ID: 929957360

View in Genome Browser
Species Human (GRCh38)
Location 2:46468614-46468636
Sequence CTGAGGGGTTGGGGGTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 508}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929957360 Original CRISPR CTGAGGGGTTGGGGGTCAGA AGG (reversed) Intronic
900071153 1:772195-772217 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
900135994 1:1117134-1117156 CTGAGGGGTTGGGGGTATATGGG - Intergenic
900183776 1:1323928-1323950 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183781 1:1323944-1323966 CTGAGGGTCTGGGGGTCTGCTGG + Intronic
900183791 1:1323968-1323990 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183798 1:1323984-1324006 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183819 1:1324040-1324062 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183854 1:1324128-1324150 CTGAGGGGCTGGGGGGCTGGGGG + Intronic
900183857 1:1324136-1324158 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183865 1:1324152-1324174 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900306356 1:2010799-2010821 CTTAGGGGGTGGGGGGCACAGGG - Intergenic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900721035 1:4175982-4176004 CAGAGGGGTCGGAGGTCAGAGGG - Intergenic
900721046 1:4176025-4176047 CAGAGGGGTCGGAGGTCAGAGGG - Intergenic
901737091 1:11319526-11319548 CTGGGGGGTTGGGGGAGACAGGG + Intergenic
901751783 1:11414404-11414426 ATGAGGGATTGGAGGGCAGAGGG + Intergenic
901796767 1:11684071-11684093 TTTAGGGGTTTGGGGTCAGATGG - Intronic
902194620 1:14789166-14789188 CTGAGGGCTTTGGGGACAGGAGG + Intronic
902343440 1:15799340-15799362 AGGAGGGGTTGCTGGTCAGAGGG - Intergenic
902421360 1:16283007-16283029 CTCAGGAGTTGGGGATAAGATGG - Intronic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
902583007 1:17421013-17421035 CTGGGAGGGTGGGGGTCTGAGGG - Intronic
902679614 1:18033753-18033775 GTGAGGGGTGTGGGGTCAGGGGG + Intergenic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
902905361 1:19552684-19552706 CTGAGGGGTAGAGGGTCACCAGG - Intergenic
902979079 1:20110208-20110230 CTGAGGGGTTGGGTAGCTGATGG - Intergenic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
903655989 1:24949073-24949095 TTGAGGGGATGGGGGTCTGCAGG + Intronic
905280804 1:36847890-36847912 CTGAGAGGCTGTGGGACAGATGG + Intronic
905362432 1:37430112-37430134 CCCTGGGGTTGGGGGTCAGTGGG - Intergenic
905434302 1:37946401-37946423 CAGAGGGGTTGGGGGCAGGAGGG + Intronic
906149995 1:43582124-43582146 CTGAGAATTTGGGGGACAGAAGG - Intronic
906460691 1:46033594-46033616 CAGAGTGGTTTGGGGTAAGAAGG - Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907630755 1:56079630-56079652 AGGAGGGGTTGGGGACCAGATGG - Intergenic
908253648 1:62284875-62284897 ATGAGGAGTTGGGGGTGACATGG - Intronic
908454106 1:64285164-64285186 CTGAGGGGATGTGGATCAAAAGG - Intergenic
909235109 1:73143121-73143143 AGGTGGGGTTGGGGGTCACAAGG + Intergenic
910112999 1:83701896-83701918 GTGAGGGGTTGAGGGTCAGCAGG - Intergenic
910118809 1:83761570-83761592 CTGAGGGGTGGGTGGGCAGGGGG - Intergenic
910308727 1:85798372-85798394 CGGCGGGGTTGGGGGTCGGAGGG + Intronic
910652107 1:89580864-89580886 CTGTAGGGTTCAGGGTCAGATGG + Intronic
911400653 1:97370414-97370436 TTGGGGGTTGGGGGGTCAGAGGG + Intronic
912512530 1:110198815-110198837 CTTAGGGCTGTGGGGTCAGATGG + Exonic
912579484 1:110707119-110707141 CTGAGGGGTGGAGGGTGAGATGG + Intergenic
912635799 1:111291508-111291530 CTGAGGGGTTGGGGGCAAGGGGG + Intronic
912799649 1:112712867-112712889 CGGAGTGGTTGGGAGGCAGAGGG + Exonic
912975390 1:114324605-114324627 CTGAGAGGCTGGGGTTTAGAAGG - Intergenic
914088087 1:144472181-144472203 TTCAGGGGATGGGGATCAGAAGG + Intergenic
915196725 1:154195067-154195089 TTGAGGGGTTAAGGGTAAGAAGG - Intergenic
915555721 1:156659711-156659733 CACAGGGGTTGGGGGACAGCTGG + Intergenic
916147044 1:161749585-161749607 CTTTGGGGGTAGGGGTCAGAGGG + Intergenic
916435063 1:164770392-164770414 CTGAGGAGTTGGAGCACAGAAGG - Intronic
916734322 1:167594014-167594036 CTGAGGAGTCAGGGGTAAGAGGG - Intergenic
917512777 1:175681924-175681946 CTTGGGGGTCGGGGGGCAGAAGG - Intronic
917538545 1:175892071-175892093 CCGAGGGGTGGGTGGTCACACGG + Intergenic
917868479 1:179221078-179221100 CTGAGGGGTGGGAGGTCACTAGG - Intronic
918076534 1:181175371-181175393 CTGGGTGGTGGGGAGTCAGAGGG - Intergenic
918304211 1:183231118-183231140 CTGTGGGGTTGGGGGTGGTAAGG - Intronic
919590909 1:199500833-199500855 CAGAGGGGTGGGGGATAAGAAGG + Intergenic
920527187 1:206675671-206675693 CTGAGGGCTTGGGTGGCTGAGGG + Intronic
920561073 1:206938999-206939021 TAGCCGGGTTGGGGGTCAGAAGG - Intronic
920699416 1:208206550-208206572 CTGATGAGTTGGGGGAGAGAAGG - Intronic
920764783 1:208821785-208821807 CTGGGGGGTTGGGGGTGGGGGGG - Intergenic
921747281 1:218752805-218752827 CTGAGGGGTTGCTGGACTGAAGG - Intergenic
922106512 1:222517644-222517666 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
922218324 1:223538947-223538969 GACAGGGGTTGGGGCTCAGAGGG + Intronic
922786703 1:228286470-228286492 CTGTGGGGTGGGGGCTCGGAAGG + Intronic
923000795 1:230004963-230004985 CTGCGGGGTTGGGGGTGTGAGGG + Intergenic
923093916 1:230760087-230760109 CTGAGGGTCTGCGGGTCACACGG - Intronic
923116036 1:230938689-230938711 CTGAGGAGATGAGGGACAGAAGG - Intronic
923147408 1:231207860-231207882 CTGGGGGGTTGGGGAGCAAAAGG + Intronic
923438933 1:233996909-233996931 GTAAGGGGTGGGGGGTCACAGGG - Intronic
924348698 1:243095210-243095232 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
924518075 1:244782608-244782630 CACAGGGGATGGGGGTCAGCAGG - Intergenic
924873519 1:248075017-248075039 CTCAGGGGCTGGGGGTCTGGGGG - Intronic
1063371713 10:5526595-5526617 GTGAGGGGTTGGGGGGCAGTTGG + Exonic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1065093453 10:22258667-22258689 CTGAGGGGCAGGTGGTCAGATGG - Intergenic
1065960536 10:30730950-30730972 CAGAGGGGTGTGGGGTGAGAGGG + Intergenic
1067077733 10:43197678-43197700 CTGTGGGATTGGAGGTCAGGAGG - Intronic
1067396193 10:45921442-45921464 CTGATGTATTGGGGGTCACAGGG - Intergenic
1067789589 10:49277729-49277751 CTGAGGGGGTGGGGCTTAGTGGG - Intergenic
1067864509 10:49890564-49890586 CTGATGTGTTGGGGGTCACAGGG - Intronic
1069528550 10:69196620-69196642 CTCAGAGGTTGGGGGTTGGAGGG - Intronic
1069543904 10:69315794-69315816 ATGAGGGGTTGGGGGTGGGATGG + Intronic
1069901322 10:71708177-71708199 CTGGAGGTTTGGGGGTCAGGAGG + Intronic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070918626 10:80170522-80170544 CTGAGGGGTTAGGGTTGGGAAGG - Intronic
1072018889 10:91379388-91379410 GTGGGGGGTTGGGGGGCAGTGGG - Intergenic
1072372562 10:94779110-94779132 TTGAGGGGTTGGGGGGCAAGGGG + Intronic
1072641519 10:97214667-97214689 AGGAGGGGAAGGGGGTCAGAAGG - Intronic
1074324945 10:112441076-112441098 CTGAGGCGGTGTGGGTCACAAGG - Intronic
1075729469 10:124627716-124627738 CTGAGGTCTAGGGGGTCTGATGG - Intronic
1075805550 10:125186425-125186447 TTGAGATGTTGAGGGTCAGACGG + Intergenic
1075872041 10:125778099-125778121 CAGTGCAGTTGGGGGTCAGAGGG - Intergenic
1076009087 10:126972565-126972587 ATGGGAGGTTGGGGGTGAGAGGG + Intronic
1076783412 10:132736917-132736939 CTGAGGGATCAGGGGGCAGAGGG - Intronic
1076975266 11:166972-166994 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077170596 11:1164333-1164355 CAAAGGGGTTGGGGGACAGGGGG - Intronic
1077896686 11:6458111-6458133 CTGAGGGGGTGGGGGTCCTCCGG + Exonic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1078602115 11:12742422-12742444 CAGAGGTTTTGGGGGTGAGAGGG + Intronic
1079352207 11:19701194-19701216 CTAAGGGGTTGGGGGTTGGTGGG + Intronic
1081253802 11:40868189-40868211 CACAGGGGTTGGGGGAGAGAAGG + Intronic
1081551668 11:44119211-44119233 CTGTGGGGATGTGTGTCAGAGGG + Intronic
1081612499 11:44570975-44570997 CTGCAGGGTAGGAGGTCAGAGGG - Intronic
1081667646 11:44925873-44925895 GTGAGGTGCTTGGGGTCAGAGGG + Intronic
1081771194 11:45651437-45651459 CTCAGGGGATTGGGGTCAGATGG - Intronic
1081853683 11:46290781-46290803 ATGAGGGGTTGGGGGTGGGGAGG + Intronic
1082894275 11:58173638-58173660 CTGAGGGGGTGGGGTTCAGGGGG - Intronic
1083169152 11:60912306-60912328 CTGAATGGTTGGGGGTGGGAGGG + Intergenic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083733897 11:64668824-64668846 CTGCTGAGTTGGGGGCCAGAGGG - Intronic
1083796868 11:65021917-65021939 ATGGGGGGTTGGGAGTCAGCCGG + Exonic
1083885959 11:65573638-65573660 CTGAAGGGCTGGGGGGCAGGGGG + Exonic
1085162297 11:74359978-74360000 TTTAGGGGATGGGGGTGAGAAGG + Intronic
1086511778 11:87566064-87566086 CTGAGGGGGTGTGGATCAGGAGG - Intergenic
1088821681 11:113462277-113462299 TTGGGGGCTTGGGGGTCGGAGGG - Intronic
1089043335 11:115475077-115475099 CTGAGGATTTGGGTGTGAGAAGG - Intronic
1089283914 11:117393642-117393664 CTGAAGGCTTTGGAGTCAGATGG - Intronic
1089682176 11:120124804-120124826 CAGAAGGGTTGGGGTTCAGGAGG - Intronic
1090063575 11:123484669-123484691 CTGAGGTTTTGGGGGTTGGAGGG - Intergenic
1090800635 11:130169459-130169481 CTGAAGGGGTGGGGGACAGGAGG + Intronic
1091221875 11:133934608-133934630 CTGCGAGGTTAGGGGTCCGATGG + Intronic
1092327624 12:7549925-7549947 GTCAGGGGTTGGGGGTCTGGGGG + Intergenic
1092910358 12:13140377-13140399 ATGAGGGGTTGGGTGTAGGATGG - Intronic
1093254961 12:16855670-16855692 CTGAGGGGTTTGGGGACATCGGG - Intergenic
1093728662 12:22543978-22544000 CTGAGGGGCTGGGGGCGAGGTGG + Intronic
1094469621 12:30791648-30791670 CTGAGGGCATTGGGGTGAGATGG - Intergenic
1095592361 12:43917569-43917591 GTGAGGGCTTGGGAGACAGATGG - Intronic
1095870745 12:47025321-47025343 CTGAGGGTTTGGGGGAGGGAGGG - Intergenic
1096122531 12:49097551-49097573 CTGAGAGGGTGGGTGGCAGAGGG - Exonic
1096185384 12:49577058-49577080 CTGCAGGGTTGGGGATGAGAAGG + Intronic
1096528643 12:52229769-52229791 CTGAAGAGTCAGGGGTCAGAGGG + Intergenic
1096558904 12:52422062-52422084 CAATGGGGTTGGGGGACAGATGG + Intergenic
1097178376 12:57156606-57156628 CTGGGTTGTTGGGGGGCAGAGGG + Intronic
1097572714 12:61355059-61355081 CACAGGGGATGGGGGTCACAGGG - Intergenic
1098355995 12:69613087-69613109 CTGAGGGTTTGTGGGTGATAGGG + Intergenic
1099176870 12:79432357-79432379 TTGTGGGGTTGGGGGGCAGGGGG - Intronic
1100378664 12:94041799-94041821 CTGAGGGGATGCGGGTCACAGGG - Intergenic
1100607785 12:96165972-96165994 CTGGGGGGTGGGAGGACAGACGG - Intergenic
1100741169 12:97595260-97595282 CAAAGGGGCTGGGGGTCAGAAGG + Intergenic
1101535484 12:105612648-105612670 GTGAAGAGTTGAGGGTCAGAAGG - Intergenic
1101989844 12:109476024-109476046 CAAAGGAGTTGGGAGTCAGAGGG - Intronic
1102025271 12:109711133-109711155 CTGAGGGGGCAGGGGGCAGAGGG - Intergenic
1103506123 12:121443253-121443275 CTGTGGGGTGGGAGGTCAGTTGG - Intronic
1103765238 12:123275050-123275072 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765248 12:123275082-123275104 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765254 12:123275098-123275120 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765264 12:123275130-123275152 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765274 12:123275162-123275184 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765289 12:123275218-123275240 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1103765292 12:123275226-123275248 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1103950637 12:124549262-124549284 CTGAGGGGCTGGCGGTGGGAGGG + Intronic
1103961642 12:124612629-124612651 GGGAGGGGCTGGGAGTCAGAAGG - Intergenic
1104534318 12:129604163-129604185 TCGAGGGGTTGGGGGTAAGGGGG + Intronic
1104641174 12:130468360-130468382 CTGAGGGGTTTGGATTCAGCAGG + Intronic
1104761504 12:131299777-131299799 CTGAGGGGCTGCGGGTGGGAAGG + Intergenic
1104818272 12:131661015-131661037 CTGAGGGGCTGCGGGTGGGAAGG - Intergenic
1104862175 12:131929495-131929517 CTGAGAGGTCAGGGGTCAGCAGG + Exonic
1106126950 13:26908485-26908507 GTGGAGGTTTGGGGGTCAGAAGG + Intergenic
1106453621 13:29907759-29907781 CTGAGGAGTTGGGAGTGTGAGGG - Intergenic
1107888849 13:44896502-44896524 CCGCGGGGGTGGGGGTCAGGAGG - Intergenic
1108709478 13:53018327-53018349 CTGAGCTGGTGGGGGTCAGAAGG - Intergenic
1109470454 13:62797977-62797999 TTGAGGGGTTGGGGGGCGGGTGG + Intergenic
1111433869 13:88180830-88180852 CTGAGGGTGTGGGGGTGTGATGG - Intergenic
1111604487 13:90519997-90520019 GTGAGGGGTGGGGGCTCACAGGG - Intergenic
1112454106 13:99542596-99542618 CAGAGAGGTTGGGGGACAGGAGG - Intronic
1112883445 13:104137716-104137738 GTGAGGGGTTTGGCTTCAGAGGG + Intergenic
1113465030 13:110506867-110506889 GAGAGGGGTCGGGGGTCAGACGG - Intronic
1113820334 13:113208890-113208912 CTGAGGGGTTTGGGGTCCAGTGG + Intronic
1113900428 13:113793844-113793866 CTGTGGTGTGGAGGGTCAGAAGG + Intronic
1114267946 14:21083756-21083778 CTCAGGGGTTGGGGGGTAGGTGG - Intronic
1114286775 14:21252103-21252125 CTTAGGAGTTGGGGGTCTTATGG - Intronic
1114639086 14:24207062-24207084 CTGAAGGGCCAGGGGTCAGAGGG - Intronic
1115233474 14:31186366-31186388 CTGATGGGTTGGGTGTGAAATGG - Intronic
1115503843 14:34075278-34075300 CTGAGGGCTTGGGGGCAGGAGGG - Intronic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1117132040 14:52695924-52695946 CTGCGGGGTTGGGGGGCGGGGGG + Intergenic
1117766538 14:59089205-59089227 GTTAGGAGTTGGGGGTCAGCAGG - Intergenic
1117987393 14:61400951-61400973 CTGAGGAGTTGGGGGTGGGGGGG + Intronic
1119799793 14:77433796-77433818 CTGAGGCCTTGGGAGACAGAAGG - Intronic
1119896434 14:78223699-78223721 CTGAGGGATAGGGGGACAAAGGG + Intergenic
1120682933 14:87502521-87502543 CTGGGGCATTGGTGGTCAGAAGG - Intergenic
1121761629 14:96449985-96450007 GTGAGGGATTTGGAGTCAGAAGG + Intronic
1123632887 15:22274459-22274481 CTTAGGGGTTGGGGGAAAAAAGG - Intergenic
1125482332 15:40089196-40089218 CTGAGGGGGTGGAGGTCGGGGGG + Exonic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128438069 15:67675435-67675457 CTGAGAGGATGGGAGACAGAGGG + Intronic
1128527391 15:68421717-68421739 GTGAGGGGCTGGGTTTCAGATGG + Intronic
1128756415 15:70186613-70186635 ATGATGGGGTGGGGGCCAGAGGG - Intergenic
1128838533 15:70830986-70831008 GTGAGAGATTGGGGGTCAAATGG + Exonic
1129449373 15:75641723-75641745 GTGAGGGTTTCGGGGTAAGAGGG + Intronic
1129570567 15:76679707-76679729 CTGAGTGGTGAGGGGACAGATGG - Intronic
1129790153 15:78335730-78335752 CTCAGCGTTTAGGGGTCAGATGG - Intergenic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1131513682 15:93063830-93063852 CTGTGGAGGTGGGGGTCAGTTGG + Intronic
1131518314 15:93094347-93094369 CTTATGGGATGGGGGTAAGATGG + Intergenic
1132244600 15:100284589-100284611 CTGAGGGGTGGGAGGCTAGAGGG + Intronic
1132778669 16:1611130-1611152 CTGAGGTGTTGGGTGACTGAGGG + Intronic
1132986704 16:2771075-2771097 CTGGGGGGTTTGGGGTGGGAGGG + Exonic
1133272857 16:4619176-4619198 CTTAGGGGATGGGGGTGAGGGGG - Intronic
1133819965 16:9227265-9227287 CTGCGGGGGTGGGGGTAAAATGG + Intergenic
1134811879 16:17174604-17174626 GCCAGGGGTTGGGGGTCAGAGGG + Intronic
1134834956 16:17353569-17353591 CAGAGGGCTTGGGGGTAAAATGG - Intronic
1135162477 16:20109422-20109444 ATGAGGGGTTGGTGGCCAGATGG + Intergenic
1136091764 16:27925750-27925772 CCGAGGGGCTGGGGGTGACAAGG + Intronic
1136158728 16:28403700-28403722 GTGAGGGGTTGGGCGTCGGGAGG - Intronic
1136204360 16:28711583-28711605 GTGAGGGGTTGGGCGTCGGGAGG + Intronic
1136774575 16:32864930-32864952 CTGAGCGGTTTGGGGTAAGCTGG - Intergenic
1136896037 16:33996584-33996606 CTGAGCGGTTTGGGGTAAGCTGG + Intergenic
1137579366 16:49623836-49623858 CAGATAGGTTGGGGGTCAGGGGG + Intronic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1139492380 16:67293269-67293291 CTGAGGGCTGGGGAGTCAGCAGG - Intronic
1140580278 16:76223255-76223277 CTGGGGGGTGGGGGGGCAGGGGG + Intergenic
1141731023 16:85822894-85822916 CCGAGGGGTTTGGGGTGGGAGGG + Intergenic
1141764831 16:86051529-86051551 CTGAGGACTTGGGGGCCAGAGGG + Intergenic
1141970174 16:87476308-87476330 CTTAGGGGTTGGGGGAAAAAAGG + Intronic
1203077001 16_KI270728v1_random:1127066-1127088 CTGAGCGGTTTGGGGTAAGCTGG - Intergenic
1142462516 17:104779-104801 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1142806072 17:2371974-2371996 CTGGGTGGTTGGGGGCCAGGCGG + Intronic
1142986318 17:3697136-3697158 GTGCGGGGGTGGGGGGCAGACGG + Intergenic
1143273110 17:5690093-5690115 CAGTGGGGTTGGGGGTTGGATGG + Intergenic
1144157895 17:12525455-12525477 CTTAGGGGTTGGGGGGCAATAGG - Intergenic
1144496670 17:15750016-15750038 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1144496689 17:15750074-15750096 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1144904943 17:18634791-18634813 CTGAGGGGCTGAGGGGCTGAGGG - Intergenic
1145398049 17:22511613-22511635 CTGCGGGGTGTGGGGTCATAGGG + Intergenic
1145898369 17:28473964-28473986 CTGAGGGCTAGGAGGTCAAAGGG + Intronic
1146002625 17:29140309-29140331 TTCCGGGGTGGGGGGTCAGAGGG + Intronic
1146683338 17:34824251-34824273 CTGTGGGGTAGGGGGTTAAATGG - Intergenic
1147157055 17:38549220-38549242 CCAAGGGGCTGGGGGTCAGCAGG + Intronic
1147195858 17:38766333-38766355 CTCAGGTGTTGGGGGCTAGAAGG - Exonic
1147215428 17:38896393-38896415 GTGAGGGGTAGGGGCTGAGAAGG - Intronic
1147386150 17:40083612-40083634 CTGAGGGGTTGGGGGTGTCTGGG - Intronic
1148612207 17:48971953-48971975 CACAGGGGATGGGGGTCAGGAGG + Intergenic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148875009 17:50681896-50681918 GTGAGGGGTGAGGGGCCAGAGGG - Intronic
1149657640 17:58318770-58318792 GTGGGGGCTTGGGGGTCAGTCGG - Intronic
1149661767 17:58337896-58337918 CTTGTGGGTTGGGGGGCAGAGGG + Intergenic
1151043200 17:70888249-70888271 CTGAGGGATTGGGGGTTTTAGGG - Intergenic
1151419061 17:73985558-73985580 CTGTGAGGATGGGGGTCACATGG + Intergenic
1151480333 17:74366794-74366816 TTGAGGGGTAGGGAGGCAGAAGG + Intergenic
1151816114 17:76472171-76472193 CTGAGGGGCAGGGGGTCGGCTGG + Intronic
1151858213 17:76737743-76737765 CTGAGGGGGCCGGGGTCACAGGG - Exonic
1152598916 17:81251665-81251687 TTGGGGGGTTGGGGGACAGAAGG + Intronic
1152632162 17:81415152-81415174 CTCAGAGGGTGGGGGTCACACGG - Intronic
1152780668 17:82226222-82226244 CTGGGGGCTGTGGGGTCAGAGGG + Intergenic
1153046256 18:857899-857921 CTCAGGGGGTGAGGGTGAGACGG + Intergenic
1153321028 18:3774461-3774483 CTGAGGGGTTCTGTTTCAGATGG + Intronic
1153978881 18:10292509-10292531 CTGAGGGGTTGGGGGAGTGGAGG - Intergenic
1154193809 18:12251779-12251801 CTGAGGGTGTGGGTGTCAGGTGG + Intergenic
1155116977 18:22778439-22778461 CAGAGGAGTAGGGGGTGAGAAGG - Intergenic
1156105973 18:33661306-33661328 CTCAGGAGTTGGGAGTCAGTAGG - Intronic
1157192730 18:45594931-45594953 CACAGGGGTTGGGGGTCGGTGGG - Intronic
1157284044 18:46365009-46365031 GTGAGGGGTTGGGGGTCTCTGGG + Intronic
1157781195 18:50440754-50440776 TTGGGGGGTGGGGGGGCAGAAGG - Intergenic
1158119037 18:54027978-54028000 CTTAGGAGTTGAGGGCCAGATGG - Intergenic
1158650009 18:59275838-59275860 CTGAGGTGGTGGTGATCAGAGGG + Intronic
1158783426 18:60679598-60679620 CTCAGGGGTTGGGGGTGGGATGG - Intergenic
1160241601 18:77128452-77128474 CTGATGTGTTGGTGGTCACATGG + Intronic
1160504826 18:79421200-79421222 CTGCCGTGATGGGGGTCAGAGGG - Intronic
1160652223 19:237155-237177 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1160729424 19:634221-634243 CTGAGGGCTTGGGGATTGGAGGG - Intergenic
1160757188 19:763984-764006 TTGAGGGGCTGCGGGTCTGAGGG + Exonic
1160805062 19:989075-989097 CTGGGGGGTTGTGGGTTCGAGGG - Intronic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1161473766 19:4473574-4473596 TTGAGGGGCTGGGGGGCCGAGGG + Intronic
1161497819 19:4597275-4597297 TTGCGGTGATGGGGGTCAGAGGG - Intergenic
1161575257 19:5051378-5051400 CTGATGGGTTGGGGGCAAAAGGG - Intronic
1161820733 19:6529255-6529277 CTGGGGGGTTGGGGATCAGGGGG + Intergenic
1162753533 19:12843469-12843491 CTGAGGAGTTGGGGGACCGCTGG + Intronic
1162955063 19:14092844-14092866 CTGAGGGGCTGGGGGGCTGTGGG + Exonic
1163121735 19:15222501-15222523 CTGAGGTGTTGGGGGTCCTCAGG + Intergenic
1163251205 19:16127414-16127436 CTGAGAGGGAGGGGGACAGACGG - Intronic
1163530757 19:17847664-17847686 CTGCGGGGTTGGGGGTGGGGAGG - Intronic
1163584763 19:18157573-18157595 GTGAGGAATTGTGGGTCAGAGGG - Intronic
1163608465 19:18288585-18288607 CAGAGGGTTTGGGGATCAGAAGG + Intergenic
1163847481 19:19645791-19645813 CTGTGGGGATGAGGGACAGATGG + Intronic
1164201989 19:23026615-23026637 GGCAGGGGTTGGGGGTCACAAGG + Intergenic
1164684236 19:30156610-30156632 ATGAGGGAATGGGGTTCAGAGGG + Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165901751 19:39172594-39172616 CTGAGGGGTTTGGGGGAGGAAGG - Intronic
1165944969 19:39436470-39436492 CTGAGGGGAAGGGGCTCTGAGGG - Intronic
1166254006 19:41589626-41589648 GTGAGGGGATGAGGCTCAGATGG - Intronic
1166679751 19:44759208-44759230 AAGAGGGGCCGGGGGTCAGAAGG - Intronic
1166856513 19:45785044-45785066 GTGATGAGTTGGAGGTCAGAGGG + Intronic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167236417 19:48318665-48318687 CTGGGGAGGAGGGGGTCAGAGGG - Intronic
1167601123 19:50455453-50455475 ATGAGGGGTCAGGGGTCAGCAGG - Intronic
1168072079 19:53958984-53959006 CTGAGAGGATGGGGGAGAGAGGG - Intergenic
1168535174 19:57163098-57163120 TGGCCGGGTTGGGGGTCAGATGG - Intronic
1168561208 19:57384869-57384891 GAGAGGGGTTTGGGGGCAGATGG - Intronic
925146822 2:1587732-1587754 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925146883 2:1587941-1587963 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925919686 2:8630537-8630559 CTGAGGGGCGGGGGGGCAGGGGG + Intergenic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
926132256 2:10311157-10311179 CTGAGGGATTGGGGGGCGGGGGG - Intronic
927142134 2:20137720-20137742 CTGGAGGGTTGGGGGTCAGAAGG - Intergenic
927594556 2:24385291-24385313 CTGGAGGGTTGGTGGGCAGAGGG - Intergenic
927819375 2:26249568-26249590 ATGAGAGGTTGGGTTTCAGATGG + Intronic
927882165 2:26696503-26696525 CTGATTGGTTGGAGGTCAGCAGG + Intronic
928622809 2:33108221-33108243 CTGGGGGGCTGTGGGGCAGAGGG + Intronic
929024256 2:37584271-37584293 GTGAGGGGTTGGGAGTGATAAGG + Intergenic
929265267 2:39912047-39912069 CTGTGGGCTTGGGAGTAAGATGG + Intergenic
929560662 2:42954421-42954443 CTGAGGGGTCAGAGGTCAAAGGG + Intergenic
929668619 2:43852487-43852509 GTGAGGGCCTGGGGGGCAGATGG + Intronic
929862152 2:45688205-45688227 CTGAGCAGTTGGAGGCCAGAAGG + Intronic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
930166254 2:48206452-48206474 CTAAGGGGGTGCGGGTGAGAGGG + Intergenic
931066812 2:58596834-58596856 CAGAGGCTTTGGGGGTCAGATGG + Intergenic
931157591 2:59653079-59653101 GAGAGGAGTTGGAGGTCAGAAGG - Intergenic
931784672 2:65608418-65608440 ATGGGAGGTGGGGGGTCAGAGGG - Intergenic
931849257 2:66236295-66236317 CTGAGGGGGGGGGGGTAAAAGGG + Intergenic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932532748 2:72554900-72554922 GTCAGGGGTTGGGGGTCTGGGGG - Intronic
932645641 2:73498546-73498568 GTGAGGGGTTTGGGGAGAGATGG - Intronic
933146440 2:78859548-78859570 CTGAGGAGTTGTTGGTCAAAGGG + Intergenic
933854482 2:86400027-86400049 CTGAGGGTGTGGGGGGCAGCAGG + Intergenic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935101818 2:100003093-100003115 CTGGGGAGTTGGGGGTCGGGGGG + Intronic
936472530 2:112811701-112811723 CTGATGGGCTGGGGGTTGGAAGG + Intergenic
942173450 2:173309060-173309082 CTAAGGGGGTGTGGGTGAGAGGG - Intergenic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
943646754 2:190414114-190414136 CTGGGGGGTTGGGTGGCAGGGGG + Intronic
945063560 2:205929108-205929130 ATGAGGGCTGAGGGGTCAGAAGG - Intergenic
946661990 2:222010998-222011020 CTGAGAGGGTGGGGAGCAGAAGG + Intergenic
946685821 2:222268622-222268644 ACGGGGGGTTGGGGGGCAGAGGG + Intronic
947418508 2:229921803-229921825 CTGAGGGGTTGGGGGGGCGGGGG - Intronic
948152700 2:235756866-235756888 ATCAGGGGTTGGGGGGCAGGTGG - Intronic
948660820 2:239505540-239505562 CTGAGGGGTGGAGGGGCAGAGGG - Intergenic
1169012083 20:2259233-2259255 CTGAGGGGTGGGGAGTTAGAGGG + Intergenic
1169258173 20:4114803-4114825 CTGTGGTGTTGGGGGTGGGAGGG - Intergenic
1169828684 20:9798076-9798098 CTGAGGGGTTGGGAGTCCAAAGG + Intronic
1171337245 20:24395415-24395437 CAGAGGTGGTGGGGGTCAGGGGG + Intergenic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1172313464 20:33935386-33935408 CTGGGGAGCAGGGGGTCAGAGGG - Intergenic
1172528801 20:35616957-35616979 CTGAGGGGCGGGGCTTCAGAGGG + Intronic
1172784016 20:37454180-37454202 CTGAAGGGATTGGGGTTAGAAGG - Intergenic
1172861995 20:38061854-38061876 TTGCGGGGTGGGGGGTCAGGAGG - Intronic
1172991467 20:39040192-39040214 CTGAGAGGTGGAGGGACAGAGGG - Intergenic
1174112505 20:48206071-48206093 CTGCCAGGTTGGGGGTCAGAAGG - Intergenic
1174390478 20:50215848-50215870 CTGGGGGGCTGGGGGTGGGAGGG + Intergenic
1175224943 20:57439370-57439392 CAGAGGGGTCGGGGGTGGGAGGG - Intergenic
1175313262 20:58026469-58026491 GTGGCGGGTTTGGGGTCAGAAGG - Intergenic
1175614596 20:60385329-60385351 CTTAGGGTTTGGGAGTGAGAAGG + Intergenic
1175940551 20:62535718-62535740 TTGAGGGGGTGGGGGTCAGGGGG + Intergenic
1175949755 20:62577045-62577067 CTGAGGGTCTGGGAGTCAGCTGG - Intergenic
1176139366 20:63538293-63538315 CTCAGGGGCTGGGGGGCAGGCGG - Intergenic
1176144452 20:63559371-63559393 CTGTGAGGGTGGGAGTCAGATGG + Intronic
1176915193 21:14617235-14617257 TTGAGGAGTTAGTGGTCAGATGG + Intronic
1178253262 21:31025117-31025139 CTAAGGGGTTGTGCGTGAGAGGG - Intergenic
1178804984 21:35831756-35831778 TTGAGGAGTTGGGGGGCAGCAGG - Intronic
1180646154 22:17340795-17340817 CTGAGAGGCTGGGAGTCAGGAGG + Intergenic
1181021888 22:20107897-20107919 CTGAGGGGTGGAGGGTAACATGG + Intronic
1183144560 22:35977936-35977958 AAGAGTGGTTGGGGGTCAGGGGG + Intronic
1183379705 22:37484773-37484795 CTGAGGTGCTGGGGGCCAGCTGG + Intronic
1184094281 22:42308239-42308261 CCAAGGGGTTGAGGGTCAGGTGG - Intronic
1184375806 22:44111943-44111965 CTGGGAGGCTGCGGGTCAGAAGG + Intronic
1184474445 22:44712916-44712938 GGGAGGGGTTGGGGGTCAGAGGG + Intronic
1184770077 22:46591876-46591898 CTGAGGGGTGCGGGGGCTGAGGG - Intronic
1184887558 22:47355583-47355605 CTGGGGGGTGGGGGGACAGGTGG + Intergenic
1184932264 22:47690255-47690277 CTGAGGGCTTGGGAGGCAGGAGG + Intergenic
1185228209 22:49665178-49665200 CAGCGGGGCTGGGGGTCAGCAGG - Intergenic
949508335 3:4746905-4746927 CTGAGTGCTGGGGAGTCAGATGG - Intronic
950214849 3:11152310-11152332 ATGAGGGGTTGGGGAGCAGAAGG - Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950249922 3:11456148-11456170 CTCAGGGTTAGGGGGCCAGAGGG - Intronic
950765858 3:15272490-15272512 CTGATGAGGTGGGGGACAGAAGG + Intronic
950774315 3:15336557-15336579 ATGAGGGGATGTGGGGCAGAGGG + Intronic
950886927 3:16370480-16370502 CTGAAGGGTTGGGCTTCTGATGG + Intronic
951698226 3:25468002-25468024 CTGATGTGATGGGGGTCAGGTGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952232755 3:31448430-31448452 ATGAGGAGTTGGGGGTGAGGTGG - Intergenic
954239861 3:49285078-49285100 TTTTGGGGCTGGGGGTCAGAAGG - Intronic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
955785878 3:62538425-62538447 CTGACAGGTTGGAGGTGAGAGGG - Intronic
956950797 3:74279873-74279895 GTGAGGGGTTTGGGGTGAGGGGG + Intronic
957587045 3:82146122-82146144 CTGAGGGGCTGGGGTACAGCTGG - Intergenic
957590185 3:82186420-82186442 CTGAGGCATTGGTGGACAGACGG - Intergenic
957828390 3:85481602-85481624 GTGAGGGGTTGGGGGTGAGGAGG + Intronic
957854325 3:85854625-85854647 GTCAGGGGTTGGGGGTCAAGGGG + Intronic
962238366 3:133729091-133729113 CTTGGGGGTCAGGGGTCAGAGGG + Intergenic
962748037 3:138412019-138412041 CTGGGGACTTGGGGGTCACAGGG + Intergenic
963786277 3:149537693-149537715 CTGAGGAATTGTGGGGCAGATGG - Intronic
964239006 3:154569467-154569489 GTCAGGGGTTGGGGGACAAAGGG + Intergenic
964269605 3:154940624-154940646 CTCCAGGGTTGGGGGTCACAGGG - Intergenic
965395342 3:168155016-168155038 CTGAGGGAGTTGGAGTCAGAAGG + Intergenic
965505886 3:169514380-169514402 GTGAATGGTTGGGGGACAGAGGG + Intronic
965604489 3:170485083-170485105 GGGAGGGGTTGCGGGGCAGAAGG - Intronic
966636015 3:182134648-182134670 ACGAGAGGTTGGGAGTCAGATGG + Intergenic
967150096 3:186640526-186640548 CCGAGGGGTTGAGGGCCAGCTGG - Exonic
967272043 3:187740211-187740233 GTGAGGGGGTGGGGGTCATGTGG - Intronic
967652781 3:192007454-192007476 GTGGTGGGTTGGGGGACAGAGGG - Intergenic
967967065 3:194970058-194970080 CTGAGGGGATTGGGGGCTGAGGG - Intergenic
968118524 3:196108224-196108246 CTGAGGGGAGGAGGGTCAGCTGG + Intergenic
968365610 3:198182817-198182839 CTGAGGGGATGGGGCTGAGCTGG - Intergenic
968461090 4:725423-725445 CTGAGGGGTTGTGGGGCCCATGG + Intronic
969038067 4:4272067-4272089 AGGAGGGGGTGGGGGTGAGAGGG + Intronic
969106714 4:4811933-4811955 CGCAGGCTTTGGGGGTCAGATGG - Intergenic
969344684 4:6563479-6563501 CTGCGGGGCTGGGGGTGAGGCGG + Intronic
969441274 4:7218083-7218105 CGGATGGGTTGGGGGTCAGGAGG + Intronic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
974879460 4:67735976-67735998 CTGAGGGGAAGGGTGACAGAGGG + Intergenic
976031863 4:80764935-80764957 TGGAGGGGTTGGGGGGCAAAGGG + Intronic
976512659 4:85929414-85929436 CAGAGGCCTTGGGGGTCAGTTGG + Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
979254644 4:118597984-118598006 CTGAGGGGATGGGGCTGAGCTGG - Intergenic
979334317 4:119448047-119448069 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
980850754 4:138378482-138378504 CTGTTGGGTGGGGGGACAGAAGG + Intergenic
981042589 4:140237116-140237138 GTGAGTTGTTGGGGGTCAGAGGG - Intergenic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
982073755 4:151718550-151718572 CTGAGAGGCTGGAGGCCAGAGGG + Intronic
982284889 4:153724556-153724578 CTCAGGACTTGGGGGTGAGAGGG - Intronic
982560410 4:156922729-156922751 CTGTTGGGTTGGGGGTCGGGGGG + Intronic
983017285 4:162628729-162628751 CTGGGGTGGTGGTGGTCAGAGGG + Intergenic
983568484 4:169179162-169179184 CAGATGGGTTGAGAGTCAGAGGG + Intronic
984437953 4:179727896-179727918 CTGCAGGGGTGGGGGTCACAAGG - Intergenic
985640794 5:1062681-1062703 CTGGGGGGCTGGGGGACTGAGGG + Intronic
986024466 5:3837746-3837768 CTTAGCGGTTGGGGGATAGAGGG + Intergenic
986232214 5:5876708-5876730 CTGAGGGGTAGGGGCAGAGAGGG + Intergenic
986276739 5:6281738-6281760 CGGAGGGGTGGGTGTTCAGAAGG + Intergenic
987113929 5:14712135-14712157 CTGAGGGGTGTGGGCTGAGATGG - Intronic
987296679 5:16559108-16559130 CGGAGGGGTTGGAGGTGGGAAGG - Intronic
987595155 5:19988369-19988391 GTGGGGGGTTGGGGGGGAGAAGG - Intronic
987948316 5:24644514-24644536 TTGAGGGGTGGGGGGGGAGAGGG - Intronic
988847365 5:35141802-35141824 ATGAGGAGTTGGGGGTGGGAGGG - Intronic
989446110 5:41530713-41530735 CTGAGGGGGTGTTGGTCAAAGGG + Intergenic
991498214 5:67248944-67248966 CTGAGGGCTTGGGGGATACATGG + Intergenic
991964482 5:72077621-72077643 CAGAGGGGTCGGGGCTCACATGG + Intergenic
992477152 5:77114508-77114530 TTGAGGGGTTGGGGGGCTGGGGG + Intergenic
993001743 5:82387900-82387922 TTGCGGGGTTGGGGGGCAGCAGG + Intergenic
996074755 5:119178744-119178766 TTGAGGGGTTGGGGTACAGTGGG + Intronic
996532865 5:124544490-124544512 CTGAGGGGCTGAGGGTGAGTAGG - Intergenic
996886013 5:128354326-128354348 CTGAGGGGGTGGGAGGCACAGGG + Intronic
997723987 5:136105016-136105038 CGGAGGGAATGGGGGTGAGAGGG + Intergenic
997833070 5:137169193-137169215 GTGAGGGGTTGGGGGGAAGTGGG + Intronic
998423273 5:142006460-142006482 CCGAGTGGCTAGGGGTCAGAGGG - Intronic
999231948 5:150066851-150066873 GGGTGGGGTTGGGGGTCTGAAGG - Intronic
999779980 5:154841394-154841416 CTGTGGACTTGGGGGTTAGAGGG + Intronic
1001437821 5:171714334-171714356 CTGAGTGATTAGGGGTGAGAAGG - Intergenic
1003362668 6:5443667-5443689 CTGCGGGGCTGGGGCTCAGCTGG - Intronic
1004286946 6:14329982-14330004 CTCAGGGATTGGAGTTCAGAGGG + Intergenic
1005904230 6:30247207-30247229 ATGAGGGGTTGGGAGTGGGAAGG - Intergenic
1006787846 6:36679858-36679880 TTGAGGGGTGGGGGGTCTGGGGG + Intronic
1006884600 6:37370620-37370642 CTCAGGGCTTGGTGGGCAGAGGG - Intronic
1007397739 6:41587177-41587199 CTGTGGGGTTGGGGCTGGGAGGG - Intronic
1007412888 6:41674973-41674995 TTGTGGGGTTGGGGGACAGGAGG + Intergenic
1007466910 6:42058938-42058960 GTGTGTGGTTGGGGGGCAGAGGG + Intronic
1008911190 6:56735534-56735556 ATGAGGGGTTATGGGACAGAGGG - Intronic
1008925638 6:56889387-56889409 CTGAGGAGTTGGAGGACATATGG - Intronic
1010090443 6:71974009-71974031 GGGAGGTGTTGGGGGTCAGTGGG + Intronic
1010447779 6:75967341-75967363 TTGGTGGGTTGGGGGTGAGAAGG + Intronic
1011025908 6:82868843-82868865 CAGAGGATTTGGGGGTCTGAAGG - Intergenic
1014692328 6:124577385-124577407 CTGTGTGCTTGGGGGACAGAAGG + Intronic
1015944603 6:138487003-138487025 GTGAGAGGTTGTGGTTCAGAAGG + Intronic
1016379229 6:143456768-143456790 CTGAGGTGTTGGGGCTCCCATGG + Intronic
1016779953 6:147946137-147946159 CTCAAGGGTTGGGGGAGAGAAGG - Intergenic
1017380713 6:153826044-153826066 TGGAGGGGGTGGGGGGCAGATGG - Intergenic
1017514485 6:155143722-155143744 ATGAGGGCTTTGGGGCCAGAGGG + Intronic
1018117413 6:160600834-160600856 CTGAAGGGTTGTGCGTCAGTGGG + Intronic
1018527915 6:164734704-164734726 CTGAGGGGGTGGGGGACCGGGGG - Intergenic
1018908815 6:168090216-168090238 CTGAGAGCGTGGGGGGCAGAGGG - Intergenic
1019215224 6:170438932-170438954 CTGAGGGCCTAGGGGTCAGCAGG + Intergenic
1019215250 6:170438997-170439019 CTGGGGGCTGGGGGGTCAGCAGG + Intergenic
1019467009 7:1195458-1195480 CTGCGGTCTTTGGGGTCAGACGG - Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019660148 7:2219636-2219658 CAGAGCGGTAGGGGGGCAGATGG + Intronic
1020080922 7:5285263-5285285 CTGGGGGGTTGGGGGTGGGGTGG - Intronic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1022034996 7:26525894-26525916 CTGATTGGTTGGGTGACAGAGGG - Intergenic
1023022991 7:36027705-36027727 CTGAGGAGTTCTGGGGCAGAAGG + Intergenic
1023638626 7:42237296-42237318 CTCAGGGCTTGTGAGTCAGAAGG - Intronic
1023965293 7:44960915-44960937 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1023965313 7:44960964-44960986 CTGAGGGGCTGGGGCTGAGGGGG + Intergenic
1023965462 7:44961418-44961440 CTGAGGGGCTGAGGGTTTGAGGG + Intergenic
1023965535 7:44961619-44961641 CTGAGGGGCTGAGGGCCTGAGGG + Intergenic
1023965601 7:44961841-44961863 CTGAGGGCTGAGGGGTCTGAGGG + Intergenic
1024069737 7:45775650-45775672 CTGAGGGGATGGGGCTGAGCTGG - Intergenic
1025099651 7:56124003-56124025 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1025197986 7:56946903-56946925 CTGAGGGGTTGGGGGTGGGGTGG + Intergenic
1025673961 7:63630032-63630054 CTGAGGGGTTGGGGGTGGGGTGG - Intergenic
1026447525 7:70498575-70498597 GTGGGGGGTTGGTGGGCAGAAGG + Intronic
1026896698 7:74013634-74013656 CAGAGGTGATTGGGGTCAGAGGG - Intergenic
1027151677 7:75738309-75738331 CTAAGGGGTGGGGGGTGGGAAGG + Intronic
1030219409 7:107081399-107081421 CTGATGGGGTGGGGGTGGGAGGG - Intronic
1030252416 7:107462499-107462521 ATGGGGGGTAAGGGGTCAGAGGG + Intronic
1032047126 7:128619935-128619957 CTGAGGGGATGGGGCTGAGCTGG - Intergenic
1032779043 7:135147660-135147682 AAAAGGGGTTGGGGGACAGACGG + Intronic
1033210892 7:139459553-139459575 CTGAGGTGTTGGCGTTGAGATGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034341722 7:150361529-150361551 CTGAGGGCTTGGGAGACAGAGGG + Intergenic
1034503041 7:151463763-151463785 CTGAGGTGTAGGGGCTCAGAGGG + Intergenic
1035520736 8:273730-273752 GTGGGGGGTTGGGGGACTGAGGG + Intergenic
1035860812 8:3026191-3026213 CTGGTGGGGTGGGGGACAGAGGG + Intronic
1036562013 8:9906087-9906109 CAGAGGGGGTGGGGGTCTGCGGG - Intergenic
1036660718 8:10706751-10706773 CAGAGGGGTTGGGGGTGACAGGG - Intronic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037801788 8:22040023-22040045 CTGGGGGGGTGGGGTTCAGGAGG - Intergenic
1038349739 8:26765150-26765172 TTGTGGGGTTTGGGGTTAGAGGG - Intronic
1039560794 8:38510878-38510900 CTGGGGGATTGAGAGTCAGAAGG - Exonic
1040509943 8:48084669-48084691 CTGAAGGGGTGGGAGTCATAGGG + Intergenic
1040557242 8:48491519-48491541 GTCAGGGGTTGGGGGGCAGGGGG + Intergenic
1040850858 8:51899181-51899203 CTGAGGGGGGCGGGGCCAGATGG - Intronic
1041636918 8:60155312-60155334 GGGAGGGGTTGGGGGACACATGG + Intergenic
1042062083 8:64830541-64830563 ATGAAGGGTTGGGGGTGGGAGGG - Intergenic
1042141171 8:65680162-65680184 CTCAGGGGTTGGGGGGCGGGGGG + Intronic
1044360124 8:91273187-91273209 TGGAGGGGTTGGTGGTGAGAGGG + Intronic
1047413907 8:124648468-124648490 CTGAGGAGTTAGGGGAGAGAGGG - Intronic
1047752172 8:127890175-127890197 CTGAGGGGTTTAGGGTCAGCTGG - Intergenic
1047769212 8:128017128-128017150 CAGAGAGGTTGGGGGACATATGG + Intergenic
1048049893 8:130806826-130806848 CTGAGGGGTCACGGGTGAGAGGG - Intronic
1049472816 8:142783880-142783902 CTGAGGGGCTGGGGGCGAGTGGG - Intergenic
1049582242 8:143418118-143418140 GTGGGGGGTTGGGGGTGAGTTGG - Intergenic
1049995548 9:1030812-1030834 ATCAGGGGTTGCGGGGCAGAGGG - Intergenic
1050334082 9:4574071-4574093 CTGAGAGGTTGGGTTTCAGTTGG + Intronic
1050726914 9:8660567-8660589 CTGAGGGGCTGGGAGCCAGCTGG - Intronic
1052999679 9:34571087-34571109 GTGAGGGGCTGAGGGTCAGAAGG - Intronic
1053165551 9:35841495-35841517 AGGAGAGGTTGGGGGTAAGAAGG - Intronic
1053612507 9:39729184-39729206 GAGAGGGGTTGGGGGTCGGGGGG + Intergenic
1053870539 9:42487155-42487177 TAGAGGGGTTGGGGGTCGGGGGG + Intergenic
1054085746 9:60741972-60741994 GAGAGGGGTTGGGGGTCGGGGGG - Intergenic
1054241008 9:62613209-62613231 GAGAGGGGTTGGGGGTCGGGGGG - Intergenic
1054555140 9:66647733-66647755 GAGAGGGGTTGGGGGTCGGGGGG - Intergenic
1054754792 9:68946741-68946763 CTGAGGTGGTGGGGGTAGGAAGG - Intronic
1055020684 9:71666369-71666391 CTGAGGGGTTGAGGGGCTGGAGG - Intergenic
1056790880 9:89624573-89624595 CTGTGGATTTGGGGTTCAGAGGG + Intergenic
1057075982 9:92138326-92138348 CCTAGGGGTTGGGGGACACAAGG + Intergenic
1057189339 9:93077769-93077791 CCCAGGGGTTGGGGGTCTCAGGG - Intronic
1059010340 9:110451110-110451132 CTGAGGGGTTTGGGGTAAAAGGG - Intronic
1059356406 9:113702633-113702655 CTCAGGTGTTGGGGCTGAGAGGG - Intergenic
1059736355 9:117103780-117103802 CTAGATGGTTGGGGGTCAGATGG - Intronic
1059941248 9:119362048-119362070 CGGAGGGGTTGGGGGTGGGGGGG - Intronic
1060385955 9:123228457-123228479 GTGTGGGGTTGGGGGACAGGGGG + Intronic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1061201927 9:129142991-129143013 CTGAGTGGTGGGAGGTCTGAGGG + Intronic
1061397174 9:130349522-130349544 AGGAGGGGCTGGGGGTGAGAAGG - Intronic
1061418843 9:130462403-130462425 CTGGGGTCTTGGGGTTCAGAGGG + Intronic
1061671033 9:132188269-132188291 CTGAGGGGCTGAGGATGAGAAGG + Intronic
1061963755 9:134001707-134001729 AGGTGGGGATGGGGGTCAGATGG - Intergenic
1062075964 9:134590126-134590148 CTGGGGTGTGGGGGATCAGAAGG + Intergenic
1062532777 9:137009165-137009187 CTGTGGGGTTGGGGGGCTGTGGG - Intronic
1062557798 9:137123496-137123518 CTGTGTTTTTGGGGGTCAGATGG + Intergenic
1185492838 X:532023-532045 CAGTGGGGTGGGGGGCCAGAGGG - Intergenic
1185791069 X:2928671-2928693 CTGGGGGGTTGGGGGCGGGACGG + Intronic
1187243992 X:17537897-17537919 CTGAGCAGATGGGGATCAGAGGG + Intronic
1187425799 X:19176368-19176390 CTGAGAAGTTGGGAGACAGATGG - Intergenic
1187701470 X:21967983-21968005 CGGAGGGGCTGGGGTCCAGATGG + Intronic
1188586710 X:31785599-31785621 TTGGGGGATTGGGGGGCAGAGGG - Intronic
1189630586 X:42948464-42948486 CTTGGGGGTTGGGGGTGCGATGG - Intergenic
1189990969 X:46594596-46594618 CTGAAAGCATGGGGGTCAGAAGG - Intronic
1190473322 X:50804466-50804488 ATGAGAGGTTGGGGGACAGACGG - Intronic
1191654140 X:63577490-63577512 TTGAGGGGGAGGGGGACAGAGGG - Intergenic
1192056567 X:67779827-67779849 CTAAGGAGTTGGGAGCCAGAGGG + Intergenic
1192996961 X:76521965-76521987 GTTAGGGGTTGGGGGTCTGGGGG - Intergenic
1194405368 X:93490341-93490363 CTAAGGGGTTGTGCGTGAGAGGG - Intergenic
1194512849 X:94816538-94816560 GTCAGGGGTTGGGGGTAAGGAGG - Intergenic
1194539838 X:95156695-95156717 ATGAGGGGTTAGGGCTCACAAGG - Intergenic
1195716684 X:107825578-107825600 TTGTGGGGTTGGGGGACAGGGGG + Intergenic
1196716888 X:118821081-118821103 GAGAGGGGTTGGGGGTAAGGGGG - Intergenic
1197119371 X:122871919-122871941 CTCAGGGGTCGGGGGGCAGTGGG + Intergenic
1197913863 X:131514001-131514023 GTGAGGGGTGGGGGCTCACAAGG + Intergenic
1199723217 X:150558222-150558244 ATGAGGGCTTGGGGGTTTGAGGG + Intergenic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200105372 X:153709127-153709149 CTGAGGGGTTTGGGGTAAGCTGG + Intronic