ID: 929961739

View in Genome Browser
Species Human (GRCh38)
Location 2:46502381-46502403
Sequence TAGTGGGTAAGCCTGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929961732_929961739 3 Left 929961732 2:46502355-46502377 CCCAAGATCCAAGTGTAGGTTCT 0: 1
1: 0
2: 1
3: 33
4: 3081
Right 929961739 2:46502381-46502403 TAGTGGGTAAGCCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 199
929961728_929961739 10 Left 929961728 2:46502348-46502370 CCCCAAACCCAAGATCCAAGTGT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 929961739 2:46502381-46502403 TAGTGGGTAAGCCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 199
929961730_929961739 8 Left 929961730 2:46502350-46502372 CCAAACCCAAGATCCAAGTGTAG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 929961739 2:46502381-46502403 TAGTGGGTAAGCCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 199
929961734_929961739 -5 Left 929961734 2:46502363-46502385 CCAAGTGTAGGTTCTCTCTAGTG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 929961739 2:46502381-46502403 TAGTGGGTAAGCCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 199
929961729_929961739 9 Left 929961729 2:46502349-46502371 CCCAAACCCAAGATCCAAGTGTA 0: 1
1: 0
2: 1
3: 16
4: 153
Right 929961739 2:46502381-46502403 TAGTGGGTAAGCCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 199
929961733_929961739 2 Left 929961733 2:46502356-46502378 CCAAGATCCAAGTGTAGGTTCTC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 929961739 2:46502381-46502403 TAGTGGGTAAGCCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929961739 Original CRISPR TAGTGGGTAAGCCTGGAGGC AGG Intronic
900101312 1:963248-963270 GGGCGGGTAAGCCTGGAGGCTGG + Exonic
902247549 1:15130984-15131006 ACGTGGGTAAGCCTGGAAGCAGG + Intergenic
902288216 1:15420064-15420086 TGGTGGCTTGGCCTGGAGGCAGG - Intronic
903828072 1:26159346-26159368 TTCTGGGCTAGCCTGGAGGCCGG - Intronic
904101108 1:28028516-28028538 TAGTGGTTAAGTCTGGATGATGG - Intronic
904277942 1:29396312-29396334 TACTGGGGACTCCTGGAGGCCGG + Intergenic
904289664 1:29476099-29476121 TAGGGTGTAAGCCTGGAGTTGGG - Intergenic
904337000 1:29804374-29804396 GAGAGGGTGAGCCTTGAGGCGGG - Intergenic
904826641 1:33277565-33277587 CAGGGGGTAAGCATGGAAGCAGG + Intronic
905273849 1:36804710-36804732 TGTTGGGGAAGCATGGAGGCTGG + Intronic
906723887 1:48029442-48029464 TAGTAGGAAAGGCTGGAAGCAGG - Intergenic
909785029 1:79600629-79600651 TCTTGGGTAAGCCTGGAGCCTGG - Intergenic
915987697 1:160482686-160482708 TAGTGGGAATGACTGGGGGCTGG + Intergenic
917473075 1:175342591-175342613 ATGGGGGTGAGCCTGGAGGCAGG + Intronic
920031204 1:203038462-203038484 GAGTGAGTAAGCCTGGAGAAGGG + Intronic
922294614 1:224238735-224238757 TAGTGGTCAATCCTGGGGGCAGG + Intronic
923160892 1:231313731-231313753 TAGTGGCTAAGACTGCAGGTGGG + Intergenic
924357845 1:243202298-243202320 AAGTGGGGAAGCCGGAAGGCGGG + Intronic
1064138490 10:12770805-12770827 TTGTGCGAAAGCCTGAAGGCTGG + Intronic
1065204568 10:23344413-23344435 TTGTGGGGAAGCCTTGAGGCAGG - Intronic
1066442799 10:35454702-35454724 TCCTTAGTAAGCCTGGAGGCGGG + Intronic
1067052460 10:43029803-43029825 CAGAGGGTGAGACTGGAGGCAGG - Intergenic
1067056996 10:43058221-43058243 TTTTGGGTAGACCTGGAGGCTGG - Intergenic
1067200974 10:44171873-44171895 AAATGGGTAAGCAGGGAGGCAGG + Intergenic
1069578995 10:69552338-69552360 TAGTGGCTGAGCCAAGAGGCTGG + Intergenic
1069963023 10:72089406-72089428 CAGCGGGGAAGGCTGGAGGCTGG + Intergenic
1073687327 10:105769670-105769692 TTGTGGGTAAGCTTTAAGGCAGG + Intergenic
1074533460 10:114312419-114312441 TAGTGGGTGAGGCAGGAGACTGG + Intronic
1078524326 11:12089154-12089176 AAGTGGGTATGCAGGGAGGCTGG - Intergenic
1079114816 11:17634396-17634418 TAGGGGGTGAGCTTGGAGGAGGG + Intronic
1080649105 11:34208922-34208944 AAGGGGGTAAGCCTGGAGGCAGG - Intronic
1081865144 11:46355653-46355675 TAGTGTGGAAGCCTGGAGAGTGG + Intronic
1082131842 11:48499734-48499756 TAATGGGGACGACTGGAGGCAGG - Intergenic
1082565307 11:54670352-54670374 TAATGGGGACGACTGGAGGCAGG - Intergenic
1082644254 11:55702070-55702092 CATGGGGTCAGCCTGGAGGCAGG - Intergenic
1084430090 11:69106261-69106283 TGGACGGTGAGCCTGGAGGCTGG + Intergenic
1084789940 11:71468027-71468049 TAGTGGTGAAGCCTGGAGCCAGG + Intronic
1085204560 11:74723036-74723058 TGGAGGGCAAGACTGGAGGCAGG + Intronic
1085336995 11:75703871-75703893 TAGAGAGTCAGCCTGGAGACTGG - Intergenic
1085444154 11:76589599-76589621 TGGTGGGTAAGCCTCGTGGGAGG - Intergenic
1085489012 11:76896521-76896543 TAGTGAGAAAGCTTGGAGGGGGG - Intronic
1088289629 11:108222483-108222505 TATTGGGTAAGCGCGGACGCGGG - Exonic
1089518297 11:119047625-119047647 TAGATGCTAAGCCAGGAGGCAGG + Intronic
1090478566 11:127047260-127047282 TAGTGAGTAAGCGTGGTGCCTGG + Intergenic
1091382043 12:67944-67966 TAGAGGGGAATCCAGGAGGCCGG + Intronic
1092126436 12:6078091-6078113 TAGAGGGTAAGCCTAGTGGCCGG - Intronic
1092319210 12:7453335-7453357 AAGTGGGTGAGCCTGGTGTCAGG - Intronic
1093574298 12:20709051-20709073 TGGTGGGAAAGCTTGGAAGCAGG + Intronic
1095154645 12:38837610-38837632 TAATGGGTAAACAGGGAGGCTGG + Intronic
1096369773 12:51059278-51059300 TATGGCTTAAGCCTGGAGGCAGG - Intronic
1098414902 12:70222107-70222129 TAGTGGGGAAGGGTGGGGGCTGG - Intergenic
1098682897 12:73380540-73380562 TAGAGAGTAAGAGTGGAGGCAGG + Intergenic
1100937006 12:99680727-99680749 TAGTGGGTAGGCTTGTAGCCTGG + Intronic
1101440917 12:104703812-104703834 TAATGGGGAAACCTGGAGGAAGG - Intronic
1101824438 12:108209666-108209688 CAGTGGGGCAGCGTGGAGGCAGG - Intronic
1101878832 12:108612973-108612995 GAGAGGGAAAACCTGGAGGCAGG - Intergenic
1102903261 12:116655604-116655626 TAGTGGGTTTGCCTGGACCCAGG + Intergenic
1104530813 12:129569402-129569424 TACTTGCTAAGCCTGGTGGCAGG - Intronic
1105006396 12:132723503-132723525 AAGTGGGAAAGCTTGGAGGTGGG + Intergenic
1106721333 13:32437715-32437737 TAATGGGTAAGACTGAGGGCCGG + Intronic
1107922243 13:45221169-45221191 AAATGGGTAAGACTGGGGGCAGG - Intronic
1111403769 13:87775173-87775195 TGGTGAGTAAGCCTGGAGGTTGG - Intergenic
1114059724 14:19008027-19008049 GAGTGGGTGAGCTTGGTGGCTGG - Intergenic
1114102821 14:19393724-19393746 GAGTGGGTGAGCTTGGTGGCTGG + Intergenic
1125728942 15:41882245-41882267 TAGTGGGGAGGGGTGGAGGCGGG - Intronic
1125812530 15:42553754-42553776 TAGTGTGTAAGCATGGAGAGAGG + Intronic
1127142853 15:55994305-55994327 TAGAGGGTCAGCCTGGAGATTGG - Intergenic
1127541654 15:59945019-59945041 TTCTGGGAAAGCCTGGAGACTGG + Intergenic
1129602293 15:77007211-77007233 TGGAGGGAAGGCCTGGAGGCTGG + Intronic
1131563812 15:93467541-93467563 ATGTGAGTAAGCCTGGAAGCAGG - Intergenic
1132281162 15:100617193-100617215 GAGGGGGCAAGACTGGAGGCAGG - Intronic
1132362822 15:101231946-101231968 GAGAGTGTAGGCCTGGAGGCTGG - Intronic
1133880723 16:9779154-9779176 CAGTGGGAAAGCATGGAGCCTGG + Intronic
1134479303 16:14603688-14603710 GAGTGAGTAAGACTGGAGGCAGG - Intronic
1135434998 16:22420816-22420838 CAGTGGGGAAGCCTGGAGGGAGG + Intronic
1137447583 16:48541164-48541186 TAGTGGGTCAGCCAGGCTGCTGG + Exonic
1141284424 16:82658502-82658524 CAGTGGTTAAGACTGGAGTCAGG + Intronic
1144384951 17:14740812-14740834 CAGGGGGTGAGGCTGGAGGCAGG - Intergenic
1146669683 17:34728398-34728420 AACTGGGTAAAACTGGAGGCAGG + Intergenic
1146728489 17:35174483-35174505 TATTGGGAAAGCCTGGAGAAAGG + Intronic
1147455963 17:40538342-40538364 TGGTGGTTCAGCCTGGAGGGTGG + Intergenic
1148348444 17:46920567-46920589 TAGTAGATAAGCTTGGAGGATGG + Intergenic
1148698839 17:49576386-49576408 TGGCGGGGAAGACTGGAGGCTGG + Intronic
1148861289 17:50605659-50605681 CAGTGGGAAAGGGTGGAGGCGGG - Intronic
1149780183 17:59391313-59391335 TAGTGGGGGAGTCTGGAGGTGGG + Intronic
1149917876 17:60628281-60628303 TAGTGGGGAAGCCTGGGAGACGG - Intronic
1150478477 17:65491543-65491565 TAGTGGGTGAGGCTGGAGCTAGG - Intergenic
1151625716 17:75274317-75274339 GAGAGGGTGAGGCTGGAGGCAGG - Intronic
1157383671 18:47245405-47245427 TAGTGGGTAGGTGAGGAGGCTGG + Intronic
1159002828 18:62988479-62988501 AAGTGGGTGAGCCTGGAGGTTGG - Intergenic
1163171796 19:15536560-15536582 GAGAGGGTGAGGCTGGAGGCTGG + Intronic
1163866328 19:19776421-19776443 TGGTGCGTAACCCTGGAGGGAGG - Intergenic
1165064333 19:33220216-33220238 AAGTGGGTTAGGCTGGAGTCGGG - Intronic
1166050432 19:40255881-40255903 TAGAGGGTGAGGCTGGAGGTTGG + Intronic
1166126444 19:40717740-40717762 TTCTGGGTGAGTCTGGAGGCTGG - Exonic
1167077194 19:47257035-47257057 TAGTGGGGGAGCCAGGGGGCGGG + Intronic
927592714 2:24370582-24370604 TATAGGGTAAGCCTTGGGGCAGG + Intergenic
928408869 2:31038440-31038462 AACTCGGTAAGCCTGGAGCCTGG + Intronic
928518151 2:32063445-32063467 GAGTGGGAAAGCCGAGAGGCGGG + Intergenic
928880050 2:36087890-36087912 TAAAGGGAAAGTCTGGAGGCAGG - Intergenic
929583318 2:43098334-43098356 TAGTGGTTGAGCCTGGTTGCAGG + Intergenic
929961739 2:46502381-46502403 TAGTGGGTAAGCCTGGAGGCAGG + Intronic
930640098 2:53845592-53845614 TAGTGGCTACTCCTGGAGCCTGG + Intergenic
931323398 2:61194624-61194646 TAGTAGCTAAGACTGCAGGCTGG + Intronic
932855515 2:75229901-75229923 GAGTGGGCAAGACAGGAGGCAGG + Intergenic
940068245 2:149653960-149653982 AGGTGGGGAAGACTGGAGGCAGG - Intergenic
941866819 2:170344037-170344059 TAGTGGGGCAGCCTGAGGGCAGG - Intronic
948362488 2:237432851-237432873 TAGTGAGTAAGTGGGGAGGCAGG + Intergenic
1170045518 20:12081116-12081138 CAGTGGGTAAGCCCAGTGGCAGG - Intergenic
1170692494 20:18628228-18628250 AAGCAGGTAAGCCTGGAGTCTGG + Exonic
1170837251 20:19895022-19895044 TGGTGGGCAAGGCTGGAGGCAGG - Intronic
1170875059 20:20242962-20242984 TAGCTAGTAAGTCTGGAGGCAGG - Intronic
1171297546 20:24031851-24031873 TTTTGGGTAACCCCGGAGGCAGG + Intergenic
1172245456 20:33442878-33442900 CAGAGGGGAAGCCTGGAGTCTGG - Intronic
1174414824 20:50359794-50359816 GAGTGGGTGAGGCTGGAAGCAGG + Intergenic
1176283159 20:64326889-64326911 TAGAGGGGAATCCAGGAGGCCGG - Intergenic
1178481077 21:32979546-32979568 TGGTGTCTAAGGCTGGAGGCTGG - Intergenic
1179273563 21:39870030-39870052 CAGTGGGCAAGCCTGCTGGCTGG + Intronic
1180001379 21:44996998-44997020 TAGTGGGTGCCCCTGGAGGAAGG + Intergenic
1180478205 22:15730639-15730661 GAGTGGGTGAGCTTGGTGGCTGG - Intergenic
1181728570 22:24828183-24828205 TACTGGGTGGGGCTGGAGGCAGG + Intronic
1184406475 22:44303604-44303626 TACTGTCTCAGCCTGGAGGCTGG - Intronic
1185241377 22:49749377-49749399 TGGAAGGTGAGCCTGGAGGCAGG + Intergenic
1185370705 22:50459707-50459729 TGGGGCGTGAGCCTGGAGGCGGG - Intronic
950183768 3:10932790-10932812 GAGAGGGTGAGGCTGGAGGCAGG + Intronic
951339335 3:21465829-21465851 GAGTGGGTCAGCCTGCAGGAAGG - Intronic
954305197 3:49721948-49721970 CAGTGGGTAAGCCTGTGGGCTGG - Exonic
955873124 3:63460841-63460863 TTGGGGGCAAGGCTGGAGGCAGG + Intronic
961009192 3:123424638-123424660 TTCTGGGTAAGGCTGGAGGAAGG - Intronic
961039050 3:123664088-123664110 TCGTGGGTGAGTCTGGTGGCTGG - Exonic
961062282 3:123840266-123840288 AAATTGGTAAGCCTGTAGGCAGG + Intronic
961619178 3:128210061-128210083 GAATGGGTAAGACTGGAGGCAGG + Intronic
961661796 3:128472992-128473014 CAGGGCGTGAGCCTGGAGGCTGG + Intergenic
962502024 3:136004721-136004743 TAATGGTTAATCCTGGAGGAAGG + Intronic
963788678 3:149560880-149560902 TAGTGGGAAAGCTAGGTGGCTGG + Intronic
965044629 3:163560640-163560662 AAGTAGGTAAGCCTGCAGGTAGG + Intergenic
966777329 3:183554499-183554521 TAGTGGGAAGGCCTGAAGTCAGG - Intronic
968663318 4:1807749-1807771 AAGTGGGAAAGCCTGGAGGTGGG - Exonic
968839714 4:2994083-2994105 TAATCTGTAAGGCTGGAGGCTGG - Intronic
969123828 4:4931233-4931255 ATGTGGGGAACCCTGGAGGCTGG + Intergenic
971503947 4:27346294-27346316 TAGCTGGGAAGCCTGGAAGCTGG + Intergenic
974328145 4:60443314-60443336 TTGTGGTTAGGCCTGGAGCCTGG + Intergenic
975992223 4:80268563-80268585 AAGTGGGTAAGGCGGTAGGCTGG + Intronic
980773840 4:137414068-137414090 TAGTGGGTAACCTGGGAGTCTGG + Intergenic
981227009 4:142308921-142308943 TAGATGGTGAGCCTGGGGGCCGG - Intronic
983910357 4:173232209-173232231 TAGTGGGTAACACTGAAGCCAGG + Intronic
985764523 5:1769706-1769728 TTGTGGATAGGCCTGGAGGTGGG - Intergenic
986034229 5:3923018-3923040 GCTTGGGTAAGCCTGCAGGCTGG - Intergenic
986044633 5:4025231-4025253 TGCTAGGAAAGCCTGGAGGCTGG - Intergenic
986686751 5:10281618-10281640 TTGTGGGTTAGCATGGAGGTGGG + Intronic
990615301 5:57501509-57501531 TATTGAGTGAGCCTGGAGGAGGG + Intergenic
990758982 5:59107661-59107683 TAGAGGGTAAGAGTGGAGGGAGG + Intronic
991029793 5:62071044-62071066 TATTTGCTAAGGCTGGAGGCAGG - Intergenic
991921133 5:71658028-71658050 GACTAGGTAAGACTGGAGGCAGG - Exonic
994250496 5:97531376-97531398 TAATGGAAAAGGCTGGAGGCAGG + Intergenic
997029725 5:130112409-130112431 TAGTCAGTAAACCTGGAGTCTGG + Intronic
997475860 5:134142174-134142196 GGGTGGGTGAACCTGGAGGCAGG - Exonic
1000038148 5:157464454-157464476 TAGGGGACAAGCCTGGAGCCTGG + Intronic
1001436019 5:171699953-171699975 TAGGTGCTAGGCCTGGAGGCCGG + Intergenic
1001546371 5:172572954-172572976 TAGGGGGTCAGAATGGAGGCTGG + Intergenic
1001557552 5:172646929-172646951 CAGTGGGAAAGTCTGGAGGCGGG + Intronic
1001701371 5:173708945-173708967 GAGTGGGTGAGGATGGAGGCCGG - Intergenic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1002603912 5:180370832-180370854 CAGTGAGGAAGCCTGCAGGCAGG + Intergenic
1003187396 6:3844217-3844239 TTGTGACTAAGCCTGGAGGAGGG + Intergenic
1003317969 6:5028570-5028592 GAGAGGATAAGTCTGGAGGCAGG + Intergenic
1003397314 6:5764390-5764412 TAGTGGGTAGGGCTGGACTCGGG - Intronic
1003861338 6:10324844-10324866 TAGTGGTTAAGAATGGAGTCAGG + Intergenic
1006013969 6:31066021-31066043 AAGTGAGTAATCCTGGAGCCAGG - Intergenic
1006070307 6:31493884-31493906 AAGTGTGTTGGCCTGGAGGCTGG - Intergenic
1006856108 6:37134439-37134461 AAGGAGGTAAGGCTGGAGGCAGG - Intergenic
1007090188 6:39179402-39179424 CAGTGTGGGAGCCTGGAGGCTGG - Intergenic
1012171036 6:96016456-96016478 TAGTGTGGGAGCCTGGGGGCTGG - Intronic
1012445987 6:99307549-99307571 CAGTGGGGAGGTCTGGAGGCAGG + Intronic
1012770360 6:103425270-103425292 AGGTGCGTAAGCCTGGAGCCTGG - Intergenic
1013721818 6:113039531-113039553 TAGCAGGTAAGCCTGCAGGTAGG - Intergenic
1016944457 6:149515705-149515727 TAGTGGGTAAGTGAGGAAGCAGG - Intronic
1017783134 6:157732109-157732131 GTGTGGGAGAGCCTGGAGGCAGG + Intronic
1017881861 6:158567633-158567655 GAGTGGGCCAGCCTGGAGTCTGG + Intronic
1018469360 6:164082255-164082277 ACATGGGCAAGCCTGGAGGCTGG + Intergenic
1019515638 7:1438709-1438731 TGGAGGGAAAGCCTGGAGGAAGG - Intronic
1020347701 7:7182895-7182917 TGGTGGGGAAGCGTGGAGGATGG + Intronic
1022045138 7:26616844-26616866 TAGTGTGGAAGCCCCGAGGCAGG + Intergenic
1024701329 7:51907155-51907177 TTGTGGCTGAGGCTGGAGGCTGG - Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1039007812 8:33060262-33060284 TAGAGGGGAAGCATGGAGGTAGG + Intergenic
1044664919 8:94624933-94624955 TAATAGGTATGCCTGCAGGCTGG + Intergenic
1044918445 8:97142013-97142035 TAGTGGGTACCTCTGGAGGGAGG + Intronic
1045373571 8:101549483-101549505 TGGAGGCTGAGCCTGGAGGCTGG + Intronic
1047078851 8:121436819-121436841 TTCTGGGAAAGCCTGGAGGAAGG + Intergenic
1047286195 8:123489163-123489185 TAGTGGGTATGCCTCTAGGAAGG + Intergenic
1048950694 8:139494319-139494341 CAGTGGCCAAGCCTGGCGGCTGG - Intergenic
1050244497 9:3673617-3673639 TAGTAGGTAAGAGTGCAGGCAGG + Intergenic
1051501100 9:17778652-17778674 TAGGGGGCAAGCGTGGAAGCAGG + Intronic
1051568933 9:18533978-18534000 TAATGGGCAAGTTTGGAGGCAGG + Intronic
1051711506 9:19935182-19935204 TAGTAGGTCAGGCTGGAAGCTGG - Intergenic
1052786204 9:32830886-32830908 GGATGGGTAAGACTGGAGGCAGG + Intergenic
1052877181 9:33575814-33575836 GAGTGGGTGAGGCTGGTGGCTGG - Intergenic
1053802488 9:41773272-41773294 TTGTGGGTAAGCCAGGCTGCTGG + Intergenic
1054142749 9:61541798-61541820 TTGTGGGTAAGCCAGGCTGCTGG - Intergenic
1054190796 9:61984618-61984640 TTGTGGGTAAGCCAGGCTGCTGG + Intergenic
1054462500 9:65472948-65472970 TTGTGGGTAAGCCAGGCTGCTGG - Intergenic
1054647577 9:67603099-67603121 TTGTGGGTAAGCCAGGCTGCTGG - Intergenic
1058940269 9:109806970-109806992 AAGTGGGCAAGCGTGGAAGCAGG + Intronic
1060292245 9:122314730-122314752 TAGGGGGCAAGACTGGAGGCAGG + Intronic
1060637228 9:125208943-125208965 TAGGGGGTAAACTTGGAAGCAGG - Intronic
1194916887 X:99718105-99718127 TGGTGGGTGATCCTGGAGCCTGG - Intergenic
1195176045 X:102316446-102316468 TTGAGGGCAAGGCTGGAGGCAGG + Intronic
1195182819 X:102370647-102370669 TTGAGGGCAAGGCTGGAGGCAGG - Intronic
1197232969 X:124026435-124026457 GAGTGGGTTAGCCTGAGGGCTGG + Intronic
1197642075 X:128977981-128978003 TAGTCTGAAAGCCAGGAGGCTGG - Intergenic
1198375937 X:136040162-136040184 TACTTCGTAAGCCTGGGGGCTGG - Exonic
1199815839 X:151396410-151396432 GGGTGGGTAAGTCTGGAGTCAGG - Intergenic
1200691048 Y:6306489-6306511 TATGGGGTGAGCCAGGAGGCAGG + Intergenic
1201044224 Y:9868227-9868249 TATGGGGTGAGCCAGGAGGCAGG - Intergenic