ID: 929966894

View in Genome Browser
Species Human (GRCh38)
Location 2:46542965-46542987
Sequence TCAGCCCCAGCCCGCCTGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 272}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929966894_929966912 4 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966912 2:46542992-46543014 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914
929966894_929966913 5 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966913 2:46542993-46543015 GGGCCGGGGCGGGGGCTCCGGGG 0: 3
1: 4
2: 37
3: 217
4: 1422
929966894_929966904 -9 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966904 2:46542979-46543001 TGGGGCTGAGCCCGGGGCCGGGG 0: 1
1: 2
2: 13
3: 100
4: 1082
929966894_929966905 -6 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966905 2:46542982-46543004 GGCTGAGCCCGGGGCCGGGGCGG 0: 3
1: 0
2: 12
3: 134
4: 1005
929966894_929966907 -4 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
929966894_929966911 3 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG 0: 3
1: 4
2: 59
3: 473
4: 2369
929966894_929966920 25 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966894_929966915 7 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966915 2:46542995-46543017 GCCGGGGCGGGGGCTCCGGGGGG 0: 3
1: 1
2: 26
3: 133
4: 1098
929966894_929966903 -10 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966903 2:46542978-46543000 CTGGGGCTGAGCCCGGGGCCGGG 0: 1
1: 4
2: 14
3: 178
4: 1276
929966894_929966921 29 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966921 2:46543017-46543039 GACCATGCCCGGAGGCCGGCCGG 0: 4
1: 0
2: 0
3: 7
4: 114
929966894_929966914 6 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966914 2:46542994-46543016 GGCCGGGGCGGGGGCTCCGGGGG 0: 3
1: 3
2: 20
3: 213
4: 1517
929966894_929966908 -3 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
929966894_929966918 21 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966918 2:46543009-46543031 TCCGGGGGGACCATGCCCGGAGG 0: 4
1: 0
2: 0
3: 5
4: 71
929966894_929966906 -5 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966906 2:46542983-46543005 GCTGAGCCCGGGGCCGGGGCGGG 0: 3
1: 1
2: 32
3: 298
4: 1571
929966894_929966917 18 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966917 2:46543006-46543028 GGCTCCGGGGGGACCATGCCCGG 0: 4
1: 0
2: 0
3: 17
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929966894 Original CRISPR TCAGCCCCAGCCCGCCTGGG GGG (reversed) Exonic
900148341 1:1167826-1167848 GCAGCCCCTGCCTGCCTGGCGGG + Intergenic
900508124 1:3040147-3040169 TCAGCACCAGCACTGCTGGGTGG - Intergenic
900931894 1:5743054-5743076 ACAGAGCCAGCCCGGCTGGGTGG - Intergenic
901068720 1:6506787-6506809 TCACCCTCAGCCTGCCTGTGAGG + Intronic
901448030 1:9319905-9319927 CTAGCCCCAGACCTCCTGGGAGG + Intronic
901648025 1:10727106-10727128 TCAAGCCCAGCCCACCAGGGAGG + Intronic
901756475 1:11444385-11444407 TTAGCCCCAGGCTGCCTGGCTGG + Intergenic
902040499 1:13489015-13489037 TCAGCCCCACTCAGCCCGGGAGG - Intronic
902510933 1:16966564-16966586 TCAGCTCCTGCCCACCTGGCTGG - Exonic
903602649 1:24553896-24553918 TCAACCCCAGCCCCACTGGAAGG + Intergenic
904625627 1:31800287-31800309 TCGGCCCCAGCCTGCATGGCTGG - Intronic
904818253 1:33221307-33221329 TCAGCCCAAGCCTGCCTGATGGG - Intergenic
904969263 1:34406260-34406282 TCAGACTCAGCCTCCCTGGGTGG - Intergenic
905280588 1:36846579-36846601 ACAGCCCCAGCCTGTCTGGGAGG - Intronic
905452873 1:38068327-38068349 GCAGCTCCAGCCCGCAAGGGAGG - Intergenic
905872332 1:41412228-41412250 TCAGCCCCTGCTCACTTGGGAGG + Intergenic
906102230 1:43271008-43271030 CCAGCCCCCGCCCACCTCGGGGG + Intronic
906611755 1:47208705-47208727 TCAGCCAGAGCCCGGCTGGCTGG - Intergenic
906627150 1:47334300-47334322 TCCGCGCCCGCCCGCCTTGGGGG + Intronic
907272423 1:53298742-53298764 TCAGCCCCAGGGGGCCTGGCTGG - Intronic
911087387 1:93990216-93990238 TCTGCCCCAGCCGGCCTGCGGGG - Intergenic
915118222 1:153613247-153613269 TCAGCCCCTGCGGGGCTGGGAGG - Intergenic
915564374 1:156705665-156705687 TCCGCCCCCCCCCACCTGGGGGG + Intronic
916435128 1:164770994-164771016 TCACTCCCAGGCCTCCTGGGAGG + Intronic
920033103 1:203048995-203049017 CCAGCCCCGCCCAGCCTGGGAGG + Intronic
920556653 1:206909414-206909436 GCAGCCGCGGCCCGACTGGGCGG - Intronic
920912838 1:210233634-210233656 GCAGCCTCAGCCCGCCGAGGAGG - Intronic
921099531 1:211916390-211916412 TCTGCCCCAGCCCATCTGGAAGG - Intergenic
921472608 1:215567369-215567391 GCCGCCGCAGCCTGCCTGGGAGG - Intergenic
921850589 1:219928692-219928714 TCAGGCCCAGGCCGCGAGGGAGG - Intronic
922466252 1:225847034-225847056 CCAGCCTCAGGCCTCCTGGGGGG + Exonic
922573634 1:226647832-226647854 TAAGGCTCAGCCCACCTGGGTGG + Intronic
922747271 1:228051324-228051346 TCACCTCCAGGCTGCCTGGGAGG - Intronic
922792238 1:228316911-228316933 CCAGCCCCACCACGCCGGGGAGG + Exonic
922803622 1:228374964-228374986 CCAGCCCAAGGCAGCCTGGGCGG - Intronic
924775165 1:247111342-247111364 GCAGCCCCAGCGCGCGGGGGTGG + Exonic
1062857824 10:788216-788238 ACAGCCCCAGCCATCCTTGGAGG + Intergenic
1062895171 10:1097666-1097688 TCTGCCCCAGCATGCCTGGAGGG + Intronic
1063123344 10:3120061-3120083 TCAGCCGGCGCCCGCCTGGCAGG - Intronic
1063557679 10:7096599-7096621 TGAGCCCAAGGCCGCATGGGTGG + Intergenic
1064435989 10:15311661-15311683 GCCGCCCCACCCCACCTGGGAGG + Intronic
1067044422 10:42976286-42976308 TCAGCCCCAGCTCCTCTGGGAGG + Intergenic
1067439701 10:46301742-46301764 TCACCCACAGCCCGCCTTGAAGG + Intronic
1067473283 10:46550847-46550869 TCAGTCCCAGCCTGCCTGACTGG + Intronic
1067537478 10:47124342-47124364 TCTGCCCCAGCAGGCCTGGAGGG + Intergenic
1067581848 10:47451325-47451347 TCACCCACAGCCCGCCTTGAAGG + Intergenic
1071490862 10:86135463-86135485 TCAGCCCCATCCTCCCTGAGGGG + Intronic
1071566697 10:86674874-86674896 TCAGGAGCAGCCTGCCTGGGTGG - Intronic
1071978037 10:90975140-90975162 TCAGGCCAAGCCCAGCTGGGAGG + Intergenic
1072152162 10:92691800-92691822 TCACACCCAGCCCGCGGGGGCGG - Intronic
1072618206 10:97063499-97063521 TCGGGCCCAGCCAGCCTGCGTGG - Exonic
1072757384 10:98030239-98030261 TCACCCCCAGCCCGCGGGGGAGG + Intronic
1073185856 10:101614600-101614622 TCAGCCCCTGCCAGGCTGTGCGG - Intronic
1074085804 10:110208310-110208332 CCAGCCCCAGCCCGCCGGAGAGG - Intronic
1075721100 10:124587946-124587968 TCAGCCCCAGCTCCACCGGGTGG - Intronic
1076794454 10:132791856-132791878 TCAGCCTCAGCCCTGCTGCGGGG + Intergenic
1077038003 11:504475-504497 TCCGCCCGCCCCCGCCTGGGCGG - Intronic
1077229843 11:1453847-1453869 TCAGGCAGAGCGCGCCTGGGTGG - Intronic
1077335710 11:2002980-2003002 ACAGCCCGAGCACGCCTGGCTGG - Intergenic
1077423721 11:2464770-2464792 TCAGCCCCAGCCCACCTAGGAGG - Intronic
1077532355 11:3103215-3103237 TGAGCCCCTGCCAGCCAGGGAGG - Intronic
1077980455 11:7294667-7294689 TCAGTCCCAGTGAGCCTGGGGGG - Intronic
1078447798 11:11417616-11417638 TGAGCCCAAGCCCTCCTGAGAGG - Intronic
1080161085 11:29177276-29177298 TCAGCCCCAGTCCCAGTGGGAGG - Intergenic
1083538203 11:63491025-63491047 TCAGGCCCATCCCGCCTCTGCGG + Exonic
1083879197 11:65539935-65539957 TCCGCCCCACCCCACCTGCGCGG + Intronic
1083880584 11:65546521-65546543 GCAGCCCCTGCTCGCCTGGCTGG - Exonic
1083968736 11:66059340-66059362 TCAGGCCCAGCCCTCCTGGTGGG + Intronic
1083997781 11:66280613-66280635 TCAGCGCCAGGCAGCCTGGGGGG + Intronic
1084572284 11:69966834-69966856 TCAGGCCCTGCCCACCTTGGGGG - Intergenic
1084880976 11:72171681-72171703 CCATCCTCAGCCCACCTGGGAGG - Intergenic
1085304517 11:75477561-75477583 TGAGCCCCAGCAAGCCTGAGGGG - Intronic
1085402765 11:76244440-76244462 GCAGCCCGAGCCCTCCTGGGTGG + Intergenic
1085678571 11:78549116-78549138 TCAGCCCCAGTCCCACTTGGGGG + Intronic
1086061309 11:82702435-82702457 TCAGCCCCAGCCCACCCTGTGGG - Intergenic
1087855870 11:103091690-103091712 CCAGCCCCAGCCCGGCAGGCCGG + Intronic
1089313423 11:117574716-117574738 TCTGCCCCAGCCCTACTGTGGGG + Intronic
1089339584 11:117748510-117748532 TCAGCCCTGGCTCTCCTGGGTGG + Intronic
1090507848 11:127338564-127338586 TCACTCCCATCCAGCCTGGGTGG - Intergenic
1091252376 11:134154539-134154561 GCAGCCTCACCCCTCCTGGGTGG + Intronic
1202818694 11_KI270721v1_random:58162-58184 ACAGCCCGAGCACGCCTGGCTGG - Intergenic
1091635391 12:2193108-2193130 TAAGCCCCAGCACACCTGGCAGG - Intronic
1091673198 12:2467520-2467542 ACAACCCCAGGCTGCCTGGGTGG - Intronic
1092367922 12:7892320-7892342 TTAGACCCACCCCTCCTGGGGGG - Intergenic
1096284153 12:50283580-50283602 TCAGCCCGAGGCCGCACGGGAGG - Intergenic
1098149463 12:67531282-67531304 TCAGCCCCACCCAGGCTGTGAGG + Intergenic
1103191975 12:119009138-119009160 TCAGCTGCAGCGGGCCTGGGAGG - Intronic
1103699817 12:122843221-122843243 GCAGCCCAGGGCCGCCTGGGAGG + Intronic
1104133522 12:125916885-125916907 TCAGCCCCAGCCTGCCAGCCAGG + Intergenic
1104812875 12:131628955-131628977 TCAGCCCCACCCCGCTGGTGTGG - Intergenic
1106193627 13:27475259-27475281 TCAGCCCCAGCCCACCTGGCAGG + Intergenic
1107086464 13:36432050-36432072 TCAGCCCCACCTCGCCCGGGCGG + Intronic
1113415238 13:110123742-110123764 GCAGCCCCAGCCCGGCTGAGTGG - Intergenic
1113917717 13:113884222-113884244 TCTACCCCGGCCCGCCTTGGAGG - Intergenic
1116817903 14:49599909-49599931 TCAGCCTCAGCCCGCCTGGAGGG - Intronic
1118373157 14:65154671-65154693 TCTACCCCAGCCTACCTGGGAGG - Intergenic
1119131632 14:72178263-72178285 CCAGCCCCTGCCCTACTGGGTGG + Intronic
1119193752 14:72702180-72702202 TCAGCCCCAGGCCGTTGGGGTGG - Intronic
1119601393 14:75979396-75979418 TCAGCCCAGGCCCACCTGGGAGG - Intronic
1121585797 14:95062049-95062071 CCAGGCCCAGCCCACCTGAGGGG - Intergenic
1122509290 14:102253373-102253395 ACAGCCTCAGCCGGCCTCGGAGG + Intronic
1122716084 14:103697933-103697955 TCAGCCCTGGCCTGGCTGGGTGG - Exonic
1122813694 14:104301815-104301837 TCCGCCCCAGGCCGCATGGGCGG + Intergenic
1123787931 15:23690917-23690939 TCATCCCCAGCCTCCCTAGGGGG + Intergenic
1129204727 15:74030131-74030153 CCAGCCCCAGCTTGCCTGGGTGG + Intronic
1129461183 15:75700748-75700770 CCAGACCCAGCCCGCCAGGCTGG - Intronic
1130942688 15:88524200-88524222 CCACCGCCAGCCCGTCTGGGAGG + Intronic
1131179278 15:90229006-90229028 GCATCCCCAGCACCCCTGGGAGG - Exonic
1131854829 15:96582641-96582663 ACAGCCCCTGCCCGCCTGAGGGG + Intergenic
1132038718 15:98506751-98506773 TCAGCCCTTGGCTGCCTGGGGGG - Intronic
1132344328 15:101099298-101099320 TCAATCTCAGCCGGCCTGGGTGG - Intergenic
1132468316 16:88094-88116 TCAGCCCCACCCTGACTTGGGGG - Intronic
1132491581 16:234774-234796 TCCGCCCCCGCCCGCCCGGCTGG + Exonic
1132726036 16:1338751-1338773 CCTGCCCCAGCACCCCTGGGCGG + Intronic
1132906114 16:2283593-2283615 GCAGCAACAGCCCGCCTGAGAGG + Intronic
1132923126 16:2410405-2410427 TCAACCTCAGCCAGCCAGGGAGG + Intergenic
1135989451 16:27208845-27208867 AGAGCCCCAGCCTGCCAGGGTGG - Intronic
1136102121 16:28004029-28004051 GCAGCCCCAGCAGGCCTGGCTGG - Intronic
1137688448 16:50403012-50403034 TGTTCCCCAGCCCACCTGGGAGG + Intergenic
1139851296 16:69952667-69952689 GCAGCCCCAGCCGGGCTGGTGGG - Intronic
1139880276 16:70175579-70175601 GCAGCCCCAGCCGGGCTGGTGGG - Intronic
1140372234 16:74419938-74419960 GCAGCCCCAGCCGGGCTGGTGGG + Intronic
1141093702 16:81148109-81148131 TCAACCTCAGCTAGCCTGGGGGG - Intergenic
1141157773 16:81609359-81609381 TCAGTGCCAGCCCCCCTCGGCGG + Intronic
1141635062 16:85310191-85310213 CCTGACCCAGCCTGCCTGGGTGG + Intergenic
1141741840 16:85898840-85898862 TCCGCCCGAGCCGGCCTGGAAGG + Exonic
1141796930 16:86281312-86281334 TCAGACCCAGCCAGCCTGCATGG + Intergenic
1142211791 16:88811922-88811944 GCAGCCCGAGCGCGCCTGCGCGG + Exonic
1142339047 16:89508650-89508672 TAAGGCCCAGCCCGGCGGGGCGG + Intronic
1142398788 16:89848362-89848384 GGAGCCCCAGCCCACCTTGGGGG - Intronic
1142599012 17:1044028-1044050 TCAGGCCCAGCCCGCCAAGAAGG + Intronic
1143107902 17:4538542-4538564 CCAGCCCCAACCCGCTTTGGGGG + Exonic
1144099474 17:11931187-11931209 TCTGCCACACCACGCCTGGGTGG + Intronic
1144783785 17:17820797-17820819 TCAGCCCCAGCCTAGCTGTGGGG - Intronic
1146843962 17:36172195-36172217 TCACCCCCAGCTCCCCAGGGTGG + Intronic
1146856268 17:36260130-36260152 TCACCCCCAGCTCCCCAGGGTGG + Intronic
1146864351 17:36328245-36328267 TCACCCCCAGCTCCCCAGGGTGG - Intronic
1146872175 17:36384041-36384063 TCACCCCCAGCTCCCCAGGGTGG + Intronic
1146879537 17:36435126-36435148 TCACCCCCAGCTCCCCAGGGTGG + Intronic
1147067210 17:37928833-37928855 TCACCCCCAGCTCCCCAGGGTGG - Intronic
1147075061 17:37984665-37984687 TCACCCCCAGCTCCCCAGGGTGG + Intronic
1147078742 17:38008394-38008416 TCACCCCCAGCTCCCCAGGGTGG - Intronic
1147086586 17:38064211-38064233 TCACCCCCAGCTCCCCAGGGTGG + Intronic
1147094680 17:38132329-38132351 TCACCCCCAGCTCCCCAGGGTGG - Intergenic
1147102529 17:38188174-38188196 TCACCCCCAGCTCCCCAGGGTGG + Intergenic
1149537360 17:57443135-57443157 TCAGCCCCAGCCAGCCGGCTTGG - Intronic
1149773972 17:59342917-59342939 GAAGTCCCTGCCCGCCTGGGAGG + Intronic
1149847102 17:60014640-60014662 TCACCCCCAGCTCCCCAGGGTGG + Intergenic
1150085461 17:62271257-62271279 TCACCCCCAGCTCCCCAGGGTGG + Intergenic
1150294339 17:63999633-63999655 TCTGCCCCTGCCAGCCTGGATGG - Intronic
1151245346 17:72790220-72790242 ACACCCCCAGCCAGGCTGGGGGG + Intronic
1151313805 17:73310253-73310275 TCAGCCCCCGCCCGCTTCTGAGG - Intronic
1152569798 17:81116616-81116638 TCTGCCCCAGGACTCCTGGGTGG + Exonic
1154004244 18:10513153-10513175 TCAGCCTCAGCCAGGCTGGCAGG - Intergenic
1160592158 18:79951054-79951076 GCCGCCCCAGCCTCCCTGGGCGG - Intronic
1160766852 19:812641-812663 CCAGCCCCAGGCCGCCCGCGTGG + Exonic
1161112610 19:2478616-2478638 GCAGCCCCTGACCGCCTAGGCGG + Intergenic
1161353964 19:3809026-3809048 GCAGCCCCTGCCTGCCCGGGAGG + Intronic
1162299227 19:9834965-9834987 TAAGCTCTATCCCGCCTGGGTGG + Intergenic
1162735625 19:12745527-12745549 TCAGGCCCAGCCAGCAGGGGTGG + Intronic
1162739568 19:12766282-12766304 TGAGCCCCAGCGAGCCTGCGAGG - Intronic
1163566004 19:18051872-18051894 CCACCCCCAGCCCGCCCGGCGGG + Intergenic
1166106734 19:40601338-40601360 GCCGCCCCAGCCCGCCCGAGGGG - Intronic
1167374662 19:49104315-49104337 ACAGCCCCCTCCCGCCAGGGCGG - Intronic
1167390783 19:49193606-49193628 TCAGCCCCAGCCTCTCTGGGGGG - Intronic
1168514839 19:57002542-57002564 ACAGCCCGAGCCCGCCTCAGTGG - Intergenic
925277039 2:2657492-2657514 TCAGCCCCACCTCCCTTGGGTGG + Intergenic
926149159 2:10415190-10415212 TCTGCCCCAGGCCGCATGGAGGG + Intronic
928453404 2:31398594-31398616 TCAGCCCGAGCCCACCATGGAGG - Exonic
929556130 2:42926752-42926774 CCAGGCCCAGCCAGCCTGGAGGG - Intergenic
929966894 2:46542965-46542987 TCAGCCCCAGCCCGCCTGGGGGG - Exonic
932043095 2:68319969-68319991 TCAGCCTCCTCCCGCCTGGCTGG - Exonic
932307509 2:70714485-70714507 TGAGCCCCAGGCCCCCTGGCTGG - Intronic
934561408 2:95315424-95315446 TCGGCCCCAGCGCCCCTTGGAGG + Intronic
935102926 2:100014035-100014057 GCAGACCCAGCCAGCCAGGGGGG + Intronic
936249217 2:110854497-110854519 TCAGCCCCAGCCCCCAAGGAGGG + Intronic
938259910 2:129888141-129888163 ACAGCCCCAGCCCACCCAGGAGG + Intergenic
938455650 2:131460917-131460939 TCAGCCCCGGCCCGCCTGGGGGG - Intergenic
938972989 2:136449179-136449201 AGAGCCGCAGCCAGCCTGGGGGG - Intergenic
939008692 2:136819689-136819711 TCAGCCTCAGCTGGACTGGGGGG - Intronic
942346136 2:175004951-175004973 TGATCCCTAGCCCGCCTGGGAGG - Exonic
945168311 2:206969283-206969305 TCAGATCCAGCCCACCTGTGAGG + Exonic
946178896 2:217938238-217938260 GCAACCCCAGCCTCCCTGGGTGG + Intronic
946404400 2:219484732-219484754 GCAGCGCCACCCGGCCTGGGAGG + Exonic
947587822 2:231367466-231367488 CCAGCACCAGCTAGCCTGGGAGG - Intronic
947644232 2:231726494-231726516 ACAGCCCATGCCCACCTGGGTGG + Intergenic
948200940 2:236129295-236129317 TCTGCCCCAGCCCTGCTGTGGGG + Exonic
948913599 2:241018867-241018889 GCTGCCCCAGCCCGCCTGGTTGG - Intronic
1169226059 20:3857703-3857725 TCAGCGGCGGCCCGGCTGGGTGG + Exonic
1170387117 20:15831591-15831613 TCAGCCCCTGCCCAGCTTGGAGG + Intronic
1172039173 20:32031547-32031569 TCAGCCCCAGCCCGGCAGAGCGG - Exonic
1172282811 20:33720062-33720084 TCAGCCCCAGCCCGGCCCGACGG + Intronic
1172600568 20:36179911-36179933 GGAGCCCCAGCCTGGCTGGGAGG + Intronic
1172961819 20:38805593-38805615 TCAACCCCATCCGGCTTGGGAGG - Intergenic
1173328167 20:42052349-42052371 GCAGCCACAGCCAGTCTGGGTGG + Intergenic
1173662280 20:44742935-44742957 TCAGCCACAGCCTGGCTGGGAGG + Intergenic
1174053842 20:47785217-47785239 CCAGCCCCGGCTCACCTGGGCGG + Intronic
1174484942 20:50855178-50855200 TCACCCCCAGCCCTGCTTGGTGG + Intronic
1175218950 20:57406039-57406061 ACAGGCCAGGCCCGCCTGGGGGG - Intronic
1175652086 20:60734184-60734206 TCTGGCCCAACCGGCCTGGGTGG - Intergenic
1176078170 20:63258595-63258617 GCAGCCCCAGCCCGCCCGCAGGG + Intronic
1176265417 20:64206635-64206657 TCAACCCCAGCTCCCTTGGGGGG + Intronic
1178832690 21:36069939-36069961 TCAGCCCCGCCCCGCTAGGGCGG + Exonic
1178865037 21:36320212-36320234 TCCGCCGCAACCCGACTGGGAGG - Exonic
1179359233 21:40689961-40689983 TCAGCCCCAGCCAGTGTGGAGGG + Intronic
1179625288 21:42645808-42645830 TCAGCCCGGGGCCTCCTGGGAGG - Intergenic
1179658027 21:42857432-42857454 TCAGCACCAGCCGGCCTCAGAGG - Intronic
1180568502 22:16695469-16695491 GCAGCCCCCGCCCCCCTTGGTGG - Intergenic
1180891345 22:19291453-19291475 GCAGCCCCAGCCCAGGTGGGAGG + Intronic
1180891497 22:19291890-19291912 TCTGCCCCGTCCCGCCTGCGCGG + Intergenic
1180957124 22:19746111-19746133 TCGGCCTCAACCAGCCTGGGAGG + Intergenic
1182150020 22:28021299-28021321 ACAGCCCCAGCCAGCCAGTGAGG - Intronic
1182795142 22:32986438-32986460 TCAGCCCCAGTCCGTCTGCCAGG - Intronic
1183373476 22:37448849-37448871 TCCTCCCCTGCCCACCTGGGAGG - Intergenic
1183671221 22:39274055-39274077 TCAGCACCAGCCCTGCTGGGTGG + Intergenic
1183981757 22:41544539-41544561 GCAGCCCCGCCCCGCCTCGGCGG - Intronic
1184235759 22:43182261-43182283 TGAGCCCAAGCACGCATGGGCGG + Intronic
1185147404 22:49146856-49146878 TCTGCTCCAGCCTGTCTGGGTGG + Intergenic
1203296218 22_KI270736v1_random:45230-45252 TCAGCCCCAACTCGCCAGAGAGG - Intergenic
949477971 3:4466939-4466961 GCAGCCCCCACCCGCCTCGGAGG + Intronic
949871143 3:8590155-8590177 TGTGCCCCAGCCTGCCTGAGAGG + Intergenic
951719921 3:25687701-25687723 TCTGCCCCAGGCCTCCTGGGTGG + Intergenic
953467210 3:43133078-43133100 TCAGCCCCATCCCCCATGCGTGG + Intergenic
953845716 3:46424675-46424697 TCAGCCCCAGCTCTGCTGTGTGG - Intergenic
954876578 3:53806365-53806387 CCAGCCCCAGCCCCTCTAGGTGG - Intronic
956120516 3:65961346-65961368 TCAGCCCCTCCCTTCCTGGGTGG + Intronic
963043267 3:141084351-141084373 TCACCCTCATGCCGCCTGGGTGG + Intronic
963904616 3:150763212-150763234 CCAGTCCCCGCGCGCCTGGGCGG - Exonic
964630280 3:158802321-158802343 TCAGCCCCAACCCACCCGGCCGG - Intronic
965659679 3:171028411-171028433 TCAGCCCCGGCCTGCCGGCGCGG + Intergenic
967873592 3:194251633-194251655 CCAGCCCAAGGCCTCCTGGGCGG - Intergenic
968850592 4:3075048-3075070 TCAGCCACAGCCGGGCCGGGTGG - Exonic
968902965 4:3439792-3439814 TCACCCCCTGCCCTCCTGGCTGG - Exonic
969421053 4:7096015-7096037 TCAGCCACAGCCAGCCATGGTGG + Intergenic
969916344 4:10495346-10495368 TCAGCCCTAGCCAGCCAAGGAGG - Intronic
978888758 4:113796709-113796731 CCAGCACCACCCCGTCTGGGAGG + Intergenic
985475628 5:77313-77335 TCATCCCAAGCCAGCCAGGGAGG - Intergenic
986204888 5:5614094-5614116 GAAGCCCCAGCCCACCTGTGGGG - Intergenic
986337770 5:6767866-6767888 TAGGCCTCAGCCCGCATGGGGGG + Intergenic
986707290 5:10462459-10462481 TGAGCCTCAGCCCACATGGGTGG - Intronic
992166922 5:74061779-74061801 GCAGCCACAGCCCTGCTGGGAGG + Intergenic
992551221 5:77862151-77862173 CCAGCCCCAGCCCACCTCTGTGG + Intronic
992866272 5:80960378-80960400 GCCGCCCCAGCCCGCCGCGGGGG + Intergenic
997527618 5:134563542-134563564 TCAGCCCCAGCCCTGCTGTGTGG + Intronic
999144032 5:149380996-149381018 CCAGCCCCAGCCCCACTGGCCGG + Intronic
1001382063 5:171311659-171311681 TCCCCCGCAGCCCGCCTGGGGGG - Exonic
1002186641 5:177457788-177457810 TCAGCCCCAGTCCTGCTGGGTGG - Intronic
1002213085 5:177609838-177609860 CCAGCCCAAGCCTGCCTTGGCGG - Exonic
1004427523 6:15516516-15516538 CCAGCCCCGGCCCCCTTGGGCGG - Intronic
1004431686 6:15550794-15550816 GCAACACCAGCCTGCCTGGGAGG - Intronic
1005048945 6:21666311-21666333 GCAGCCCCAGCTCGCCTCGGAGG + Intergenic
1007760209 6:44128637-44128659 CAAGCCCCAGCCCCCCAGGGCGG - Intronic
1013538877 6:111087943-111087965 CCAGCCCCAGCCGCCCTCGGGGG - Exonic
1017737950 6:157381026-157381048 CCAGCCCCAGCCCCCTCGGGCGG - Intergenic
1018345973 6:162899622-162899644 TCAGCCTCACCCTGGCTGGGAGG - Intronic
1018901877 6:168055770-168055792 CCAGGACCAGCCTGCCTGGGGGG - Exonic
1019287935 7:232931-232953 GCAGCCCCAGCCTTCCTGAGAGG + Intronic
1019349949 7:549966-549988 TCAGCCTCATCTCCCCTGGGGGG + Exonic
1019539780 7:1546441-1546463 CCAGCCCCGGCCAGCCTGTGTGG + Exonic
1019759734 7:2801519-2801541 CCAGCTCCAGCCTGCTTGGGCGG - Intronic
1019965951 7:4498804-4498826 TCAGCCCCAGGCTACCTGAGTGG - Intergenic
1020008152 7:4793039-4793061 TTAGCACCAGCTGGCCTGGGCGG - Intronic
1022015601 7:26346139-26346161 CCAGCCCCAGCCTGACTGGCTGG + Intronic
1022527769 7:31049560-31049582 TCAGCTGCTGCCCGCCTGGCTGG + Intergenic
1023969157 7:44978721-44978743 TCAGCCCCATCTGGTCTGGGTGG + Intronic
1024058723 7:45682719-45682741 TCTACCCTAGCCAGCCTGGGTGG - Intronic
1027229149 7:76262063-76262085 TAACCCCCAGCCCTCCTGGGTGG - Intronic
1027600284 7:80231880-80231902 TCAGCCCCAGCCAGTCTGTATGG + Intergenic
1029358453 7:100070467-100070489 TCAGCCCCAGGACAACTGGGGGG + Exonic
1029459105 7:100685300-100685322 ACAGCCCCAGCGCACCCGGGAGG + Intronic
1029483757 7:100827322-100827344 TCAGCCCCCGCCACCCGGGGCGG - Exonic
1032402028 7:131630219-131630241 TCACCCCCACCCCACCAGGGGGG - Intergenic
1034830676 7:154305075-154305097 CCAGCCCCAGCCCGGCTGAGCGG + Intronic
1035721955 8:1798921-1798943 GCAGCCCCAGCCCAGCTCGGAGG - Intergenic
1035790013 8:2296029-2296051 ACAGCCACAGCCAGCCTGGATGG + Intergenic
1035802792 8:2425676-2425698 ACAGCCACAGCCAGCCTGGATGG - Intergenic
1035972294 8:4262629-4262651 TCAGCCCCAGGCTAACTGGGTGG - Intronic
1036220897 8:6921031-6921053 ACAGCCACAGCCCACCTCGGGGG + Intergenic
1036562182 8:9906718-9906740 CCTCCCCCACCCCGCCTGGGCGG + Intergenic
1037995018 8:23345779-23345801 TCAGCCCCAGCCGGGCTCAGTGG + Intronic
1045796434 8:106050552-106050574 TCAGCCCCAAACCATCTGGGAGG - Intergenic
1046946447 8:119978644-119978666 TCAGCCCCCTCCCAGCTGGGTGG + Intronic
1047754735 8:127909774-127909796 TCAGCCCCAGAGCGCCTGCATGG - Intergenic
1049285853 8:141774851-141774873 TCCTCTCCAGCCAGCCTGGGTGG + Intergenic
1049637674 8:143697706-143697728 TCACCCCACCCCCGCCTGGGTGG - Intronic
1049741354 8:144242537-144242559 GCAGCCCCAGCTCCCCTGCGTGG - Intronic
1052883821 9:33624087-33624109 TCTGCCTCGGCCTGCCTGGGTGG - Intergenic
1052990671 9:34517799-34517821 TCAGCCCCAGGCCCCCTGCCTGG - Intronic
1057777353 9:98021756-98021778 TTAGCCCCAGACAGCCTGGCAGG + Intergenic
1057888091 9:98846269-98846291 TCAGTCCCAGTGAGCCTGGGGGG + Intronic
1058110872 9:101029507-101029529 TCAACCCCCGCCCGGGTGGGAGG - Intronic
1059329111 9:113524044-113524066 TCAGGCTGAGCCCGCCTGGAGGG - Intronic
1059392045 9:114005514-114005536 TCAGGCCCAGCTGGCCAGGGAGG + Intronic
1060518979 9:124283175-124283197 TCATCCCCAGCCTTCCTGAGAGG - Intronic
1060807531 9:126587026-126587048 TCACCCCTAGCCCTCCTGGGGGG - Intergenic
1062105940 9:134754840-134754862 CCTGCCCCAGCCTGTCTGGGTGG - Intronic
1062120426 9:134831145-134831167 CCAGCCCCAGCCTCCCTGGGTGG + Intronic
1062309926 9:135930113-135930135 TCAGCCTCAGCCCAGCTGTGGGG - Intergenic
1062606813 9:137352187-137352209 TCAGCCTCAGTCGCCCTGGGAGG + Exonic
1062685634 9:137811631-137811653 TCAGCGCCAGCCCGCGCTGGGGG - Intronic
1062710624 9:137973296-137973318 TCAGGCCCAGCCCGGCTGTCAGG - Intronic
1185471962 X:389349-389371 TCAGGCCCTGCCAGCCTTGGGGG - Intergenic
1189443445 X:41058234-41058256 CCACCCCCATCCCGCCTGTGAGG - Intergenic
1192118593 X:68433940-68433962 TCCCCACCACCCCGCCTGGGAGG + Intergenic
1195668403 X:107450081-107450103 TCCGCCCCGGGCCGGCTGGGGGG + Intergenic
1198727373 X:139691871-139691893 CCAGCCCGAGGCCGCCGGGGAGG + Intronic