ID: 929956144

View in Genome Browser
Species Human (GRCh38)
Location 2:46460188-46460210
Sequence GGTTTCTGCTTCTGTAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2513
Summary {0: 1, 1: 2, 2: 40, 3: 312, 4: 2158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929956144_929956152 26 Left 929956144 2:46460188-46460210 CCCGTTTTACAGAAGCAGAAACC 0: 1
1: 2
2: 40
3: 312
4: 2158
Right 929956152 2:46460237-46460259 TCCCCATGGTGGCACAGCAATGG 0: 1
1: 0
2: 0
3: 24
4: 181
929956144_929956150 12 Left 929956144 2:46460188-46460210 CCCGTTTTACAGAAGCAGAAACC 0: 1
1: 2
2: 40
3: 312
4: 2158
Right 929956150 2:46460223-46460245 CTGAAAGATCTGTCTCCCCATGG 0: 1
1: 0
2: 1
3: 13
4: 168
929956144_929956154 27 Left 929956144 2:46460188-46460210 CCCGTTTTACAGAAGCAGAAACC 0: 1
1: 2
2: 40
3: 312
4: 2158
Right 929956154 2:46460238-46460260 CCCCATGGTGGCACAGCAATGGG 0: 1
1: 0
2: 2
3: 7
4: 125
929956144_929956151 15 Left 929956144 2:46460188-46460210 CCCGTTTTACAGAAGCAGAAACC 0: 1
1: 2
2: 40
3: 312
4: 2158
Right 929956151 2:46460226-46460248 AAAGATCTGTCTCCCCATGGTGG 0: 1
1: 0
2: 1
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929956144 Original CRISPR GGTTTCTGCTTCTGTAAAAC GGG (reversed) Intronic
Too many off-targets to display for this crispr