ID: 929966895

View in Genome Browser
Species Human (GRCh38)
Location 2:46542966-46542988
Sequence CTCAGCCCCAGCCCGCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 2, 2: 1, 3: 40, 4: 384}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929966895_929966917 17 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966917 2:46543006-46543028 GGCTCCGGGGGGACCATGCCCGG 0: 4
1: 0
2: 0
3: 17
4: 156
929966895_929966906 -6 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966906 2:46542983-46543005 GCTGAGCCCGGGGCCGGGGCGGG 0: 3
1: 1
2: 32
3: 298
4: 1571
929966895_929966920 24 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966895_929966915 6 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966915 2:46542995-46543017 GCCGGGGCGGGGGCTCCGGGGGG 0: 3
1: 1
2: 26
3: 133
4: 1098
929966895_929966911 2 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG 0: 3
1: 4
2: 59
3: 473
4: 2369
929966895_929966905 -7 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966905 2:46542982-46543004 GGCTGAGCCCGGGGCCGGGGCGG 0: 3
1: 0
2: 12
3: 134
4: 1005
929966895_929966914 5 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966914 2:46542994-46543016 GGCCGGGGCGGGGGCTCCGGGGG 0: 3
1: 3
2: 20
3: 213
4: 1517
929966895_929966918 20 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966918 2:46543009-46543031 TCCGGGGGGACCATGCCCGGAGG 0: 4
1: 0
2: 0
3: 5
4: 71
929966895_929966912 3 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966912 2:46542992-46543014 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914
929966895_929966913 4 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966913 2:46542993-46543015 GGGCCGGGGCGGGGGCTCCGGGG 0: 3
1: 4
2: 37
3: 217
4: 1422
929966895_929966921 28 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966921 2:46543017-46543039 GACCATGCCCGGAGGCCGGCCGG 0: 4
1: 0
2: 0
3: 7
4: 114
929966895_929966907 -5 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
929966895_929966908 -4 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
929966895_929966904 -10 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966904 2:46542979-46543001 TGGGGCTGAGCCCGGGGCCGGGG 0: 1
1: 2
2: 13
3: 100
4: 1082

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929966895 Original CRISPR CTCAGCCCCAGCCCGCCTGG GGG (reversed) Exonic
900142180 1:1143323-1143345 CCCAGCCCCACACTGCCTGGGGG + Intergenic
900148340 1:1167825-1167847 AGCAGCCCCTGCCTGCCTGGCGG + Intergenic
900229662 1:1550274-1550296 CTCCACGCCAGCCCGGCTGGGGG + Intronic
900401930 1:2476226-2476248 CCCAGCTCCAGCCCAGCTGGTGG - Intronic
900647218 1:3714432-3714454 CTCACCCCCACCCTGACTGGTGG - Intronic
900659273 1:3774707-3774729 CCAAGCCCCAGCCCTCCTAGAGG + Intronic
901006085 1:6172118-6172140 CTCAGCCTAGGCCAGCCTGGGGG - Intronic
901081485 1:6586473-6586495 CTCAGGCCCAGACAGACTGGGGG - Intronic
901187762 1:7386117-7386139 CACAGCCCCAGCCCGCTGGAAGG + Intronic
901301520 1:8203086-8203108 CTCAGCCCCAGGTGGCCTAGTGG + Intergenic
901521234 1:9786752-9786774 CCCAGCCATAGACCGCCTGGTGG - Intronic
901615509 1:10536328-10536350 CCCAGCCCCAGTCCCCCTGTAGG - Intronic
901652550 1:10751637-10751659 CTCTTCCCCAGCCTGCCCGGTGG - Intronic
901800722 1:11706518-11706540 CTCAGCCTCTGGCAGCCTGGAGG - Exonic
902122755 1:14181692-14181714 CTCTCCCCCAGCCTGTCTGGTGG + Intergenic
902242560 1:15098775-15098797 ATCTGCCCCAGTCCACCTGGAGG - Intronic
902876394 1:19343246-19343268 CTGATCCCCTGCCCACCTGGGGG - Intronic
903007478 1:20308367-20308389 CTCAGCTCCAGTCCACCTTGGGG - Intronic
903264998 1:22152846-22152868 CACAGTCCCTGCCCTCCTGGAGG - Intergenic
903386955 1:22933265-22933287 TTCAGCCCCTTCCCACCTGGGGG - Intergenic
904042658 1:27593414-27593436 CTGGGTCCCAGCCTGCCTGGGGG - Intronic
904171422 1:28594145-28594167 CCCAGCCTTAGCCCACCTGGTGG + Exonic
904619516 1:31766843-31766865 CTCTGCCCCAGGCTCCCTGGAGG - Intergenic
904818254 1:33221308-33221330 TTCAGCCCAAGCCTGCCTGATGG - Intergenic
905037744 1:34929151-34929173 CCCAGCCCTCGCCCGGCTGGAGG - Intronic
905512125 1:38530026-38530048 GTCAGCACCTGCCTGCCTGGTGG + Intergenic
905512136 1:38530083-38530105 GTCAGCACCTGCCTGCCTGGTGG + Intergenic
905512143 1:38530112-38530134 GTCAGCGCCGGCCTGCCTGGTGG + Intergenic
905512154 1:38530169-38530191 GTCAGCTCCTGCCTGCCTGGTGG + Intergenic
905512162 1:38530198-38530220 GTCAGCACCTGCCTGCCTGGTGG + Intergenic
905512175 1:38530256-38530278 GTCAGCTCCTGCCTGCCTGGTGG + Intergenic
905512181 1:38530285-38530307 GTCAGCTCCTGCCTGCCTGGTGG + Intergenic
905512202 1:38530401-38530423 GTCAGCTCCCGCCTGCCTGGTGG + Intergenic
905512234 1:38530572-38530594 GTCAGCTCCTGCCTGCCTGGTGG + Intergenic
905626155 1:39491689-39491711 CGCAGCCACAGCCGGACTGGTGG + Exonic
906203438 1:43974576-43974598 CTCCGCCCCAGTGCGCCTGTTGG - Intronic
906524441 1:46486040-46486062 GACATCCCCTGCCCGCCTGGAGG + Intergenic
909562794 1:77024557-77024579 ATGCTCCCCAGCCCGCCTGGAGG - Intronic
911087388 1:93990217-93990239 TTCTGCCCCAGCCGGCCTGCGGG - Intergenic
915236357 1:154486026-154486048 CTCAGCCTCAGCACGGCTGATGG + Exonic
915471565 1:156128860-156128882 GGAAGCCCCAGCCAGCCTGGGGG + Intronic
915564373 1:156705664-156705686 CTCCGCCCCCCCCCACCTGGGGG + Intronic
915749772 1:158195703-158195725 CTCAGCCTCAGCCTTCCTGTCGG + Intergenic
915911365 1:159917688-159917710 CTCACCCCAAGCCCGCCTGAGGG + Intergenic
916888629 1:169095340-169095362 CTCAGCCCCAGCATGCCAGCTGG - Intergenic
917072692 1:171169461-171169483 CTCAGCCCCAGGCCTGCTGCAGG - Intergenic
919536072 1:198789284-198789306 CCCACCCCCAGCAGGCCTGGAGG - Intergenic
920284150 1:204867832-204867854 CTCAGCCCATGGCTGCCTGGTGG + Intronic
920338384 1:205259860-205259882 CTCAGCCCACGCACACCTGGGGG - Intronic
922416664 1:225428230-225428252 CCCCGCCCCACCCTGCCTGGGGG + Intronic
922466250 1:225847033-225847055 CCCAGCCTCAGGCCTCCTGGGGG + Exonic
923017282 1:230136636-230136658 CTCAGACCCAGCGCTCCTGAAGG - Intronic
924425058 1:243943128-243943150 CTGAGCCCCAGCCTCCCGGGTGG + Intergenic
924560636 1:245154693-245154715 CCCAGCCCCAGCCCGGCTCCAGG + Intergenic
1062796983 10:352013-352035 CTCAGCCCCCGCCCCGCTGAGGG + Intronic
1062895170 10:1097665-1097687 CTCTGCCCCAGCATGCCTGGAGG + Intronic
1063032485 10:2249631-2249653 CTCTGCTCCAGCCTGCCTAGAGG + Intergenic
1063100249 10:2944338-2944360 CACAGACCCAGGCAGCCTGGTGG + Intergenic
1065800185 10:29344793-29344815 CTAAGCTCCTGCCCTCCTGGGGG + Intergenic
1067429404 10:46233243-46233265 CTCAGCCACAGCCCCCCAGGTGG + Intergenic
1067527363 10:47046716-47046738 CTCAGCCGCTGCCCTCCCGGAGG + Intergenic
1067537477 10:47124341-47124363 CTCTGCCCCAGCAGGCCTGGAGG + Intergenic
1067580050 10:47439073-47439095 TTCAGCACCAGCCAGCCTGCCGG - Intergenic
1068940019 10:62671383-62671405 CTCAGCCCCAGCCTGCTTCTGGG + Exonic
1069744333 10:70705414-70705436 CTGAGCCCCAGCCCGGCTGGCGG - Intronic
1069920185 10:71811644-71811666 CTCAGGCCCTGCCTGCCTCGTGG - Intronic
1070819860 10:79348261-79348283 CTCAGGCCCCGGCCACCTGGTGG + Intronic
1071333729 10:84585274-84585296 CCCGGACCCAGCCTGCCTGGAGG - Intergenic
1071490861 10:86135462-86135484 CTCAGCCCCATCCTCCCTGAGGG + Intronic
1071501332 10:86206332-86206354 AGCAGCCCCAGCTCGCCTGCCGG + Intronic
1073136952 10:101225484-101225506 CCCCGCCCCAGCCGGCCTTGGGG + Intergenic
1074188153 10:111114576-111114598 CTGAGTCACAGCCTGCCTGGCGG + Intergenic
1075129072 10:119723146-119723168 CCCTCCCCCAGCCTGCCTGGAGG - Intergenic
1075309830 10:121404926-121404948 CTGAGTTCCAGCCCTCCTGGAGG + Intergenic
1075506240 10:123024972-123024994 CTCAGTCCCAGCTATCCTGGAGG + Intronic
1075716319 10:124557828-124557850 CTCAGCCCAAGACCCCCAGGTGG - Intronic
1076569154 10:131421041-131421063 CTCAGGCCCTGCCCTCCTGTTGG + Intergenic
1076781589 10:132727687-132727709 CTCACCCTCAGCCTCCCTGGTGG + Intronic
1076794453 10:132791855-132791877 CTCAGCCTCAGCCCTGCTGCGGG + Intergenic
1076812731 10:132897741-132897763 CTCAGACCCAGGCTTCCTGGGGG + Intronic
1077033088 11:479006-479028 CTCAGCCCCAGGCCGGCTCCTGG - Intronic
1077099994 11:818469-818491 CCCTGCCCCAGCCCTACTGGGGG - Intergenic
1077251742 11:1563788-1563810 CCCAGCCCCAGCCCCACTGCTGG + Intronic
1077579080 11:3405227-3405249 CCCAGGCCCAGCCCTCCTGCAGG - Intergenic
1077980456 11:7294668-7294690 CTCAGTCCCAGTGAGCCTGGGGG - Intronic
1079127807 11:17731222-17731244 CAGAGCCTCAGCCCTCCTGGTGG - Intergenic
1083440412 11:62672299-62672321 CTCGGCCCTGGCCCGCCTTGCGG - Exonic
1083651357 11:64206646-64206668 CCCAGCGCCAGCCCGCCCTGGGG + Intergenic
1083713197 11:64561127-64561149 TTCAGACTCAGCCGGCCTGGAGG + Intronic
1083968735 11:66059339-66059361 GTCAGGCCCAGCCCTCCTGGTGG + Intronic
1083997780 11:66280612-66280634 GTCAGCGCCAGGCAGCCTGGGGG + Intronic
1084236102 11:67788746-67788768 CCCAGGCCCAGCCCTCCTGCAGG - Intergenic
1084275210 11:68047812-68047834 CCGGGCCCCAGCCCGGCTGGGGG + Intronic
1084422264 11:69066306-69066328 CTCAGCCCAAGCCAGAGTGGAGG - Intronic
1084491284 11:69479988-69480010 CTGAGCACCCGCCCGCCTTGTGG - Intergenic
1084593982 11:70106314-70106336 CACAGCCCCAGCTTGGCTGGTGG - Intronic
1084661784 11:70550394-70550416 CCCTGCCCCAGCCCACCTGGGGG - Intronic
1084836299 11:71804244-71804266 CCCAGGCCCAGCCCTCCTGCAGG + Intergenic
1085273434 11:75283624-75283646 CTCACTACCAGCCCTCCTGGTGG - Intronic
1085678570 11:78549115-78549137 CTCAGCCCCAGTCCCACTTGGGG + Intronic
1086061310 11:82702436-82702458 ATCAGCCCCAGCCCACCCTGTGG - Intergenic
1087027185 11:93661491-93661513 GCCAGCCCCAGCCTGCCTAGGGG - Intergenic
1088728514 11:112660125-112660147 ATCAGGCCCAGCCTGCATGGTGG + Intergenic
1088797035 11:113273285-113273307 CTCAGCCCAAGCGCCCCTGCTGG + Intronic
1089313422 11:117574715-117574737 CTCTGCCCCAGCCCTACTGTGGG + Intronic
1089622642 11:119730268-119730290 CTCTGCTCCTGCCCGCCTAGAGG - Intergenic
1089889800 11:121869682-121869704 GTCAGGCCAGGCCCGCCTGGTGG + Intergenic
1091201951 11:133787832-133787854 CACGGCCCCAGCCCGCCCTGCGG - Intergenic
1091443498 12:529253-529275 CTCAGCCCCACCTCTCCTGTTGG + Intronic
1091664957 12:2412178-2412200 CACAGCCCCAGCCCCACTGCAGG + Intronic
1091762676 12:3097513-3097535 CTCAGCCCCATTCCTCCTTGTGG - Intronic
1092117480 12:6019542-6019564 CTCAGCCTCGGACAGCCTGGAGG + Exonic
1092355271 12:7789362-7789384 CTTAGACCCACCCCTCCTGGCGG - Intronic
1092367923 12:7892321-7892343 CTTAGACCCACCCCTCCTGGGGG - Intergenic
1092407010 12:8228110-8228132 CCCAGGCCCAGCCCTCCTGCAGG - Intergenic
1092905966 12:13101138-13101160 CCCGGCCCCAGCCGGCCTGCTGG - Intronic
1096472420 12:51888052-51888074 CTCAGGCCCCGCCCACCCGGAGG + Exonic
1096576988 12:52558987-52559009 TTCAGCCCCAGCCAGCCGGATGG + Intergenic
1096660247 12:53119629-53119651 CACAGCCCCAGCCTATCTGGGGG + Intronic
1096720249 12:53516028-53516050 TTCAGACTCAGCCCTCCTGGAGG - Exonic
1098425945 12:70366176-70366198 CTCCGCCCCGCCCCGCCCGGGGG - Intergenic
1099437262 12:82659483-82659505 CGCAGCCCGCGGCCGCCTGGTGG - Intergenic
1102689864 12:114751861-114751883 CTCAGCAGCAGCCTGGCTGGTGG + Intergenic
1102880756 12:116482746-116482768 CTCAGACCCAGCCCTCCCGCAGG + Intergenic
1103740193 12:123085948-123085970 CTCAGCCCCTGCCTGCCCTGTGG - Intronic
1104613835 12:130252582-130252604 ATCAGCTCCACCCCACCTGGGGG + Intergenic
1104750069 12:131232750-131232772 CTCAGCCTCATCCTGGCTGGAGG - Intergenic
1104782645 12:131431710-131431732 CTCAGCCTCATCCTGGCTGGAGG + Intergenic
1105801040 13:23903571-23903593 CTGAGTCCCAGCGCGGCTGGGGG + Intergenic
1111919665 13:94396818-94396840 CACTGCCCCAGACTGCCTGGAGG - Intronic
1113397654 13:109963575-109963597 CTAAGCCCTACCCCGCCTTGCGG - Intergenic
1113992396 14:16037969-16037991 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1114648407 14:24268397-24268419 CCCGGCACCAGCCCTCCTGGCGG + Exonic
1116817904 14:49599910-49599932 CTCAGCCTCAGCCCGCCTGGAGG - Intronic
1116828280 14:49693140-49693162 CACAACCCCTGCCCGCCCGGCGG - Exonic
1117013493 14:51494485-51494507 CTCTGCCCCAGTGTGCCTGGAGG - Intronic
1117446143 14:55805472-55805494 CTCGTCCCCAGCCCAGCTGGAGG + Intergenic
1118752378 14:68816547-68816569 CTCTGCCCCGGCCGGCCTGCCGG + Intergenic
1118883534 14:69848717-69848739 CTCAGGCCCAGCTCCACTGGAGG - Intergenic
1120935598 14:89892472-89892494 CCCAGCCTTAGCCCACCTGGTGG + Intronic
1121168780 14:91836178-91836200 CTCACCTCCAGCCCGCAAGGCGG + Intronic
1121242327 14:92439781-92439803 CCCACCCCCACCCCGCCAGGGGG + Intronic
1121618932 14:95332700-95332722 ATCAGCCCCTGCCCGCATGGTGG + Intergenic
1122125604 14:99576938-99576960 CTCGCCCCCAGGCTGCCTGGGGG + Intronic
1123433317 15:20236588-20236610 CTCAGCCCTAGCCCCCTTGCAGG + Intergenic
1123787930 15:23690916-23690938 CTCATCCCCAGCCTCCCTAGGGG + Intergenic
1125514225 15:40308900-40308922 CTCCGCCCCAGCCCCGCTGCAGG - Intergenic
1128757011 15:70190043-70190065 CCCAGCCCCTGCCCTCCAGGGGG - Intergenic
1129458082 15:75686385-75686407 CCCCGCCCCACCCCTCCTGGAGG + Intronic
1129459645 15:75694108-75694130 TTCAGCCTCAGCCTGCGTGGTGG - Intronic
1129467191 15:75730825-75730847 CACAGCCTCAGACCTCCTGGAGG - Intergenic
1129720037 15:77872894-77872916 CACAGCCTCAGACCTCCTGGAGG + Intergenic
1131854828 15:96582640-96582662 CACAGCCCCTGCCCGCCTGAGGG + Intergenic
1132038719 15:98506752-98506774 CTCAGCCCTTGGCTGCCTGGGGG - Intronic
1132855727 16:2043848-2043870 CTCAGCCCCCGCCCCCCAGGAGG + Intronic
1132942596 16:2515341-2515363 CCCTGCCCCACCCTGCCTGGTGG + Intronic
1133347682 16:5081307-5081329 CCCAGGCCCAGCCCTCCTGCAGG - Intronic
1136383290 16:29907018-29907040 CCCAGACCCAGCCCTCCTGGAGG - Exonic
1136775844 16:32871427-32871449 GGTAGCCCCAGCCTGCCTGGGGG + Intergenic
1136851306 16:33614535-33614557 CTCAGCCCTAGCCCCCTTGCAGG - Intergenic
1136866937 16:33766665-33766687 CTCAGGCCCTGCCTCCCTGGCGG + Intergenic
1136894772 16:33990085-33990107 GGTAGCCCCAGCCTGCCTGGGGG - Intergenic
1136911777 16:34149876-34149898 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1139207676 16:65044957-65044979 CTGAGCTCCAGCCTCCCTGGTGG + Intronic
1139440652 16:66964991-66965013 CTCTGCCCCAGGCAGCATGGTGG + Intronic
1139549864 16:67667166-67667188 CTGTGCCCCTCCCCGCCTGGAGG - Intronic
1139644700 16:68319883-68319905 CTCATCCCGACCCCGCCTGAGGG + Intronic
1139851297 16:69952668-69952690 CGCAGCCCCAGCCGGGCTGGTGG - Intronic
1139880277 16:70175580-70175602 CGCAGCCCCAGCCGGGCTGGTGG - Intronic
1140372233 16:74419937-74419959 CGCAGCCCCAGCCGGGCTGGTGG + Intronic
1141093703 16:81148110-81148132 CTCAACCTCAGCTAGCCTGGGGG - Intergenic
1141424092 16:83934404-83934426 CCCAGCCCCAGCCCCCCTCGGGG + Intronic
1142148323 16:88501870-88501892 ATCAACCCCAGCCCGCGAGGGGG + Intronic
1142205406 16:88780437-88780459 CTCTGCCTTAGCCTGCCTGGAGG - Intronic
1142283031 16:89159449-89159471 CTGAGCACCAGCCCGTCTGAGGG + Intergenic
1142319828 16:89373939-89373961 CAGGGCCCCAGCCCGCTTGGTGG - Intronic
1203078260 16_KI270728v1_random:1133536-1133558 GGTAGCCCCAGCCTGCCTGGGGG + Intergenic
1203105225 16_KI270728v1_random:1349537-1349559 CTCAGGCCCTGCCTCCCTGGCGG - Intergenic
1203112908 16_KI270728v1_random:1462996-1463018 CTCAGCCCTAGCCCCCTTGCAGG - Intergenic
1203128289 16_KI270728v1_random:1612831-1612853 CTCAGGCCCTGCCTCCCTGGCGG + Intergenic
1143387442 17:6540083-6540105 CTCTGCCCCAGACCTCCTGCTGG - Intronic
1143627323 17:8118028-8118050 CGCAGCAGCAGCCGGCCTGGAGG + Exonic
1143648674 17:8248935-8248957 CTCAAACACAGCCCGCCTGGTGG + Intronic
1144737528 17:17563399-17563421 CTCAGCCCCACCTCGCAGGGAGG + Intronic
1144775705 17:17783592-17783614 CTCTGCCCCAGCCGGGCTGCAGG + Intronic
1144783786 17:17820798-17820820 CTCAGCCCCAGCCTAGCTGTGGG - Intronic
1144784376 17:17823687-17823709 CCCAGCCCCGCCCCGCCTGCAGG + Intronic
1145970070 17:28951172-28951194 CTCAGTCCCGGCCCGGCTGCTGG + Exonic
1146266696 17:31457692-31457714 CTCACCCCCAGCCCCGCAGGTGG + Intronic
1147019562 17:37520720-37520742 CTCACCCCCAGCAGGCCTAGCGG + Intronic
1148862156 17:50610045-50610067 TTCAGCCCCTGCCCTCTTGGGGG - Intronic
1150255610 17:63741885-63741907 CTCCGCCCCACCCCGCCCTGCGG + Intronic
1151245345 17:72790219-72790241 CACACCCCCAGCCAGGCTGGGGG + Intronic
1151408920 17:73907759-73907781 CCCAGCCCCAGCCCACCTCCTGG - Intergenic
1151945354 17:77316593-77316615 CTCTGACCCAGCCTGGCTGGCGG - Intronic
1152341495 17:79728346-79728368 CTCAGGCCCTGCCTCCCTGGCGG + Intergenic
1152605317 17:81286636-81286658 CCCAGCCCCTGCCAGGCTGGAGG + Intronic
1152635477 17:81428977-81428999 CTCAGGCCACCCCCGCCTGGAGG - Intronic
1153417260 18:4860477-4860499 CTCAACCCCAGCTCACCTGATGG + Intergenic
1153576066 18:6523161-6523183 CTCACCCACAGACCACCTGGTGG + Intronic
1156482590 18:37445518-37445540 CTCAGCCCCAGGCTGTCTGGCGG - Intronic
1157275699 18:46309938-46309960 AGCATCCCCAGGCCGCCTGGGGG + Intergenic
1160065214 18:75567702-75567724 CACAGCCCCCGCCCCCCAGGTGG + Intergenic
1160221997 18:76984626-76984648 CTGAGCCCCTGCACGCCTGCTGG + Intronic
1160672224 19:371151-371173 CCGGGTCCCAGCCCGCCTGGCGG + Intronic
1160685546 19:434850-434872 CTCCGGCCCTGCCAGCCTGGGGG + Exonic
1160913182 19:1484058-1484080 CTCGGCCTCAGCCCCACTGGCGG - Exonic
1161206920 19:3046429-3046451 CCCATCCCCAGCCCGGTTGGGGG - Intronic
1161356782 19:3823465-3823487 CTCCACCCCATGCCGCCTGGCGG - Intronic
1162312456 19:9914917-9914939 CTCAGCCCCAGGCCGCCGCCTGG - Intronic
1162402985 19:10457403-10457425 CTTGGCACCAGCCTGCCTGGGGG - Intronic
1162782294 19:13012581-13012603 CCCAACCCCCGCGCGCCTGGGGG - Intronic
1162797710 19:13095300-13095322 GTCACCCCCTGCCCGCCTGGGGG - Exonic
1162930623 19:13955817-13955839 CTCAGCCCCAGCCCTGATGAGGG + Intronic
1162936385 19:13983647-13983669 CTAAGCCTGAGCCCCCCTGGAGG + Intronic
1163322229 19:16581544-16581566 CCCAGACCCAGCTAGCCTGGTGG + Intronic
1163419147 19:17204439-17204461 CTCAGACCCAGCCTGGCTAGCGG - Intronic
1163448288 19:17360592-17360614 CACAGACCCAGCTAGCCTGGAGG - Exonic
1163566002 19:18051871-18051893 CCCACCCCCAGCCCGCCCGGCGG + Intergenic
1163566507 19:18055015-18055037 CTCAGTCCCATCCCGGCTGAAGG + Intergenic
1164670667 19:30070379-30070401 CTCAGTGCCAGCCCAGCTGGAGG + Intergenic
1165029520 19:32987648-32987670 CTCAGCCCTAGCCCCCTTGCAGG + Intronic
1165060875 19:33204701-33204723 AGCAGCCCCACCCCGCCAGGAGG + Exonic
1165388412 19:35525006-35525028 CGCAGCCCCAGTCACCCTGGAGG - Intronic
1165939272 19:39407193-39407215 CTCAGACCGAGGCTGCCTGGAGG + Intronic
1166106735 19:40601339-40601361 CGCCGCCCCAGCCCGCCCGAGGG - Intronic
1166690875 19:44820706-44820728 CTCAGCCCTGGCTCCCCTGGCGG - Exonic
1166887783 19:45972495-45972517 CTCTGCCACAGCCCCCTTGGGGG + Intronic
1167176675 19:47869173-47869195 CTCTCCCCCATCCCACCTGGAGG - Intergenic
1167390784 19:49193607-49193629 CTCAGCCCCAGCCTCTCTGGGGG - Intronic
1168350890 19:55675001-55675023 GTCAGCTCCAGCTCGCTTGGCGG - Intergenic
1168643103 19:58042852-58042874 CTCAGCCACAGCGGCCCTGGTGG - Intronic
925538519 2:4941409-4941431 CTCCACCCCAGTCCACCTGGCGG + Intergenic
926149158 2:10415189-10415211 TTCTGCCCCAGGCCGCATGGAGG + Intronic
927491369 2:23523217-23523239 CTCTGCCCCAGCCCACCCTGGGG - Intronic
927709048 2:25313992-25314014 CGCAGCCCCAGCCTGCCTCCCGG - Exonic
928192939 2:29190381-29190403 CCCAGCCCCACCTCACCTGGGGG + Intergenic
928998757 2:37324901-37324923 CTCGGCCCGCGCCCGCCGGGAGG + Intergenic
929556132 2:42926753-42926775 CCCAGGCCCAGCCAGCCTGGAGG - Intergenic
929966895 2:46542966-46542988 CTCAGCCCCAGCCCGCCTGGGGG - Exonic
930024173 2:47020383-47020405 CTCAGCCTCAGCCGGCCAGGTGG - Intronic
931103195 2:59025414-59025436 CTCAGCCCTAACCAGCCTAGTGG - Intergenic
932214650 2:69958916-69958938 ATCAGCCCCAGGGCACCTGGAGG - Intergenic
932368154 2:71166306-71166328 CTGAGCCCCAGTCAGCCTGGAGG - Intergenic
932667470 2:73708636-73708658 CCCCGCCCCAGCTCTCCTGGTGG - Intergenic
932715789 2:74100179-74100201 CCCAGCCCCAGCCCCACTGGGGG - Intronic
935311080 2:101784096-101784118 CTCAGCCGCAGCCACCATGGTGG + Intronic
936067792 2:109345124-109345146 TACAGCCCCAGGCTGCCTGGTGG + Intronic
936249216 2:110854496-110854518 TTCAGCCCCAGCCCCCAAGGAGG + Intronic
936286375 2:111184501-111184523 CCCAGCCCCAGCCCTCCTCCAGG + Intergenic
936515941 2:113181676-113181698 CTCAGCCCAAGCCCTCATGAAGG - Intronic
937069438 2:119051838-119051860 CTCAGCCCCAGCCCTTCTGCGGG - Intergenic
937937736 2:127259546-127259568 CCCAGGCCCAGCCACCCTGGTGG + Intronic
938455651 2:131460918-131460940 CTCAGCCCCGGCCCGCCTGGGGG - Intergenic
938539322 2:132273351-132273373 CTCAGCCTCAGCCAGCCTCTGGG + Intergenic
938972990 2:136449180-136449202 CAGAGCCGCAGCCAGCCTGGGGG - Intergenic
942271788 2:174282687-174282709 CTGAGCCACAGCCTGCTTGGAGG - Intergenic
942481773 2:176395659-176395681 CTCAGACCCAGCTGCCCTGGAGG + Intergenic
944643855 2:201757684-201757706 CTCAGCCCTAAACAGCCTGGTGG - Exonic
945381323 2:209145224-209145246 CTCAGCCCCAGCCAGCCATGGGG + Intergenic
946839294 2:223804207-223804229 CTCAGCCACTGCCTGGCTGGTGG - Intronic
947765203 2:232633484-232633506 CTCAGCGACTGCCAGCCTGGTGG - Exonic
948171341 2:235906077-235906099 GTCAGCCACAGCCCCCTTGGAGG - Intronic
948378593 2:237538224-237538246 CGCAGGCCCCGCCCTCCTGGGGG - Intronic
948836912 2:240630338-240630360 CACGGCCGCAGCCTGCCTGGGGG - Exonic
1169042821 20:2509622-2509644 CTCAGCCTCAGCCTCCCTCGGGG - Intronic
1171257103 20:23697773-23697795 CTAAGCCCCAGCCCATCTGCAGG - Intergenic
1171274260 20:23842278-23842300 CTAAGCCCCAGCCCATCTGCAGG - Intergenic
1171769451 20:29311176-29311198 CTCAGCCGCAGCCAGCCTCTGGG + Intergenic
1171907098 20:30908217-30908239 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1171978169 20:31608523-31608545 CCCAGACCCAGCCCATCTGGAGG + Intergenic
1172875224 20:38160076-38160098 CCCTGCCCCTGCCCTCCTGGTGG - Intronic
1173250993 20:41364220-41364242 CACAGCCCCAGCCCTCCCTGTGG + Intronic
1173812372 20:45963889-45963911 CTCAGGCCCAGGACACCTGGTGG - Exonic
1173864886 20:46307560-46307582 CTCACCGCCAGCCCGCCCGACGG + Intronic
1174330229 20:49812192-49812214 CTCAGCCCCAGTCCTCCCGATGG + Intergenic
1175218951 20:57406040-57406062 CACAGGCCAGGCCCGCCTGGGGG - Intronic
1176078169 20:63258594-63258616 AGCAGCCCCAGCCCGCCCGCAGG + Intronic
1176265416 20:64206634-64206656 CTCAACCCCAGCTCCCTTGGGGG + Intronic
1176384934 21:6134566-6134588 CTCAGAACCACCCTGCCTGGAGG + Intergenic
1176551800 21:8226360-8226382 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1176570709 21:8409359-8409381 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1176578618 21:8453506-8453528 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1178530093 21:33368858-33368880 CTCAGCCCCAGGCCTGCTGCTGG - Intergenic
1178915298 21:36702497-36702519 CTCAGCCCCAGACTGACTGAGGG - Intronic
1179010586 21:37553043-37553065 CCCAGGCCCAGGCCGCCTCGAGG - Intergenic
1179359232 21:40689960-40689982 CTCAGCCCCAGCCAGTGTGGAGG + Intronic
1179474096 21:41632301-41632323 ATGAGCGCCAGCCCGCATGGAGG + Intergenic
1179738538 21:43403686-43403708 CTCAGAACCACCCTGCCTGGAGG - Intergenic
1179881453 21:44294875-44294897 CTCACCCCCAGCCCTCCCTGGGG + Intronic
1179896417 21:44366065-44366087 TTCAGACACAGCCCGCCTAGCGG + Intronic
1180314875 22:11269548-11269570 CTCAGCCGCAGCCAGCCTCTGGG + Intergenic
1180340504 22:11614155-11614177 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1180568917 22:16697955-16697977 CTCAGCCTCGGACAGCCTGGAGG + Intergenic
1180951985 22:19724595-19724617 CTCAGACCCACCCCACCTGCAGG + Exonic
1181014899 22:20063257-20063279 TCTAGCCCCAGCCCACCTGGTGG - Intronic
1181078982 22:20401399-20401421 GCCAGCCCCAGCACCCCTGGTGG + Intronic
1181513736 22:23400241-23400263 CTCAACCCTGGCTCGCCTGGTGG - Intergenic
1181639751 22:24190307-24190329 CTCAGCCCCACCATGCCTGGAGG - Intergenic
1182076725 22:27500004-27500026 CTCAGGCCCAGATCTCCTGGGGG + Intergenic
1182300057 22:29332137-29332159 CTCTGCCCCAGCCTGGCTGCAGG + Intronic
1183414906 22:37676435-37676457 CCCAGCCACAGCCCGACTGCAGG + Intronic
1183483804 22:38078693-38078715 CTCCTCCCCAGGCCGCCTGGTGG - Exonic
1183490196 22:38111817-38111839 CCCAGCCCCAGCCTCCCTGAGGG - Exonic
1183739535 22:39662290-39662312 CCCACCCCCGGGCCGCCTGGAGG + Exonic
1184004761 22:41699891-41699913 CTCAGCCCCAGGCCGGCCTGCGG + Intronic
1184502106 22:44880496-44880518 CTCTGCCTGAGCCCTCCTGGGGG - Intergenic
1184562209 22:45269614-45269636 CCCAGCCCCATCCCGGCCGGGGG - Intergenic
1185102548 22:48849389-48849411 CCCAGCCCCGGACAGCCTGGAGG - Intronic
1203256822 22_KI270733v1_random:143282-143304 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
950008051 3:9704107-9704129 CCCAGCCCCAGCCAGCCGCGGGG + Intronic
950046051 3:9949231-9949253 CTCAGCGCCAGCCCTCTTGGGGG + Exonic
950429698 3:12943775-12943797 CTCTGCTCCAGGCCGCCTGCTGG - Intronic
951825131 3:26859857-26859879 CTCCGCCCCAGTCCTCCTGGAGG + Intergenic
952203892 3:31159738-31159760 ATCAGCCCCATCCTGCCTTGAGG + Intergenic
952963610 3:38607896-38607918 CTCAGTCCCAGCCCACCTTCAGG + Intronic
952969379 3:38641324-38641346 ATCATCCCCATCCCTCCTGGAGG + Intronic
954849487 3:53588359-53588381 CTCAGACCCAGCCCTGCTTGTGG + Intronic
955769249 3:62372553-62372575 CTCCGCCGCCGCCCGCCCGGAGG + Exonic
956748569 3:72328956-72328978 CCCAGCCCCAGACCTGCTGGAGG + Intergenic
959591862 3:108090778-108090800 CTGCGCCCCAGCCAGCCCGGCGG - Intronic
961412969 3:126736324-126736346 CTCAGGACCAACCCTCCTGGAGG - Intronic
961464417 3:127072676-127072698 CTGAGCCCAAGACCCCCTGGAGG - Intergenic
961501314 3:127338022-127338044 CGCAGCTGCCGCCCGCCTGGCGG - Intergenic
964830137 3:160874953-160874975 CTCAGCCCCAGCCTTCCAGCTGG + Intronic
966362970 3:179149062-179149084 CTCCGGCCCCGCCAGCCTGGCGG + Intronic
966679784 3:182629721-182629743 CCCAGGCCCAGGCCCCCTGGAGG + Intergenic
968572979 4:1352118-1352140 CTGAGCCCCAGCCTGGCTGAAGG + Intronic
968582720 4:1402484-1402506 CTGAGCCTCAGCCAGCTTGGCGG + Intergenic
968601891 4:1513406-1513428 CGCTGCCGCAGCCCGCCTGGAGG + Intergenic
968761236 4:2443573-2443595 CGCAGCCCCAGCCAGCATGTAGG - Intronic
968872410 4:3248590-3248612 CTAAGGCCCAGGGCGCCTGGGGG + Exonic
968994870 4:3938920-3938942 CCCAGGCCCAGCCCTCCTGCAGG - Intergenic
969417139 4:7068204-7068226 CTCAGGCCCCGCCCACCGGGGGG - Intergenic
969759133 4:9169874-9169896 CCCAGGCCCAGCCCTCCTGCAGG + Intergenic
969819096 4:9707354-9707376 CCCAGGCCCAGCCCTCCTGCAGG + Intergenic
971288434 4:25312642-25312664 CGCAGTCCCCGCCCACCTGGGGG - Intergenic
981745916 4:148052267-148052289 CTCAACCCCAGCACTCCTTGAGG + Intronic
982249315 4:153388721-153388743 CTCAGCCCCAGGCCTGCTGCTGG + Intronic
985538663 5:477933-477955 CTCAGACCCCACCCGCCTGATGG + Intronic
988532063 5:32036625-32036647 CTCAGCCCCAGGCACCCTGGAGG - Intronic
990777950 5:59324379-59324401 CTCAGCCCCAGCCACCATGAGGG + Intronic
997228346 5:132226336-132226358 CACAGCCCCAGCCCTCTTGTAGG - Intronic
997527759 5:134564439-134564461 CTCATCCCCAGCCTGCCTCCAGG - Intronic
997661137 5:135590387-135590409 CCCGGCCCCAGCCAGCCTGCAGG + Intergenic
997667951 5:135647583-135647605 CTCAGCCCCCAGCCTCCTGGAGG + Intergenic
997690383 5:135824102-135824124 CCCAGCCCCAGCCTCCCTGCAGG - Intergenic
999305311 5:150515739-150515761 CTCAGCCCCAGCTGTCCTTGAGG + Intronic
1001382064 5:171311660-171311682 TTCCCCCGCAGCCCGCCTGGGGG - Exonic
1001948211 5:175797430-175797452 CCTAGGCCCAGCCCGCCTAGCGG - Intronic
1001959449 5:175871584-175871606 CGCGGCTCCAGCTCGCCTGGCGG + Intronic
1003963297 6:11229368-11229390 CTCAGGCCCAGCCCGGGCGGGGG - Intronic
1006235962 6:32632765-32632787 ATAAGCCTCAGCCCGCCTGCCGG + Intronic
1006851640 6:37102790-37102812 CTCCGCCCAGGCCCGCCTTGCGG + Intergenic
1007428057 6:41759860-41759882 CTCAGCCCCAGCCCCCGTCATGG - Intergenic
1007483789 6:42166893-42166915 CTCGGCCCCATTCCGCCAGGTGG + Intronic
1014137858 6:117908340-117908362 CTCCGCCCCGCCCCGCCCGGGGG + Intronic
1015914958 6:138206688-138206710 CTCACACCCAGCACACCTGGGGG - Intronic
1018542601 6:164898613-164898635 CTCAGTCCCAGCCAGTCTGGAGG - Intergenic
1018768446 6:166952317-166952339 CTCACACACAGCCCTCCTGGAGG + Intronic
1019159850 6:170062591-170062613 CACAGAGCCAGCCAGCCTGGAGG + Intergenic
1019276910 7:180468-180490 CTCGGCCTCAGCCTCCCTGGGGG + Intergenic
1019349948 7:549965-549987 CTCAGCCTCATCTCCCCTGGGGG + Exonic
1019376085 7:692884-692906 CTCAGCCCCCTCCAGCCTGCAGG - Intronic
1019395904 7:817332-817354 CCTCGCCCCAGCCTGCCTGGAGG + Intronic
1019738660 7:2662374-2662396 CTCAGCACCTGCCCTGCTGGAGG + Exonic
1020007366 7:4789784-4789806 CTCAGCCCCACCCCCACTGCAGG - Intronic
1020319132 7:6927243-6927265 CCCAGGCCCAGCCCTCCTGCAGG - Intergenic
1022898934 7:34782355-34782377 CTCAGCTCCAGCTTCCCTGGTGG + Intronic
1023570830 7:41569708-41569730 CTCAGCCCCAGACCTGCTTGGGG - Intergenic
1024984359 7:55182537-55182559 CCCAGCAACAGCCTGCCTGGTGG - Intronic
1026307782 7:69156799-69156821 CTCAGCATCAGCACCCCTGGAGG - Intergenic
1026513900 7:71049955-71049977 CTCAGCCAGAGCCTGCCTGGAGG - Intergenic
1027539600 7:79452309-79452331 CTCACCCCTAGCCAGCCCGGGGG - Intronic
1029228497 7:99046903-99046925 CTCAGGCCCAGCCCTCGCGGTGG + Intronic
1029460616 7:100692105-100692127 CCCAGCCCCAGGCCTGCTGGAGG + Intergenic
1031992273 7:128206272-128206294 CTCAGCTCAAGCCCACCAGGAGG + Intergenic
1034421627 7:150993840-150993862 CCCAGCCCCAGGCCGCAGGGTGG - Exonic
1034529035 7:151684048-151684070 CTCAGCTCCAGCGGCCCTGGAGG - Intronic
1035273840 7:157735796-157735818 CTCAGCCACTGCCTGCCAGGAGG - Intronic
1035379671 7:158429653-158429675 CTCAGCTCCAGACCGCCAGCAGG + Intronic
1036847382 8:12179087-12179109 CCCAGGCCCAGCCCTCCTGCAGG - Intergenic
1036868747 8:12421408-12421430 CCCAGGCCCAGCCCTCCTGGAGG - Intergenic
1037675104 8:21044256-21044278 CATTGCCCCAGCCTGCCTGGTGG - Intergenic
1039274442 8:35919955-35919977 CTAAACCCCAGCCCACCTTGTGG + Intergenic
1042876967 8:73448950-73448972 CCCAGCCCCAGCCGGGCTGCAGG - Intronic
1043611756 8:82072754-82072776 CTCAACCTCAGCCAGCCTGAAGG - Intergenic
1045252761 8:100495260-100495282 CTGAGACCCAGCCTGCCTGCGGG + Intergenic
1045547372 8:103140806-103140828 CGCAGCCCCGGCCCGCAAGGAGG - Exonic
1046260279 8:111758818-111758840 CGCAGCCCCAGCCTCCCTGATGG - Intergenic
1048164321 8:132048903-132048925 CTCAGCCTCAGGCCCCCTGCAGG - Intronic
1049205479 8:141361632-141361654 CACTGCCCCCGCCAGCCTGGAGG + Intronic
1049576217 8:143391151-143391173 CTCCCCCCCCGCCCACCTGGAGG + Intergenic
1049674341 8:143883107-143883129 CTCATCCCCAGCAGGCCTGGAGG - Intergenic
1049712734 8:144073405-144073427 CTCAGGCCCCTCCCACCTGGAGG + Intergenic
1053430929 9:38041299-38041321 CACAGCCCCCGCCTGACTGGTGG - Intronic
1056413384 9:86354192-86354214 CTCAGCCTCTGCCGGCCTGGGGG + Intronic
1056852495 9:90096259-90096281 CTGAGTCACAGCCCCCCTGGGGG - Intergenic
1057039095 9:91834364-91834386 CTCAACACCAGCCCTGCTGGAGG + Intronic
1057888090 9:98846268-98846290 CTCAGTCCCAGTGAGCCTGGGGG + Intronic
1057904698 9:98974731-98974753 CTCAGCCCCGGCCCCCCAGTGGG + Intronic
1058362487 9:104165505-104165527 CTCAGTCCTAGCCCTGCTGGTGG + Intergenic
1059329112 9:113524045-113524067 GTCAGGCTGAGCCCGCCTGGAGG - Intronic
1060004953 9:119991795-119991817 CTCAGCCACAGCTCTCCTGCAGG + Intergenic
1060406346 9:123374911-123374933 CCCAGCCTCAGCCCGCCTGTGGG + Intronic
1060555656 9:124506063-124506085 CTGGGCTCCCGCCCGCCTGGAGG + Intronic
1060555867 9:124506965-124506987 CTCAGACCCACACAGCCTGGTGG + Intronic
1060807532 9:126587027-126587049 ATCACCCCTAGCCCTCCTGGGGG - Intergenic
1061237838 9:129352481-129352503 CTCAACCCCAGCCGCTCTGGGGG - Intergenic
1061725587 9:132580476-132580498 CTCACCCCCAGCCCGGCCGGCGG + Intergenic
1061808501 9:133149268-133149290 CCCCGCCCCAGCCCGCCCGCAGG + Intronic
1062010328 9:134263610-134263632 CTCAGGACCAGGCCACCTGGAGG + Intergenic
1062030725 9:134360798-134360820 CCCAGCTTCAGCCTGCCTGGGGG - Intronic
1062292659 9:135803965-135803987 CACAGCCCCAGCCAGGCTTGTGG + Intergenic
1062483362 9:136762612-136762634 CTGAGCCCCAGCCGGCGCGGTGG + Intronic
1203472979 Un_GL000220v1:124964-124986 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1203363183 Un_KI270442v1:235561-235583 CTCAGCCGCAGCCAGCCTCTGGG + Intergenic
1185469432 X:373779-373801 CCCGGCCCCAGAGCGCCTGGCGG - Intronic
1185471963 X:389350-389372 CTCAGGCCCTGCCAGCCTTGGGG - Intergenic
1187698116 X:21940920-21940942 CCCCGCCCCAGCCCGCCAGGCGG - Intronic
1190117894 X:47637848-47637870 CTCAGCCCGAGCCTGCTAGGTGG - Exonic
1192247853 X:69388283-69388305 CACAGCCCCAGGCTGCTTGGTGG - Intergenic
1200051082 X:153432137-153432159 CACAGCCCCAGCGCTCCTGAGGG - Intergenic
1200059312 X:153477183-153477205 CTCTGGCACAGCCAGCCTGGAGG - Intronic
1200120691 X:153788919-153788941 CTCGGCTGCAGCCAGCCTGGAGG - Intronic
1200215996 X:154368532-154368554 CTCAGCCCCAGCCCCACTCCAGG - Intronic
1201075144 Y:10181228-10181250 CTCAGCCGCAGCCAGCCTCTGGG - Intergenic
1201424286 Y:13831645-13831667 CGCAGCCCCAGCCTCCCTGACGG + Intergenic