTGGGAGGGAGG - Intergenic
914314740 1:146499441-146499463 CAGGCTGTGTTTTGGGAGGGAGG + Intergenic
914499611 1:148233947-148233969 CAGGCTGTGTTTTGGGAGGGAGG - Intergenic
915107222 1:153542089-153542111 GAGGTTGTGGATTGGGGAGGGGG + Intergenic
916259083 1:162822680-162822702 CACGCTGATGATGAGGAAGGTGG + Intergenic
916316876 1:163458816-163458838 CAGGCTGTGCATATGGCAGGTGG + Intergenic
917396634 1:174601103-174601125 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
917603009 1:176596266-176596288 GAGGCTGTGTATCAGGTAGGGGG - Intronic
917846119 1:179021937-179021959 CGGGCTGTGGATTCTGAAAGTGG - Intergenic
918119868 1:181529186-181529208 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
918144749 1:181745651-181745673 GTGCATGTGGATTAGGAAGGTGG - Intronic
918347222 1:183616482-183616504 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
918567565 1:185951175-185951197 GAGGCTTTGGATTGGGAAGAAGG + Intronic
918734183 1:188037865-188037887 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
919092368 1:192991190-192991212 CAGGTTGTGGTTAAAGAAGGCGG + Intergenic
920402313 1:205683621-205683643 CTGGCTGTGGACTTGGAAGGAGG + Intergenic
920475350 1:206271140-206271162 CAGGGTGTGGATTGGGGTGGTGG + Intronic
920570905 1:207016555-207016577 CAGAGTGTGGATTGGGAAGGAGG + Intronic
920755317 1:208725115-208725137 GAGGCTGTGGGCTAGGAATGGGG - Intergenic
921212523 1:212912335-212912357 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
921459671 1:215412822-215412844 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
921509359 1:216010831-216010853 GAGGCTTTGGATTGGGAAGAGGG - Intronic
921520242 1:216148378-216148400 GAGGCTTTGGATTGGGAAGAAGG - Intronic
921678257 1:218001554-218001576 CAGGCTCTGGAGTAGAAAGGAGG - Intergenic
921732870 1:218596668-218596690 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
922153963 1:223027286-223027308 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922477765 1:225918626-225918648 CGGGCTGTGGAGTAGAAAGCAGG + Intronic
922791872 1:228315369-228315391 AGGGCAGTGGATTAGGGAGGAGG + Intronic
922906497 1:229177254-229177276 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
922986302 1:229868515-229868537 TAGGCTGAGGAGGAGGAAGGAGG - Intergenic
923017258 1:230136530-230136552 CAGGCTGTGGCTCTGGATGGGGG - Intronic
923214095 1:231833086-231833108 GAGGCTTTGGATTGGGAAGAAGG + Intronic
923244857 1:232121013-232121035 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
923408523 1:233686311-233686333 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
923460526 1:234205986-234206008 CACGCTGTGGATGAGGAGGATGG + Intronic
924160470 1:241226514-241226536 CAGGCAGTGTAGTAGGAATGAGG + Intronic
924180754 1:241436801-241436823 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
924941522 1:248815600-248815622 CAGGCTTTGGATTAGGTGGTTGG - Intronic
1063363262 10:5473941-5473963 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1063368282 10:5504658-5504680 CAGGGTGAGGACTCGGAAGGTGG + Intergenic
1063509491 10:6632475-6632497 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1063527576 10:6799974-6799996 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1063603563 10:7503756-7503778 CAGGCTGTGGAAGAGTAAGAAGG - Intergenic
1064425016 10:15222842-15222864 CAGCCTGTGGCGTGGGAAGGGGG - Intronic
1064886897 10:20122042-20122064 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1065226058 10:23545070-23545092 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1065438931 10:25729273-25729295 TGGGCTGTGGATGAGGAAAGGGG + Intergenic
1066081072 10:31930447-31930469 TAGGCTGTGAAATAGGAAGTGGG - Intergenic
1066599870 10:37093247-37093269 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1068058244 10:52036645-52036667 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1068179553 10:53501912-53501934 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1068231078 10:54169586-54169608 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1068552953 10:58426551-58426573 CAGGCTGTGGCTTCAGAAGGTGG - Intergenic
1068592237 10:58863895-58863917 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1069632101 10:69903198-69903220 CAGGCAGTGGGTTCTGAAGGAGG + Intronic
1069639048 10:69943386-69943408 CAGGCTGTGAACTGGGAACGTGG + Intronic
1069803879 10:71105106-71105128 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1070475033 10:76821403-76821425 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1070739685 10:78894548-78894570 CAGGCAGAGGATGTGGAAGGGGG + Intergenic
1070786459 10:79165057-79165079 CAGGTTGTGGGTTGGGTAGGGGG + Intronic
1071251377 10:83823119-83823141 GAGGCTGGGGTTTAAGAAGGTGG + Intergenic
1072448878 10:95522960-95522982 CTGCCTGTGGATAAGGCAGGTGG + Intronic
1072574210 10:96685483-96685505 CAAGCCGTGGGTGAGGAAGGTGG + Intronic
1072580369 10:96735047-96735069 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1072626002 10:97112369-97112391 CAGGCTGTGGATGCGGAAAGGGG - Intronic
1072865889 10:99061139-99061161 AAGGCTGTGGACTAGGGTGGTGG + Intronic
1073061275 10:100735295-100735317 CAGGCTGTGGGTCTGGAGGGGGG + Intergenic
1073220517 10:101868577-101868599 TAGGCTGAGGAGGAGGAAGGAGG - Intronic
1074428196 10:113370630-113370652 CAGCCAGAGGATTAGGAAGTAGG - Intergenic
1074740883 10:116483481-116483503 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1075248805 10:120847673-120847695 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1075335985 10:121609173-121609195 CAGCCTGTGGATCAACAAGGCGG + Intergenic
1075394358 10:122115867-122115889 CAGGAGGTGGTTTAGGAAGCTGG + Intronic
1075439402 10:122467460-122467482 CAGGCTTTAAATTAGGAATGAGG - Intronic
1075543680 10:123337392-123337414 CAGGCTGTGGCTTTGGAGGGTGG - Intergenic
1075807627 10:125201555-125201577 CAGGCTGGGGGATAGGATGGAGG - Intergenic
1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG + Intergenic
1076444949 10:130507869-130507891 CAGGCAGTGGATCAGGACAGAGG - Intergenic
1077850693 11:6072714-6072736 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1078046028 11:7915041-7915063 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1079447566 11:20570622-20570644 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1079450929 11:20599241-20599263 CGGGCTGTAGAGGAGGAAGGAGG - Intergenic
1079672466 11:23186817-23186839 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1079847588 11:25490100-25490122 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1080027809 11:27631961-27631983 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1080245769 11:30177694-30177716 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1080438224 11:32266053-32266075 CAGATTGTGGATTCAGAAGGAGG + Intergenic
1080959584 11:37142745-37142767 CAGGCTGTAGAGTAGGGAGAGGG - Intergenic
1081077692 11:38696618-38696640 CAGGCTGTGGCTTCAGAAGGTGG - Intergenic
1083188027 11:61029062-61029084 CAGGCAGTGAAACAGGAAGGAGG + Intergenic
1083315129 11:61810234-61810256 CAGGCTGGGGATCAGCAGGGTGG + Intronic
1084047266 11:66576447-66576469 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1084355656 11:68636537-68636559 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1085194343 11:74659188-74659210 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
1085303951 11:75474650-75474672 CAGGCTGGGGGGCAGGAAGGAGG + Intronic
1085396606 11:76209889-76209911 CAGGCTGGGGGCTAGGGAGGAGG - Intronic
1085514446 11:77104216-77104238 CAGGGAGTGGATTAGTAAAGGGG + Intronic
1086136162 11:83445779-83445801 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1086231712 11:84578000-84578022 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
1086937626 11:92762396-92762418 CAGGCTGTGGCCTGGGAATGGGG - Intronic
1087099739 11:94352479-94352501 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1087127914 11:94644437-94644459 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1087197014 11:95312347-95312369 GAGGCTTTGGATTAGGAAGAAGG - Intergenic
1087314782 11:96590758-96590780 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1087550222 11:99639164-99639186 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
1087839436 11:102906960-102906982 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1088377663 11:109159846-109159868 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1088616207 11:111631443-111631465 CAGGTTGAGGATTAGAATGGTGG + Intronic
1089080946 11:115775872-115775894 CAGGTTGTGGGGTAGGAAGAAGG - Intergenic
1089349188 11:117812106-117812128 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1089470958 11:118719888-118719910 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1089987774 11:122829946-122829968 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1090075820 11:123579453-123579475 CTGGCTGTGGACAGGGAAGGAGG + Intronic
1090850490 11:130567242-130567264 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1090871858 11:130756398-130756420 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1090940798 11:131386515-131386537 CTGTCTGTGGTGTAGGAAGGAGG + Intronic
1091065688 11:132509620-132509642 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
1091183780 11:133629620-133629642 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1091596436 12:1882058-1882080 CAGGCTGTGGAAGGGGAAGGGGG - Intronic
1091862404 12:3797677-3797699 CAGGCCCTGGATTATAAAGGTGG - Intronic
1092030942 12:5284636-5284658 GAGGGTGGGGATGAGGAAGGGGG - Intergenic
1092485872 12:8901643-8901665 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1092489136 12:8929381-8929403 CAGGCTGTGGATAAGGAGGTAGG - Intronic
1092626647 12:10335806-10335828 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1092723621 12:11465061-11465083 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1092739224 12:11612587-11612609 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1092924753 12:13262851-13262873 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1093007441 12:14065421-14065443 CAGCCTTTGGATAAGGAAGTTGG + Intergenic
1093071060 12:14707751-14707773 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1093267907 12:17024585-17024607 CAGGCTTTGGATTGGGAAGAAGG + Intergenic
1093358533 12:18197784-18197806 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1093486442 12:19658049-19658071 CAGGTTGTGGCCCAGGAAGGTGG + Intronic
1093584416 12:20819889-20819911 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1093833174 12:23791581-23791603 CAGGTTGTGGATAAGGAACTTGG - Intronic
1094400784 12:30058811-30058833 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1094421981 12:30280468-30280490 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1094825847 12:34268467-34268489 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1095623203 12:44282982-44283004 CAGGCTGTGGCTTCAGAGGGCGG + Intronic
1095637752 12:44452626-44452648 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096670529 12:53195839-53195861 CTTGCTATGGAATAGGAAGGAGG + Intronic
1096781987 12:53996901-53996923 ACGGCTGTGGATCAGGAAGCAGG - Intronic
1097054983 12:56243781-56243803 CTGGCTGTGGATGAAGAAGGTGG - Exonic
1097376354 12:58848007-58848029 CATGCTGTGAAACAGGAAGGGGG + Intergenic
1097416950 12:59326098-59326120 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1097570541 12:61326196-61326218 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1097928821 12:65161778-65161800 CAGGCTGTGTACCAGAAAGGAGG + Intergenic
1098173533 12:67769526-67769548 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1098826063 12:75298439-75298461 CATGTTGTGGAATGGGAAGGGGG + Intronic
1099291999 12:80785961-80785983 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1100940453 12:99718329-99718351 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1101168278 12:102061814-102061836 CAGGGTGGGGACTCGGAAGGTGG + Intronic
1101278293 12:103225557-103225579 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1101667328 12:106831182-106831204 CAGCCTGTGGAGAAAGAAGGTGG - Intronic
1102148704 12:110673687-110673709 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
1102248897 12:111372406-111372428 CAGGCTGTGGTTTCAGAGGGTGG - Intergenic
1102523171 12:113492098-113492120 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1102758750 12:115366958-115366980 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1102770714 12:115473537-115473559 CACGCTCTGGATTAGCAAGGGGG + Intergenic
1102962426 12:117101250-117101272 CAGGCAGTGGAAGAGGAAGCTGG - Intergenic
1103434241 12:120912529-120912551 GAGGCTGAGGCTGAGGAAGGTGG - Intergenic
1103588420 12:121973194-121973216 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
1104017911 12:124972672-124972694 CAGGCCGTGGAGCAGGCAGGCGG + Intronic
1104283229 12:127397465-127397487 CAGGCTATGGCTTAGGAAAAGGG + Intergenic
1104685325 12:130781015-130781037 CAGGTTGTGGCTCAGGGAGGCGG + Intergenic
1104854873 12:131896805-131896827 CAGGCTGTGGTCCAGGCAGGAGG - Intronic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1106156559 13:27163280-27163302 AAGGCTGGAGAGTAGGAAGGGGG - Intronic
1106262315 13:28078413-28078435 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
1106943543 13:34801468-34801490 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1107075688 13:36319275-36319297 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1107220196 13:37972054-37972076 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1107471464 13:40695264-40695286 CAGGATGTGGATTAGGAGAGAGG + Intergenic
1107683037 13:42870296-42870318 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1107893329 13:44933344-44933366 AAGTCTGTTGACTAGGAAGGTGG - Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108155904 13:47584390-47584412 CAGGCTGTGGCTTCAGAAAGTGG - Intergenic
1108202796 13:48059226-48059248 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1108418849 13:50228440-50228462 AGGTCTGTGGATCAGGAAGGGGG - Intronic
1108803768 13:54130567-54130589 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1108814234 13:54269691-54269713 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1108913315 13:55581122-55581144 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1108919443 13:55657852-55657874 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1108947539 13:56043139-56043161 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1108947721 13:56044459-56044481 CAGGCTGAGGAACAGGAAAGAGG - Intergenic
1108952843 13:56115295-56115317 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1109343674 13:61091194-61091216 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1109353014 13:61207634-61207656 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1109709558 13:66144212-66144234 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1109716639 13:66229262-66229284 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1110275203 13:73634897-73634919 GAGGCTGTGGCTGAGGAGGGAGG - Intergenic
1110765582 13:79276963-79276985 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1111125935 13:83911161-83911183 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1111458735 13:88515706-88515728 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1111630543 13:90842273-90842295 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1111631595 13:90851468-90851490 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1112236931 13:97645146-97645168 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1112315460 13:98358265-98358287 CAGGCTCTGGTGTAGGAAGGAGG - Intronic
1113059325 13:106304666-106304688 CAGACTGTGGAGGAGGGAGGTGG + Intergenic
1113324435 13:109268173-109268195 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1114064733 14:19051560-19051582 AAGGCTGTGTATGAGGATGGTGG + Intergenic
1114097528 14:19348442-19348464 AAGGCTGTGTATGAGGATGGTGG - Intergenic
1115115885 14:29880314-29880336 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
1115632050 14:35255008-35255030 CAGACTGTGGGTGAGGAGGGTGG - Intronic
1115746588 14:36443962-36443984 CGGGCTCAGGCTTAGGAAGGAGG - Intergenic
1115793453 14:36905909-36905931 CAGGGTGTGGCTTAAGAAAGAGG + Intronic
1115904910 14:38193626-38193648 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1116179786 14:41518778-41518800 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1116256168 14:42559349-42559371 CAGGCTGTGGATTCAGAGGGTGG - Intergenic
1116490479 14:45498262-45498284 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1116702300 14:48258260-48258282 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1116953019 14:50896006-50896028 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1117399584 14:55346509-55346531 CAGGCTGTGGGATATGAAGTTGG + Intronic
1117801287 14:59446913-59446935 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1117957814 14:61136300-61136322 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1118342989 14:64911623-64911645 CAGGGGGAGGATTAGGAAAGAGG - Intergenic
1118983719 14:70735566-70735588 CAGGCTGTGGGTTTGGCAGCAGG - Intronic
1119317305 14:73706329-73706351 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1120091142 14:80334395-80334417 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
1120166641 14:81208277-81208299 CAGACTGTGGCTTCAGAAGGTGG + Intronic
1120251297 14:82063964-82063986 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1120367003 14:83583501-83583523 CAGGCTGTGGCTTCAGAAGGTGG + Intergenic
1120437957 14:84503094-84503116 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1121523766 14:94604196-94604218 CAGGAAGGGGAGTAGGAAGGAGG - Intronic
1121609781 14:95269874-95269896 CAGCCTGTGGATTGGGGTGGGGG - Intronic
1121654346 14:95584289-95584311 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1121703750 14:95975783-95975805 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1122041103 14:98988030-98988052 GAGGCTTTGGATTAGGAAGAAGG - Intergenic
1122518275 14:102324107-102324129 CAGGTTGTGCAGTAGGAAGCTGG + Intronic
1125045877 15:35241605-35241627 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1125131411 15:36288518-36288540 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1127285228 15:57526868-57526890 CACGCTGGGCATTGGGAAGGGGG + Intronic
1127975050 15:63990934-63990956 CAGGCAGAGGAGTAGGGAGGGGG - Intronic
1127993549 15:64137916-64137938 CAGGATGTGGTTTAGGAACTGGG + Intronic
1128045091 15:64610731-64610753 TCTGCTGTGGCTTAGGAAGGAGG - Intronic
1128233640 15:66052476-66052498 CAGGATGTGGATCAGGATTGAGG - Intronic
1128688845 15:69707828-69707850 CAGGCTGTGGCTTTGGAGGGTGG - Intergenic
1128912719 15:71530876-71530898 TGTGCTGTGGATGAGGAAGGGGG + Intronic
1129469442 15:75742613-75742635 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1130011050 15:80153083-80153105 CAGGTTGTGGATGGGGAAGTCGG - Exonic
1130775978 15:86983695-86983717 GAGGCTGGAGATTAGGAAAGGGG - Intronic
1130855211 15:87834100-87834122 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1130945842 15:88550378-88550400 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1131447848 15:92514341-92514363 TAGGCTTTGGATTGGGAAGAAGG - Intergenic
1131499908 15:92952317-92952339 CAGGCTGGGGAGGAGGGAGGGGG + Intronic
1131684804 15:94757303-94757325 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1131882407 15:96874701-96874723 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1131906835 15:97152087-97152109 CAGGCTGGGAAAAAGGAAGGAGG - Intergenic
1131921708 15:97335109-97335131 GAGACTGTGGATTAGTAAGAGGG + Intergenic
1132018091 15:98336970-98336992 CAGGCTGTGGACTGGGAGGCAGG - Intergenic
1132263119 15:100443122-100443144 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1132340520 15:101075371-101075393 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1132783487 16:1641762-1641784 CAGGCTGTGGAGTAGGGTGGCGG - Intronic
1133489646 16:6255131-6255153 AAGTCTGTGGATTAGAAGGGTGG + Intronic
1133765627 16:8835901-8835923 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1134196999 16:12166974-12166996 CAGCCAGTGGTTAAGGAAGGTGG + Intronic
1134342073 16:13355445-13355467 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1134598002 16:15511225-15511247 CAGGCTGTGGCTTGGGGAGAGGG - Intronic
1135005526 16:18818777-18818799 GAGGCTGTGGATTGGGCAGGGGG - Intronic
1136407242 16:30055134-30055156 CAGGATGTGGAATAGGCAGCAGG - Intronic
1138024771 16:53513659-53513681 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1138083744 16:54115535-54115557 CAGGCTGTGGGGAAGGGAGGTGG + Exonic
1138805056 16:60081663-60081685 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1139225811 16:65232709-65232731 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1139942949 16:70619341-70619363 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1139943623 16:70623672-70623694 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1140854362 16:78964888-78964910 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
1141841389 16:86576436-86576458 GGGGCTGTGGGATAGGAAGGTGG + Intronic
1142643938 17:1300228-1300250 CAGGCTCTGGCTCTGGAAGGAGG + Exonic
1142840233 17:2622954-2622976 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
1143015419 17:3888890-3888912 CAGGCTGTGGACCAGGGTGGTGG + Intronic
1144104771 17:11974721-11974743 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1144793961 17:17878513-17878535 ATGGCTTTGGAGTAGGAAGGGGG + Intronic
1146058313 17:29591943-29591965 CAGGGTGTGGAGGAGGAAGGAGG + Intronic
1146175478 17:30663654-30663676 CAGACTGTGGATAAGGATGGAGG - Intergenic
1146348929 17:32079700-32079722 CAGACTGTGGATAAGGATGGAGG - Intergenic
1147960733 17:44166114-44166136 CAGGCTGAGGCTAAGGCAGGAGG - Intergenic
1148785538 17:50144431-50144453 CAGGCTGTGATGTAGGGAGGGGG - Intronic
1148908438 17:50926564-50926586 CAGGATGTGGGCTGGGAAGGAGG + Intergenic
1149452213 17:56758692-56758714 CAGGCTGTGGCTTCGGAGGGTGG + Intergenic
1150444101 17:65215179-65215201 GAAGGTGTGGATTAGGAGGGTGG + Intronic
1151749017 17:76026566-76026588 AGGGCTGTGGCTTAGGCAGGAGG + Intronic
1151839647 17:76608838-76608860 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1152331969 17:79678750-79678772 AAGGCTGGGGTTGAGGAAGGAGG - Intergenic
1152655606 17:81517930-81517952 CAGGCTGTGGCCTGGGACGGTGG - Intronic
1155173925 18:23286886-23286908 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1155696919 18:28695992-28696014 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1157584428 18:48792092-48792114 AAGGCTGTGGAGAAGGAAGCAGG + Intronic
1158336480 18:56418426-56418448 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1158379729 18:56915963-56915985 CAGGCAGTGGATTACTGAGGAGG - Intronic
1158832243 18:61292481-61292503 CAGTCTGTGGTTTAGCAAGCTGG - Intergenic
1159085095 18:63781177-63781199 CATGTTGTGGGTGAGGAAGGGGG - Intronic
1159835156 18:73327472-73327494 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1160518321 18:79490372-79490394 CAGGCTCTGGGTCAGGATGGGGG + Intronic
1160680456 19:409631-409653 CAATCTGTAGATGAGGAAGGTGG + Intergenic
1161185769 19:2919150-2919172 CAGCCTTTGAATTAGGAATGGGG + Intergenic
1161206930 19:3046437-3046459 CGGGCTGGGGATGGGGAAGGGGG + Intronic
1162983488 19:14254257-14254279 CAGACTGTGGATAAGGATGGAGG + Intergenic
1163121185 19:15218987-15219009 CAGCCTATGGCTAAGGAAGGAGG - Intergenic
1163402477 19:17102463-17102485 GAGGCAGTGGATGAGGAAGTTGG - Exonic
1163614371 19:18318160-18318182 CACACTGTGGATTAGGGTGGTGG - Intronic
1163907287 19:20158369-20158391 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1164003990 19:21132659-21132681 CAGGCTTTGGGTTGGGAAGAAGG + Intergenic
1164153076 19:22571076-22571098 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1164459122 19:28432742-28432764 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1165496908 19:36158301-36158323 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1165510225 19:36262370-36262392 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1165835459 19:38752442-38752464 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1166498836 19:43326385-43326407 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1166701675 19:44885918-44885940 CAGGCTGTGGGGTAGGAGGTAGG - Exonic
1167037163 19:47001318-47001340 AAGGCTGTGGAGTGGGACGGTGG - Exonic
1167046506 19:47052634-47052656 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1167148688 19:47696730-47696752 CAGGCTGGGGCTCAGGAGGGCGG + Intronic
1167323925 19:48812655-48812677 CTGCCTGTAGAATAGGAAGGTGG - Intergenic
1167533746 19:50035764-50035786 CAGGCTGAGCATTAGAGAGGTGG + Intronic
1167670479 19:50850146-50850168 CTGGCTGTGGCTCAGAAAGGGGG + Intergenic
1167696903 19:51020090-51020112 CAGACTGTGGAAGAGGAAGGAGG + Intronic
1168051741 19:53834434-53834456 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1168212025 19:54897762-54897784 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG + Intronic
925544656 2:5003814-5003836 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
925781972 2:7389558-7389580 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
926407866 2:12572587-12572609 AAGGCTTTGGATTGGGAAGAAGG - Intergenic
926413696 2:12629334-12629356 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
926559756 2:14403049-14403071 CAGCCTGAGGATGAGGAAGAAGG + Intergenic
926815440 2:16794815-16794837 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
926891951 2:17645927-17645949 CAGCCTGTATATTAGGATGGGGG + Intronic
927288284 2:21379264-21379286 CAGGCTGTGGCTTTAGAGGGTGG - Intergenic
927424094 2:22962265-22962287 CAGGCTGTGGTTCAGGCAAGGGG - Intergenic
927553965 2:24019866-24019888 CAGCGTGTGGATTCGGAGGGTGG - Intronic
927639418 2:24837281-24837303 CAGGTTATGGAGTGGGAAGGAGG + Intronic
927911003 2:26899681-26899703 CAGCCCCTGGATTGGGAAGGGGG - Intronic
928680149 2:33693140-33693162 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
928827555 2:35439978-35440000 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
929277897 2:40045246-40045268 TAGGGTGGGGATTAGGATGGAGG + Intergenic
929954872 2:46449374-46449396 CAGGCTGTGGATTAGGAAGGGGG - Intronic
930955200 2:57195791-57195813 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
931042716 2:58316526-58316548 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
931237039 2:60420436-60420458 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
931608838 2:64078058-64078080 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
931625883 2:64255365-64255387 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
931850519 2:66246758-66246780 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
931948359 2:67334433-67334455 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
932087668 2:68776156-68776178 CTGGCTGCGGAATAGCAAGGAGG + Intronic
932140552 2:69273612-69273634 GAGGCTGAGGATTGGGAGGGAGG - Intergenic
932358715 2:71087921-71087943 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
932415356 2:71570316-71570338 CGGGCTGTCGATGAGCAAGGTGG + Exonic
932837405 2:75050457-75050479 CAGCCTCTGGATGGGGAAGGAGG - Intronic
932854107 2:75216650-75216672 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
932886587 2:75554429-75554451 CAGGCTGGGGAGAAGGAAAGGGG + Intronic
932973847 2:76576727-76576749 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
933163820 2:79054207-79054229 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
934116241 2:88797762-88797784 CAGGCCGTGGTTTTGGAAGGTGG - Intergenic
934626916 2:95867080-95867102 CAGGCCATGGTTTTGGAAGGTGG + Intronic
934806643 2:97234210-97234232 CAGGCCATGGTTTTGGAAGGTGG - Intronic
934830866 2:97522965-97522987 CAGGCCATGGTTTTGGAAGGTGG + Intronic
935211595 2:100943637-100943659 CAGGCTGTGCAGTAAGAAGAGGG + Intronic
936883434 2:117281568-117281590 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
936909435 2:117575175-117575197 CAGGCTGTGGCTTCAGACGGTGG - Intergenic
937867650 2:126766058-126766080 CAGGCTGTGGAATTGGGGGGTGG + Intergenic
937877783 2:126838214-126838236 CAGGGTGTGGATGAGGAGGCAGG - Intergenic
938717160 2:134031159-134031181 CAAGCTCTGGATTAGGAACTAGG + Intergenic
939137637 2:138315714-138315736 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
939307508 2:140428969-140428991 GAGGCTTTGGATTGGGAAGAAGG - Intronic
939554687 2:143660235-143660257 CAGAATGTGGAGGAGGAAGGAGG - Intronic
940530284 2:154870147-154870169 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
940675705 2:156722943-156722965 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
941353488 2:164461945-164461967 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
941848463 2:170155205-170155227 AAGGCTGTGCATCAGGAAGCTGG + Intergenic
941935794 2:170980517-170980539 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
942231888 2:173867848-173867870 CAGGCTCAGTATTTGGAAGGGGG - Intergenic
942247658 2:174022842-174022864 GAGGCTGTGCTTTAGGTAGGAGG - Intergenic
942299105 2:174545212-174545234 GACGCTGTGGACCAGGAAGGTGG - Intergenic
942730189 2:179054634-179054656 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
942805814 2:179930060-179930082 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
942981893 2:182093218-182093240 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
943412829 2:187563364-187563386 GAGGCTTTGGATTGGGAAGAAGG + Intronic
943560873 2:189460428-189460450 GAGGGTGTGGAGTGGGAAGGAGG - Intronic
943896099 2:193362251-193362273 CAGACCGTGGCTTAGGAAGGTGG - Intergenic
943951193 2:194133762-194133784 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
944387550 2:199182201-199182223 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
944828011 2:203504388-203504410 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
944876025 2:203964795-203964817 GAGGCTTTGGATTGGGAAGAGGG + Intergenic
945188762 2:207165878-207165900 CAGCTCGTGGATCAGGAAGGGGG + Exonic
945938427 2:215925208-215925230 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
946292377 2:218754961-218754983 CAGGGTGGGTATTTGGAAGGAGG - Exonic
946574266 2:221057275-221057297 CAGGCTGTGGCTTCAGAAGGTGG - Intergenic
946780943 2:223192714-223192736 AAGGCTTTGGATTGGGAAGAAGG + Intronic
946886598 2:224228122-224228144 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
946893376 2:224299507-224299529 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
946919696 2:224566069-224566091 CAGCCTGTAGATGGGGAAGGTGG - Intronic
947857433 2:233333618-233333640 CAGGATGTGGGTTTGGATGGTGG - Intronic
948390793 2:237609782-237609804 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1169070234 20:2722618-2722640 CAGGCTGTGGCATAGGGAGAAGG - Intronic
1169850875 20:10049431-10049453 AGGGCTGTGGCTAAGGAAGGCGG + Exonic
1169897797 20:10522832-10522854 CAGCCTGTTGCTGAGGAAGGGGG + Intronic
1170068769 20:12343149-12343171 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1170106336 20:12756709-12756731 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1170165845 20:13359794-13359816 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1170325386 20:15150706-15150728 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1170820600 20:19754029-19754051 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1171238755 20:23548362-23548384 CAGGCTCTGGATTAGGGGAGGGG + Intergenic
1171242850 20:23585876-23585898 CAGGCTCTGGATTAGGGGAGGGG - Intergenic
1172524731 20:35592489-35592511 AAGGCTGAGGGTTAGGTAGGAGG + Intergenic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1173023525 20:39287345-39287367 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1173102013 20:40096175-40096197 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1173118972 20:40271882-40271904 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1173577619 20:44123275-44123297 TGGGCTGTGGATGTGGAAGGAGG - Intronic
1173985585 20:47259203-47259225 CAGGGTGTGGAGGTGGAAGGAGG + Intronic
1174103103 20:48142205-48142227 CAGACTGTGTATGAGGAGGGAGG - Intergenic
1175618032 20:60420169-60420191 CTGGCTGTGGCTAAAGAAGGTGG + Intergenic
1175769441 20:61614334-61614356 CAGGCTGTTGAGCAGGAGGGCGG + Intronic
1176092639 20:63325795-63325817 GAGGCTGTGGGGTAGGGAGGGGG + Intronic
1176296545 21:5076312-5076334 GAGGCTGTGGATGGGGAGGGTGG - Intergenic
1176446743 21:6828243-6828265 AAGGCTGTGTATGAGGATGGTGG + Intergenic
1176824914 21:13693269-13693291 AAGGCTGTGTATGAGGATGGTGG + Intergenic
1177100722 21:16894995-16895017 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1177102776 21:16916823-16916845 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1177118165 21:17110153-17110175 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1177139685 21:17344661-17344683 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1177257457 21:18683868-18683890 CAGGGTGTGGAAGAGGGAGGAGG + Intergenic
1178001294 21:28164035-28164057 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1178004106 21:28196988-28197010 CAGGCTGTGGCTTCAGAAGGTGG - Intergenic
1178007611 21:28240653-28240675 CAGGCTGTGGAGGAGGGAGGAGG - Intergenic
1179006837 21:37522777-37522799 CAGGCTTTTGAGAAGGAAGGAGG - Intergenic
1179015179 21:37589886-37589908 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1179333809 21:40431294-40431316 TAGGCTGAGGAGGAGGAAGGGGG - Intronic
1179860504 21:44185809-44185831 GAGGCTGTGGATGGGGAGGGTGG + Intergenic
1180155399 21:45974995-45975017 CAGGGTGTGGTGTTGGAAGGCGG - Intergenic
1180258742 21:46651548-46651570 CAGGCAGTGGAGGGGGAAGGCGG + Intronic
1180483221 22:15774182-15774204 AAGGCTGTGTATGAGGATGGTGG + Intergenic
1180561054 22:16614462-16614484 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1182576894 22:31278937-31278959 CAGGATCTGGAGTAGAAAGGGGG - Intronic
1182630056 22:31678195-31678217 TCAGCTGTGGATAAGGAAGGAGG + Intronic
1182732377 22:32505604-32505626 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1183001438 22:34862754-34862776 CAGGCTGGTGAAAAGGAAGGAGG - Intergenic
1183454018 22:37911792-37911814 GAGTCTGTGGATTACTAAGGGGG - Intronic
1184190714 22:42892618-42892640 CAGGCTGTGGAGCAGGCACGTGG - Intronic
1184667519 22:45996690-45996712 CAGGCCGTGGAGCAGGAGGGCGG - Intergenic
1184881194 22:47305067-47305089 CAGGCCGAGGGTTAGGAAGGTGG - Intergenic
949671257 3:6400511-6400533 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
949731050 3:7113370-7113392 CAGGATGTAGATAAGGAACGAGG - Intronic
949861203 3:8506412-8506434 AAGGCTGGGGACCAGGAAGGAGG + Intronic
950457579 3:13101869-13101891 CAGGATCTGGATGGGGAAGGAGG - Intergenic
950885959 3:16363001-16363023 CAGGCAGTGGATGAGGTGGGTGG - Intronic
950926597 3:16747148-16747170 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
951137157 3:19117858-19117880 TTGGCTGGGGAGTAGGAAGGTGG - Intergenic
951316221 3:21192075-21192097 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
951358957 3:21702298-21702320 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
951803478 3:26622761-26622783 CAGGCTGGGAATGAGGGAGGAGG - Intergenic
952343474 3:32464296-32464318 GAGGCTTTGGATTGGGAAGAAGG + Intronic
952895952 3:38079154-38079176 GAGGCTTTGGATTGGGAAGAAGG + Intronic
953825605 3:46249187-46249209 GAGGCTTTGGATTGGGAAGAAGG + Intronic
954591557 3:51787839-51787861 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
954671707 3:52294489-52294511 CAGGCTGGAGATTGGGAGGGAGG + Intergenic
954803997 3:53204715-53204737 CAGGCTGTGGGACAGGGAGGGGG + Intergenic
955768164 3:62366302-62366324 GAGGCTGTGGCTTTGGAAGAAGG + Intergenic
955972321 3:64447663-64447685 AAGGCAGTAGATTAGGCAGGGGG + Intergenic
956194967 3:66644458-66644480 CAGACTGCAGATTAGGTAGGTGG + Intergenic
956412418 3:68992889-68992911 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
956548897 3:70437740-70437762 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
956709315 3:72025824-72025846 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
957317204 3:78586021-78586043 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
957364787 3:79208764-79208786 CATGGTGTGGGTTAGGGAGGAGG + Intronic
957491898 3:80938295-80938317 CATGCTATGGATTAAGAAAGAGG + Intergenic
957736976 3:84215439-84215461 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
958182985 3:90083896-90083918 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
958611155 3:96428620-96428642 CAGACTGTAGATTAGAAAGCAGG - Intergenic
958744713 3:98118824-98118846 GAGGCTATGGATCAGGAAGGTGG + Intergenic
959579126 3:107966165-107966187 CAGGCTGTTGATTAGGAGTTAGG - Intergenic
959892426 3:111571052-111571074 CAGGCTGTGGGGTAGGAGGTAGG + Intronic
959972161 3:112420439-112420461 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
960176351 3:114522310-114522332 TAGGCTGGAGGTTAGGAAGGGGG + Intronic
960282774 3:115796379-115796401 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
960310021 3:116108196-116108218 GAGGCTTTGGATTGGGAAGAAGG + Intronic
960818861 3:121705524-121705546 CAGGCTGTGGTCCAAGAAGGGGG + Intronic
961198408 3:125023678-125023700 CAGCCTGTTGATTAGAAATGTGG - Intronic
961331856 3:126147246-126147268 ATGGCTGGGGACTAGGAAGGTGG + Intronic
961505147 3:127365666-127365688 CAGGCTGTGGAATCTGAAGGCGG + Intergenic
961730687 3:128962532-128962554 GAGGCTTTGGATTGGGAAGAAGG - Intronic
962170802 3:133099205-133099227 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
963273642 3:143309222-143309244 CAGTCTGAGGCTTGGGAAGGTGG + Intronic
963422099 3:145073434-145073456 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
963520538 3:146356383-146356405 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
963663445 3:148154483-148154505 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
963684436 3:148417180-148417202 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
964067994 3:152600279-152600301 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
964076700 3:152700868-152700890 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
964125355 3:153229567-153229589 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
964836154 3:160940558-160940580 CGGGCTGTGGCTTCGGAGGGTGG + Intronic
965262552 3:166503660-166503682 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
965336428 3:167434051-167434073 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
965502512 3:169473279-169473301 TAGCCTGTGGATTAGGATGAAGG - Intronic
966085527 3:176064171-176064193 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
966104994 3:176324507-176324529 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
966299417 3:178461907-178461929 CAGGCTGTGGCTTTAGAGGGTGG + Intronic
966428737 3:179809137-179809159 CAGCCTGAGAATTAGGAATGGGG - Intronic
967244076 3:187469150-187469172 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
967496326 3:190147336-190147358 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
967561487 3:190922942-190922964 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
967624548 3:191669362-191669384 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
967647117 3:191938960-191938982 CAGGCTGTAGAACAGGAAGGGGG - Intergenic
969208704 4:5669710-5669732 CAAGATGTGGATTTAGAAGGTGG - Intronic
969476227 4:7423975-7423997 CATGCTGTGGCTTAGGAGGATGG + Intronic
969716729 4:8871543-8871565 CAGGTTCTCGATGAGGAAGGAGG + Exonic
969995899 4:11312873-11312895 CAGGCTCTGGATTAAGAGAGTGG - Intergenic
970087641 4:12366598-12366620 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
970240359 4:14002641-14002663 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
970426911 4:15954146-15954168 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
970624419 4:17861349-17861371 CAGGCTGTTGATTCAGAGGGTGG - Intronic
971123084 4:23724902-23724924 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
971180657 4:24326041-24326063 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
971200236 4:24503843-24503865 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
971327323 4:25655260-25655282 CAAGCTGAGGAAAAGGAAGGGGG - Intergenic
972613648 4:40677990-40678012 CAGCCTGTGGCTGAGGCAGGAGG - Intergenic
973101849 4:46282041-46282063 GAGGCTGTGGAATTTGAAGGAGG + Intronic
974037221 4:56827623-56827645 CAGGCTGTGGCTTTAGAGGGTGG + Intergenic
974631627 4:64497723-64497745 CAAGCTGTGCATTGGAAAGGAGG + Intergenic
975186509 4:71409930-71409952 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
975864989 4:78716738-78716760 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
975933789 4:79556855-79556877 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
976405617 4:84658216-84658238 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
976696642 4:87924696-87924718 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
976884471 4:89967675-89967697 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
977012824 4:91657500-91657522 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
977058533 4:92225179-92225201 CCAGCTGTTGAATAGGAAGGAGG + Intergenic
977075103 4:92441844-92441866 GAGGCTTTGGATTGGGAAGAAGG + Intronic
977198331 4:94087512-94087534 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
977217055 4:94296110-94296132 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
977545040 4:98367208-98367230 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
977578142 4:98696458-98696480 CAGGCTGGGGAGTGGGAAGAGGG + Intergenic
978001017 4:103556641-103556663 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
978934156 4:114355047-114355069 TAGGCTGTGGCTTCAGAAGGTGG - Intergenic
979136159 4:117114942-117114964 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
979183402 4:117757886-117757908 CAGGCTGTGGCTTCAGAATGGGG + Intergenic
979380040 4:119996754-119996776 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
979850207 4:125564511-125564533 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
979879476 4:125936954-125936976 AAGGCTGGGGGTTAGGAAGGAGG + Intergenic
979895064 4:126148024-126148046 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
980285039 4:130770194-130770216 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
980472344 4:133266570-133266592 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
980527964 4:134014998-134015020 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
980758815 4:137201002-137201024 CCATCTGTGGATTAAGAAGGTGG - Intergenic
980904037 4:138930696-138930718 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
981266819 4:142794267-142794289 CAGGCTGTAGTTTAAGATGGTGG + Intronic
981539822 4:145835578-145835600 GAGGCTTTGGATTGGGAAGAAGG - Intronic
981799351 4:148637514-148637536 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
981835947 4:149053538-149053560 CACGCAGTGGCTGAGGAAGGTGG - Intergenic
982083874 4:151815491-151815513 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
982180379 4:152744211-152744233 GAGGCTTTGGATTGGGAAGAAGG + Intronic
982535545 4:156603113-156603135 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
982719020 4:158840123-158840145 CAGGTTATGGAGGAGGAAGGAGG + Intronic
982767446 4:159365110-159365132 CTGGATGTGGTTGAGGAAGGGGG + Intergenic
983068132 4:163235824-163235846 CAGGCTGTGGCTTTAGATGGTGG - Intergenic
983149329 4:164258486-164258508 AAGGCTCTGAATTAGGAAGAGGG - Intronic
983345658 4:166523355-166523377 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
983448149 4:167879084-167879106 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
983452433 4:167925722-167925744 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
983462907 4:168048912-168048934 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
983501581 4:168505668-168505690 CAGCCTCTGGTTTAGAAAGGAGG - Intronic
984393514 4:179167772-179167794 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
984607253 4:181799872-181799894 CAGCCTGTCTATTAGGAAGTGGG + Intergenic
984715285 4:182918836-182918858 CAAGCGGTGGATTTGGGAGGAGG - Intergenic
985435813 4:189928686-189928708 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
985582448 5:705618-705640 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
985809178 5:2070572-2070594 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
986193628 5:5518375-5518397 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
986308318 5:6532067-6532089 CAAGCTGGGGATTAAAAAGGAGG - Intergenic
986388979 5:7266416-7266438 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
986397213 5:7343065-7343087 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
986554948 5:9001424-9001446 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
987486937 5:18536508-18536530 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
987487598 5:18541142-18541164 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
987498024 5:18671736-18671758 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
987895679 5:23943180-23943202 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
989532549 5:42524830-42524852 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
989764509 5:45064799-45064821 CAGGCTCTGGACTTGGATGGTGG + Intergenic
990075757 5:51843991-51844013 CAGGCTGTGGCTTCCGAGGGTGG - Intergenic
990429147 5:55717580-55717602 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
992394766 5:76360187-76360209 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
992960926 5:81956086-81956108 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
993192817 5:84701308-84701330 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
993836796 5:92826792-92826814 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
994532444 5:100987136-100987158 TAGGCTTTGGATTGGGAAGAAGG + Intergenic
994775779 5:104034441-104034463 GAGGCTTTGGATTGGGAAGAGGG - Intergenic
994989648 5:106981202-106981224 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
995122604 5:108552105-108552127 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
996344720 5:122476482-122476504 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
996745339 5:126842436-126842458 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
997769582 5:136542490-136542512 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
997772546 5:136568229-136568251 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
997778247 5:136630526-136630548 CAAGCTGTGGAACAGGAAAGTGG + Intergenic
999394073 5:151215417-151215439 CATGCTGTGGATGGGGAAGAAGG + Intronic
999465897 5:151804051-151804073 CAGGATTTGGAGTGGGAAGGGGG + Exonic
999476512 5:151904482-151904504 CACGCTATGGATGAGGAAGCTGG - Intronic
999618766 5:153452587-153452609 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1000438681 5:161242800-161242822 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1000439818 5:161251325-161251347 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1000519312 5:162278278-162278300 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1000848142 5:166306704-166306726 CAGGCTTTGGAATAGGGAGTAGG + Intergenic
1001210172 5:169803677-169803699 TAGGGTGTGGAGTAGGATGGTGG + Intronic
1002280859 5:178129452-178129474 AAGGGTGAGGGTTAGGAAGGAGG - Intergenic
1003430076 6:6030670-6030692 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1003590263 6:7431537-7431559 CAGCCCGTGGAGGAGGAAGGAGG + Intergenic
1004080087 6:12383549-12383571 CAGGCTGTGAACTGGGCAGGTGG + Intergenic
1004283421 6:14299835-14299857 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1004507894 6:16261871-16261893 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1004575324 6:16888780-16888802 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1004768473 6:18756948-18756970 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1004822640 6:19384182-19384204 CAGGCTGTTGATGAGAAATGTGG + Intergenic
1004837104 6:19541735-19541757 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1005014554 6:21364385-21364407 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1005263957 6:24091571-24091593 CATGTTGTGGAGTAGGAAAGAGG + Intergenic
1005957797 6:30676780-30676802 CAGGCTGTGGTCAAGGGAGGAGG + Exonic
1006059672 6:31410894-31410916 CAGGCTGGGGGTGAGGAATGGGG + Intronic
1006817498 6:36862350-36862372 CAGGCTGTGGAGGAGGAGGCTGG - Intronic
1007828764 6:44622093-44622115 CAGGCTGTGTAGTAGCATGGTGG + Intergenic
1008016420 6:46525596-46525618 CAGACTGAGGATGAGGAAGAAGG + Intergenic
1008153832 6:47989586-47989608 CAGGCTGTTGCTTCAGAAGGTGG + Intronic
1008321837 6:50123691-50123713 CAGGCTGTGGATCAGGAGGATGG - Intergenic
1008650087 6:53552837-53552859 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
1009824313 6:68846580-68846602 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
1010263743 6:73844990-73845012 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1010399378 6:75430782-75430804 ATGGCTGTGGATTAGGACAGAGG + Intronic
1010586594 6:77663433-77663455 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1010662411 6:78586217-78586239 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1010826760 6:80485004-80485026 AAGGCTTTGGATTGGGAAGAAGG + Intergenic
1010829595 6:80513184-80513206 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1010894446 6:81348025-81348047 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1011527619 6:88282190-88282212 CAGGCTGTGCGTTGGGCAGGAGG + Intergenic
1011770838 6:90673090-90673112 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1011968859 6:93196327-93196349 CAGGTTGTGGTTCAGCAAGGGGG + Intergenic
1012066441 6:94556822-94556844 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1012315928 6:97782431-97782453 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1013407787 6:109858643-109858665 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1013891806 6:115034712-115034734 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1014360064 6:120465161-120465183 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1014454768 6:121623317-121623339 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1014555950 6:122842656-122842678 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1014612185 6:123559459-123559481 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1014614572 6:123585172-123585194 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1014718997 6:124894870-124894892 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1014793887 6:125704743-125704765 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1014891643 6:126851576-126851598 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1015271472 6:131341699-131341721 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1015287941 6:131507162-131507184 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1015692144 6:135937277-135937299 CAGGCCGTGGATCTGGAAGAAGG - Intronic
1015815669 6:137208565-137208587 CAGGCTGTGGCTTCGGAGGGTGG + Intronic
1016204630 6:141455644-141455666 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1016248965 6:142018639-142018661 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1016518904 6:144926000-144926022 GAGGCTTTGGATTTGGAAGAAGG - Intergenic
1016535660 6:145106032-145106054 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1016741407 6:147533067-147533089 CAGGCCTTGGGTTGGGAAGGGGG + Intronic
1016853371 6:148642632-148642654 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1016997524 6:149970786-149970808 CAGGATCTGGAGTATGAAGGAGG - Intronic
1017389605 6:153924317-153924339 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1017480955 6:154854234-154854256 AAGTCTGTGGATTAGGACTGAGG + Intronic
1018138839 6:160806617-160806639 AAGGCTGTGGCTGAGCAAGGTGG + Intergenic
1018707803 6:166475630-166475652 CAGGTGCTGGCTTAGGAAGGTGG - Intronic
1018866914 6:167753417-167753439 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1019006674 6:168803582-168803604 CAGCCTGTGGACTGGAAAGGCGG + Intergenic
1019650455 7:2154907-2154929 CAGCCTGTGGAGAAGGACGGAGG + Intronic
1020016833 7:4836200-4836222 GAGGCTGTGGAGTGGGATGGCGG - Intronic
1020541046 7:9461440-9461462 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1021977795 7:26027075-26027097 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1021981388 7:26058980-26059002 TAGGCAGAGGATTAGGAATGTGG + Intergenic
1023522813 7:41065841-41065863 CAGGCTGTGGGTGGGGAAGGCGG + Intergenic
1023698787 7:42873495-42873517 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1024588328 7:50859897-50859919 CAGGCTGTGAACCAGGAAGCAGG + Intergenic
1025964968 7:66261081-66261103 CAGACTGTGGTATAAGAAGGGGG - Intronic
1026091734 7:67306098-67306120 AAGGCTGGGAATTAGAAAGGGGG - Intergenic
1026532556 7:71212239-71212261 CAGGCTGTGGCTTTGGAAGGTGG + Intronic
1027972692 7:85105870-85105892 CAGGTTGTGGAGTAGGAGTGTGG + Intronic
1028253097 7:88558883-88558905 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1028670607 7:93396763-93396785 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1029377206 7:100186311-100186333 AAGGCTGGGAATTAGAAAGGGGG - Intronic
1030383603 7:108842093-108842115 AGGGCAGTGGAGTAGGAAGGGGG - Intergenic
1030441584 7:109594904-109594926 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1031145721 7:117995043-117995065 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1031525694 7:122819754-122819776 GAGGCTTTGGATTGGGAAGAAGG - Intronic
1031685944 7:124731862-124731884 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1031776420 7:125912821-125912843 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1033282230 7:140014407-140014429 CAGGCTGGGGCTGAGGTAGGAGG + Intronic
1033432172 7:141299478-141299500 AAGGCTATGGATCTGGAAGGTGG - Intronic
1033675846 7:143540104-143540126 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1033695988 7:143789339-143789361 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1033909369 7:146246264-146246286 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1035371342 7:158380923-158380945 CAGGCTGTGGCTTCAGAGGGGGG - Intronic
1035469291 7:159099525-159099547 CAGGCTGGGGCTCAGAAAGGAGG + Intronic
1035582001 8:746370-746392 CAGGCTGCGGATGAGGAAACTGG + Intergenic
1035880568 8:3241094-3241116 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1037961584 8:23102276-23102298 GAGGCTGAGGAGTAGGTAGGAGG - Intronic
1037969940 8:23164645-23164667 GAGGCTGAGGAGTAGGTAGGAGG + Intergenic
1039642747 8:39241593-39241615 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
1041793110 8:61717285-61717307 CAGACTGTGGCTTCAGAAGGTGG - Intergenic
1042432814 8:68727730-68727752 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
1042466357 8:69133518-69133540 CAGGCTGTGGCTTCAGAAGGTGG - Intergenic
1042707473 8:71677742-71677764 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1042728355 8:71903209-71903231 CAGGCTGTGGCTTCACAAGGTGG - Intronic
1043855689 8:85262438-85262460 GAGGATGTGGGTTGGGAAGGAGG + Intronic
1044148418 8:88745093-88745115 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1044925263 8:97203747-97203769 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1045197627 8:99946702-99946724 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1045644883 8:104288764-104288786 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1046119861 8:109832287-109832309 CAGGCTTTTGCTCAGGAAGGTGG + Intergenic
1046294217 8:112198655-112198677 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1046512183 8:115215057-115215079 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1047084335 8:121499432-121499454 TAGGTTATGGTTTAGGAAGGAGG - Intergenic
1047699448 8:127434560-127434582 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1047778752 8:128094847-128094869 GAGGCTCTGGAGCAGGAAGGTGG - Intergenic
1047829448 8:128614796-128614818 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1048143859 8:131822021-131822043 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1048168333 8:132083115-132083137 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1048728325 8:137411155-137411177 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1048764141 8:137827705-137827727 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1049196452 8:141318323-141318345 CAGGCTGTGGTTAAGGAGGGTGG - Intergenic
1049391304 8:142373017-142373039 CAGGCTGAGGGGTAGGATGGAGG - Intronic
1049511382 8:143028430-143028452 GAGGCTGTGGATGGGGGAGGTGG - Intergenic
1049652286 8:143776552-143776574 CAGGGTGTAGTATAGGAAGGGGG + Intergenic
1049868721 8:144957142-144957164 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1049941211 9:547811-547833 CATGCTGTGAAAGAGGAAGGTGG + Intronic
1050258006 9:3814047-3814069 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1050624164 9:7485996-7486018 CAGACTGTGAACTAGGAAGAAGG - Intergenic
1050641131 9:7668747-7668769 CAGGGTGTGGATCACTAAGGTGG - Intergenic
1051052728 9:12951154-12951176 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1051849180 9:21488583-21488605 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1051902680 9:22059876-22059898 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1051975445 9:22942363-22942385 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1053745279 9:41190061-41190083 CAGGCTGTGGATTGGAAGCGGGG - Intronic
1054481993 9:65675152-65675174 CAGGCTGTGGATTGGAAGCGGGG + Intronic
1054683068 9:68241207-68241229 CAGGCTGTGGATTGGAAGCGGGG + Intronic
1054807389 9:69407630-69407652 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1055233170 9:74088492-74088514 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1055322741 9:75098339-75098361 TAGGATGAGGGTTAGGAAGGGGG + Intronic
1055626823 9:78183640-78183662 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1055699091 9:78921761-78921783 AAGGCTGAGGAGGAGGAAGGAGG + Intergenic
1055843298 9:80531583-80531605 CAGGCTGTGGCTTCAGACGGTGG - Intergenic
1055881841 9:81011840-81011862 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1056061255 9:82886578-82886600 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1056323989 9:85461475-85461497 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1056331175 9:85522592-85522614 CAGGCTGTTGAGTAGGGAAGTGG + Intergenic
1056522550 9:87413755-87413777 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1056707213 9:88961368-88961390 CAAGGTGTGGAAGAGGAAGGTGG + Intergenic
1056883078 9:90415405-90415427 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1057126638 9:92621021-92621043 AGGGCTGTGGATAAGGAAGTCGG - Intronic
1057234949 9:93350438-93350460 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1057263155 9:93597514-93597536 CAGGCTGTGGGGCAGGAAGCGGG + Intronic
1057278517 9:93692115-93692137 CAGTCTGTGAATCAGGAAGTGGG + Intergenic
1057684096 9:97217664-97217686 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1057890028 9:98863015-98863037 CTGGCTGTGTATTGGGAACGTGG - Intergenic
1058174519 9:101722174-101722196 CAGGCTGTGGCTTCAGAGGGTGG + Intronic
1059587262 9:115619769-115619791 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1059606603 9:115842082-115842104 GAGGCTTTGGATTGGGAAGGAGG + Intergenic
1059863388 9:118488549-118488571 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1060384901 9:123216162-123216184 CAGGCAAAGGATTAGGAAGGGGG - Intronic
1060518934 9:124282977-124282999 CAGCCTGTGGGGCAGGAAGGAGG + Intronic
1060962580 9:127691515-127691537 CAGGCTGTGGAGGAGGACGCTGG - Exonic
1061883686 9:133580227-133580249 CAGGCTGTTGATGGAGAAGGGGG - Exonic
1062024256 9:134333036-134333058 CAGGCTCTGGATGAAGTAGGGGG + Intronic
1062465206 9:136677828-136677850 CTGGATGTGGATTTGGAAGTGGG - Intronic
1202781407 9_KI270718v1_random:845-867 CAGGCTGTGGATTGGAAGCGGGG - Intergenic
1203522448 Un_GL000213v1:56288-56310 AAGGCTGTGTATGAGGATGGTGG - Intergenic
1185858328 X:3556011-3556033 GAGGCTCTGGATTGGGAAGAAGG + Intergenic
1185960594 X:4543361-4543383 GAGGCTTTGGATTAGGAATAAGG + Intergenic
1185991159 X:4894415-4894437 GAGGCTCTGGATTGGGAAGAAGG - Intergenic
1187086427 X:16047569-16047591 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1187259375 X:17671084-17671106 CAGGCAGTGCATTAGGAACTGGG - Intronic
1188431124 X:30106177-30106199 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1188463284 X:30451980-30452002 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1188992921 X:36845844-36845866 CAGGATGGGGATATGGAAGGAGG + Intergenic
1189822585 X:44884662-44884684 AAGGCTGTGGTTTAGGAATGGGG + Intronic
1191089223 X:56602392-56602414 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1191202886 X:57803467-57803489 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1191856135 X:65628409-65628431 CAGGCTGTGGCTTCAGAGGGTGG - Intronic
1192102600 X:68280083-68280105 TAGACTGTGTATTAGCAAGGGGG + Intronic
1192452352 X:71252368-71252390 CAGGCTGTGGGGGAGGAATGGGG - Intronic
1192527755 X:71862206-71862228 CAGGCTGTGGCTTCAGAGGGTGG - Intergenic
1192934910 X:75849371-75849393 CAGGCTGTGGATTCAGAGGGTGG - Intergenic
1193614547 X:83671514-83671536 CAGGCTGTGGCTTCAGAGGGTGG + Intergenic
1193941598 X:87684723-87684745 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1194186152 X:90776204-90776226 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1194308445 X:92275946-92275968 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1194351386 X:92827323-92827345 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1194367203 X:93025762-93025784 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1194502883 X:94701702-94701724 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1195044325 X:101042586-101042608 TTGGCTGTTGGTTAGGAAGGTGG - Intronic
1195908580 X:109868104-109868126 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1196073185 X:111546752-111546774 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1196165646 X:112533444-112533466 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1196300108 X:114042816-114042838 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1196330923 X:114469592-114469614 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1196341615 X:114604179-114604201 GAGGCTTTGGATTGGGAAGAAGG + Intronic
1196470006 X:116013505-116013527 GAGACTTTGGATTAGGAAGAAGG - Intergenic
1196512159 X:116524326-116524348 CAGCCAGTGGACTGGGAAGGTGG - Intergenic
1196533448 X:116815365-116815387 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1196572600 X:117281983-117282005 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1196631475 X:117945012-117945034 CAGGCTGTGAATGAGGAACTAGG + Intronic
1196773764 X:119320658-119320680 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1197065017 X:122224865-122224887 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1197351956 X:125391725-125391747 GAGGCTTTGGATTGGGAAGAAGG + Intergenic
1199472507 X:148210416-148210438 CAGGCTGTTGCTTCAGAAGGTGG + Intergenic
1199576574 X:149318490-149318512 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1199848224 X:151706905-151706927 AAGGGTGTGGCTTGGGAAGGTGG + Intergenic
1200659708 Y:5944015-5944037 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1200675417 Y:6142019-6142041 GAGGCTTTGGATTGGGAAGAAGG - Intergenic
1200834357 Y:7718316-7718338 CAGGCAGTGGATGAGGTGGGTGG - Intergenic
1201511145 Y:14764665-14764687 CTGTCTGTGGACTAGGAAGTGGG - Intronic
1201559613 Y:15302129-15302151 CAGGCAGGGGATTAGGAAATGGG - Intergenic
1201977570 Y:19869493-19869515 CGGGCTGGGGAATGGGAAGGCGG - Intergenic