ID: 929966896

View in Genome Browser
Species Human (GRCh38)
Location 2:46542967-46542989
Sequence GCTCAGCCCCAGCCCGCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 2, 1: 1, 2: 1, 3: 50, 4: 346}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929966896_929966914 4 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966914 2:46542994-46543016 GGCCGGGGCGGGGGCTCCGGGGG 0: 3
1: 3
2: 20
3: 213
4: 1517
929966896_929966911 1 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG 0: 3
1: 4
2: 59
3: 473
4: 2369
929966896_929966907 -6 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
929966896_929966918 19 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966918 2:46543009-46543031 TCCGGGGGGACCATGCCCGGAGG 0: 4
1: 0
2: 0
3: 5
4: 71
929966896_929966908 -5 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
929966896_929966913 3 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966913 2:46542993-46543015 GGGCCGGGGCGGGGGCTCCGGGG 0: 3
1: 4
2: 37
3: 217
4: 1422
929966896_929966906 -7 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966906 2:46542983-46543005 GCTGAGCCCGGGGCCGGGGCGGG 0: 3
1: 1
2: 32
3: 298
4: 1571
929966896_929966920 23 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966896_929966915 5 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966915 2:46542995-46543017 GCCGGGGCGGGGGCTCCGGGGGG 0: 3
1: 1
2: 26
3: 133
4: 1098
929966896_929966905 -8 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966905 2:46542982-46543004 GGCTGAGCCCGGGGCCGGGGCGG 0: 3
1: 0
2: 12
3: 134
4: 1005
929966896_929966917 16 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966917 2:46543006-46543028 GGCTCCGGGGGGACCATGCCCGG 0: 4
1: 0
2: 0
3: 17
4: 156
929966896_929966921 27 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966921 2:46543017-46543039 GACCATGCCCGGAGGCCGGCCGG 0: 4
1: 0
2: 0
3: 7
4: 114
929966896_929966912 2 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966912 2:46542992-46543014 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929966896 Original CRISPR GCTCAGCCCCAGCCCGCCTG GGG (reversed) Exonic
900372073 1:2336606-2336628 GCTCTGCTCCAACCCCCCTGGGG + Intronic
900414666 1:2529488-2529510 GCCGCGCACCAGCCCGCCTGCGG - Exonic
900466826 1:2829854-2829876 GCCCAGGCCCAGGCTGCCTGGGG + Intergenic
900638853 1:3678785-3678807 GCCCTGCCCCAGCCCCACTGTGG + Intronic
901006086 1:6172119-6172141 GCTCAGCCTAGGCCAGCCTGGGG - Intronic
901678752 1:10901427-10901449 GCTCAGGCCCCGCCCCCCAGGGG + Intergenic
902276760 1:15345547-15345569 GCTGAGCCCCAGTCGGCTTGAGG + Intronic
902362250 1:15948265-15948287 GCTCAGCCCCAGCCCTGACGGGG + Intronic
902626231 1:17677984-17678006 GCTCACCCGCAGCCCCCATGAGG - Intronic
902983606 1:20142308-20142330 GCTCTGCCCCCTCCAGCCTGTGG + Intronic
903522179 1:23959363-23959385 GCGCAGCCCCCTCCCGCCTCGGG - Intronic
903649367 1:24913647-24913669 GCTGGGCCCCAGCCAGTCTGGGG + Intronic
903694034 1:25194537-25194559 GCTCAGACTCAGCCCTGCTGGGG + Intergenic
904138642 1:28334141-28334163 GCTCATCTCCAGCAGGCCTGGGG - Intronic
904339403 1:29824476-29824498 CCTCAGCCGCACCCAGCCTGGGG - Intergenic
905879504 1:41454514-41454536 GCTCAGCCCCAGCCAGGAAGTGG - Intergenic
906223734 1:44103939-44103961 TCTCAGCCTCAGCCCGCCTGCGG + Intergenic
906717107 1:47978496-47978518 GCACAGGCCCAGACTGCCTGTGG + Intronic
908611744 1:65868718-65868740 GCTCAGCCACAGCTCACCTGCGG - Intronic
909392923 1:75136429-75136451 GCTGCGCGCCAGCCCGCCCGCGG + Intronic
911087389 1:93990218-93990240 GTTCTGCCCCAGCCGGCCTGCGG - Intergenic
911292199 1:96071005-96071027 GGTCAGCCCCACCCTCCCTGTGG - Intergenic
912174698 1:107141279-107141301 GCTCCGCCCGCTCCCGCCTGGGG + Intronic
913112866 1:115671762-115671784 GCTCTGCCACAGTCTGCCTGGGG - Intronic
915471564 1:156128859-156128881 GGGAAGCCCCAGCCAGCCTGGGG + Intronic
915564372 1:156705663-156705685 GCTCCGCCCCCCCCCACCTGGGG + Intronic
915619776 1:157074067-157074089 TCTCAGCCTCAGCCTGGCTGCGG - Intergenic
915911364 1:159917687-159917709 CCTCACCCCAAGCCCGCCTGAGG + Intergenic
918303914 1:183228631-183228653 GCACAGACACAGCCTGCCTGGGG - Intronic
919465948 1:197921684-197921706 GCGCAGCCCCGGCCTCCCTGAGG + Intronic
919809628 1:201400261-201400283 TCTTAGCCCAAGCCCACCTGAGG - Intergenic
920756721 1:208739978-208740000 GTGCAGCCCCAGCCTCCCTGAGG + Intergenic
922416662 1:225428229-225428251 GCCCCGCCCCACCCTGCCTGGGG + Intronic
922675738 1:227547841-227547863 TCACAGCCCCAGCCCACGTGGGG - Intergenic
924707693 1:246512418-246512440 GCTCACCCCCAGCCCACAGGAGG - Intergenic
1062796982 10:352012-352034 GCTCAGCCCCCGCCCCGCTGAGG + Intronic
1062879280 10:965104-965126 GCTCAGCACCCGCCTGCCTGTGG + Intergenic
1063714582 10:8514300-8514322 TCTCAGCCTCAGCCCGGCTGTGG + Intergenic
1067230058 10:44399822-44399844 CCTAACCCCCAGCCTGCCTGAGG + Intergenic
1068940018 10:62671382-62671404 GCTCAGCCCCAGCCTGCTTCTGG + Exonic
1069712278 10:70497341-70497363 GCTCAGACCCAGCCTGTCTGGGG + Intronic
1069886537 10:71627448-71627470 GCTAAGCTCCAGCCTCCCTGGGG + Intronic
1070311233 10:75275621-75275643 GCACAGCCCCAGCTCACCTCAGG + Intergenic
1070700817 10:78600435-78600457 GCTGAGTCCCAGCATGCCTGGGG - Intergenic
1070767967 10:79067341-79067363 GCGCAGCCCCGGCCGGGCTGCGG - Intergenic
1071490860 10:86135461-86135483 CCTCAGCCCCATCCTCCCTGAGG + Intronic
1073193314 10:101667945-101667967 GCACTGCCCCAGCCGGCCTGAGG + Exonic
1073441534 10:103555447-103555469 CCCCAGCCCGAGACCGCCTGGGG + Intronic
1074363046 10:112838152-112838174 GCTTGGCCCCAGCCCTCTTGGGG - Intergenic
1075667906 10:124244072-124244094 GCTCCTCCCCAGCCTGTCTGTGG - Intergenic
1076156031 10:128206630-128206652 GCTCATCCCCATCCCTCCTTAGG + Intergenic
1076646273 10:131957197-131957219 GCTGATCCCCCGTCCGCCTGTGG + Intronic
1076794452 10:132791854-132791876 CCTCAGCCTCAGCCCTGCTGCGG + Intergenic
1076796279 10:132799893-132799915 GCCCAGCCCTGGCCAGCCTGTGG + Intergenic
1076812730 10:132897740-132897762 GCTCAGACCCAGGCTTCCTGGGG + Intronic
1076884201 10:133254215-133254237 GGGCAGCCCCAGCACGCCTCAGG - Intergenic
1077230586 11:1456697-1456719 GCTCAGCTCCGGCCAACCTGCGG + Intronic
1077730366 11:4723347-4723369 TCTCAGCCTCCGCCCGGCTGCGG + Intronic
1078216316 11:9314723-9314745 GCCCCGCCCCGGCCCGCCCGCGG + Exonic
1078642702 11:13111236-13111258 GGACAGCCCCAGCCTGACTGAGG + Intergenic
1078660783 11:13283858-13283880 GCTCTGACCCAGGCCCCCTGTGG + Intronic
1079097637 11:17521060-17521082 GGAGAGCCCCAGCCAGCCTGGGG + Intronic
1079237173 11:18699097-18699119 GCGCGCCCCCAGCCCGCCCGCGG + Intronic
1080527371 11:33138355-33138377 GTTCTGCCCCACCCAGCCTGTGG - Intronic
1083662243 11:64256814-64256836 GCACAGCCCCACTCCTCCTGGGG + Intronic
1084004752 11:66316939-66316961 GCTGAGCCCCGTGCCGCCTGCGG - Exonic
1084398315 11:68929385-68929407 TCTCTGCCCCCGCCCTCCTGCGG + Intronic
1084661786 11:70550395-70550417 CCCCTGCCCCAGCCCACCTGGGG - Intronic
1085507100 11:77066894-77066916 GCTCCGCCCCGCCCCGCCCGCGG - Intergenic
1089313421 11:117574714-117574736 GCTCTGCCCCAGCCCTACTGTGG + Intronic
1089418994 11:118316771-118316793 GCTTAACCACAGCCCGCCTCTGG - Intergenic
1089442715 11:118530575-118530597 CCCGAGCCCCAGCCCACCTGCGG - Intronic
1089599264 11:119603468-119603490 TCTCAGCCTCAGCCTGGCTGTGG + Intergenic
1089758942 11:120708691-120708713 GTTCTGGCCCAGCCCGACTGAGG - Intronic
1092072466 12:5642808-5642830 GCTCAGCTCCAGCCACACTGTGG + Intronic
1092268409 12:7001593-7001615 TGTCAGCCCCAGCCCTCCTCAGG - Intronic
1095982731 12:47982217-47982239 GCTCAGTCCCACCCAGGCTGGGG + Intronic
1095984567 12:47990853-47990875 GCCCAGCTCCACCCAGCCTGTGG - Intronic
1096549565 12:52363263-52363285 ACTCAGCCTCGGCCCGGCTGCGG + Exonic
1096560181 12:52430558-52430580 ACTCAGCCTCGGCCCGGCTGCGG + Exonic
1096626645 12:52899918-52899940 TCTCAGCCTCAGCCCGGCTGCGG + Exonic
1096715600 12:53489385-53489407 GCTCAACTACAGCTCGCCTGAGG - Intronic
1096836687 12:54355697-54355719 TCTGACCCCCAGCCTGCCTGGGG + Intergenic
1097690339 12:62728837-62728859 GCTGAGCACCAGCCTGCCAGTGG + Intronic
1098425946 12:70366177-70366199 GCTCCGCCCCGCCCCGCCCGGGG - Intergenic
1102119413 12:110429153-110429175 GAGCAGCCCCAGCCCACCTCAGG + Intergenic
1102914658 12:116743839-116743861 GCTCAGCCACTTCCCACCTGTGG + Intronic
1104721602 12:131047602-131047624 TCCCAGCCCCAGCCCGGCAGAGG - Intronic
1104729110 12:131095239-131095261 GCTCAGCCCCAGCCCTGCCTGGG + Intronic
1104801328 12:131556808-131556830 GCTTTGCCCCTGCCCGCCTGAGG - Intergenic
1104809398 12:131611457-131611479 TCTCTGCCCCAGCCCACGTGAGG - Intergenic
1104814371 12:131637448-131637470 GCACAGCCCCAGGCAGCCTGAGG + Intergenic
1105697190 13:22900509-22900531 GCCCAGCCCCAGCCTTCCTGAGG - Intergenic
1105723082 13:23135321-23135343 GAGCAGCCCCAGCCCACCTCAGG - Intergenic
1106507437 13:30383369-30383391 GCTCAGCTCCAGCCCAGGTGAGG - Intergenic
1110630073 13:77697780-77697802 GCTCGGCCTCAGCCCGCGCGTGG + Intergenic
1113923580 13:113928320-113928342 GCGCAGCCCCGCCCCTCCTGGGG - Intergenic
1113947224 13:114051122-114051144 GCTTGGCCCCAGGCAGCCTGAGG - Intronic
1113949700 13:114065237-114065259 GCGCTGCCCCATCCCGCCTGCGG + Intronic
1113992397 14:16037970-16037992 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1114270669 14:21098315-21098337 GCTCCGCCGCCGCCCGCCCGGGG - Exonic
1114646087 14:24257035-24257057 GCTCAGGGCCAGCCAGACTGGGG - Intronic
1118349811 14:64965729-64965751 GCTCATCACCAGCCTGTCTGGGG + Intronic
1118615519 14:67572252-67572274 GCCCAGGCCCAGCCCGTCGGTGG - Exonic
1121017462 14:90557149-90557171 GCCCCGCCCCACCCCACCTGAGG - Intronic
1121081826 14:91114650-91114672 CCTCATCCCCAGCAAGCCTGTGG - Intronic
1121242325 14:92439780-92439802 GCCCACCCCCACCCCGCCAGGGG + Intronic
1121495912 14:94391223-94391245 GCTCAGCCCCCGCCCTGCTCTGG + Intergenic
1121619809 14:95338326-95338348 TCTCTGCCCCAGCCCTCTTGTGG + Intergenic
1122324599 14:100874867-100874889 GCACAGCCCCAGCCCCTCAGTGG - Intergenic
1122356276 14:101124765-101124787 CCTCAGCCCCTGGCCACCTGGGG + Intergenic
1123058144 14:105582028-105582050 GCCCAGCCCCAACCAGCCCGGGG - Intergenic
1125518961 15:40337832-40337854 GCATAGTCCCAGCCCGCCTCCGG + Exonic
1125841062 15:42801576-42801598 TCTCAGCCTCAGCCTGGCTGCGG + Intronic
1127961051 15:63891272-63891294 GGCCAGCCCCACCCAGCCTGTGG - Intergenic
1127975045 15:63990897-63990919 CCACAGCCACAGCCTGCCTGGGG + Intronic
1128728591 15:70005895-70005917 GCTCAGTCCAAGCCAGCCAGTGG - Intergenic
1129597960 15:76979614-76979636 TCTCAGCCTCAGCCCGGCTGCGG + Intergenic
1130845562 15:87741109-87741131 GCACAGCCCCACACCGTCTGCGG - Intergenic
1131183525 15:90256442-90256464 GTTCAGAACCAGCCTGCCTGGGG + Intronic
1131854827 15:96582639-96582661 CCACAGCCCCTGCCCGCCTGAGG + Intergenic
1132499883 16:280587-280609 GCTCAGCCCCGGCGCGACTGCGG - Exonic
1132614354 16:832803-832825 GCTCCGCCCCATCCACCCTGTGG + Intergenic
1132685516 16:1160470-1160492 TCTCAGCCCCTGCCCGGCTCAGG + Intronic
1132846016 16:2001241-2001263 GCCCAGGCACTGCCCGCCTGAGG - Intronic
1133170677 16:3980893-3980915 GCTCTGCCCCAGCAGGCGTGAGG - Intronic
1136544455 16:30947748-30947770 GCTCAGCCCCAGCTTGCCCCTGG - Exonic
1136911778 16:34149877-34149899 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1137624615 16:49899934-49899956 GCTGAGCCCCAGCCCGAGAGGGG + Intergenic
1138443109 16:57046903-57046925 GCTCAGCCACTCCCTGCCTGGGG + Intronic
1138584960 16:57963567-57963589 GCCCAGCCCCAGCCCTGCTCAGG + Intronic
1139293005 16:65874904-65874926 TCTCAGCCCCAGCAGGCCTCAGG + Intergenic
1139507598 16:67406984-67407006 GCTCTGCCCCATGCTGCCTGAGG + Intronic
1139644699 16:68319882-68319904 GCTCATCCCGACCCCGCCTGAGG + Intronic
1140912757 16:79468603-79468625 GCTCAGCCCCAGCTCACCCTGGG + Intergenic
1141424090 16:83934403-83934425 TCCCAGCCCCAGCCCCCCTCGGG + Intronic
1141775074 16:86117643-86117665 GCGCAGACCCACCCTGCCTGAGG + Intergenic
1142148322 16:88501869-88501891 GATCAACCCCAGCCCGCGAGGGG + Intronic
1142283030 16:89159448-89159470 CCTGAGCACCAGCCCGTCTGAGG + Intergenic
1143564796 17:7715059-7715081 GCCCAGCCCCAGTCCCCTTGGGG - Intergenic
1143894877 17:10128079-10128101 GCTCGGCCCTACCCCGGCTGGGG + Intronic
1144454221 17:15405905-15405927 GCTCAGGCCTAGCCAGGCTGAGG + Intergenic
1144576915 17:16435295-16435317 GCTCAGCCCAGGCCTGGCTGGGG - Intronic
1144783787 17:17820799-17820821 GCTCAGCCCCAGCCTAGCTGTGG - Intronic
1145074716 17:19842780-19842802 GACCAGCCCCAGCCCTCATGTGG + Intronic
1145208187 17:20995638-20995660 GCTCACCCCCAGCCCGTAGGAGG + Intergenic
1145761167 17:27426103-27426125 GCTCACCCCCAGCCCACAGGAGG + Intergenic
1146053384 17:29568936-29568958 CCCCAGGCCCAGCCCGCCAGCGG - Intronic
1146456701 17:33014589-33014611 GCTCAGCCCCTCCCCGCTTAGGG - Intronic
1146703277 17:34980725-34980747 GCTCCTCCCCCGCCCGCCTGCGG + Intronic
1146839847 17:36143627-36143649 TCACAGCCCCAGCTCCCCTGAGG + Intergenic
1146937093 17:36818677-36818699 GCCCAGCCCCAGCCCACCCCAGG - Intergenic
1147144731 17:38478366-38478388 GCTCCACCCCTGCCCACCTGTGG - Intronic
1147166726 17:38597326-38597348 GCCCAGCCCCAGACAGGCTGAGG + Intronic
1147536643 17:41326328-41326350 GCTCACCCCCAGCCCACAGGAGG + Intergenic
1147700149 17:42388526-42388548 GCCCAGCCCCAGCCTGGCCGAGG + Exonic
1147722283 17:42546695-42546717 GCTTCGCCCCGCCCCGCCTGCGG - Intergenic
1147723468 17:42552865-42552887 GCTTCGCCCCGCCCCGCCTGCGG - Exonic
1148366183 17:47057528-47057550 GCTAAGCCCCTGACTGCCTGGGG + Intergenic
1148856826 17:50583563-50583585 GCTCATCCCCAGCTCTCCTTCGG + Intronic
1151825763 17:76523357-76523379 TCACAGCCCCAGCTCGCCCGGGG + Intergenic
1152753485 17:82077377-82077399 GCTCAGCCACACCCCTCCTGCGG - Intergenic
1153900458 18:9614086-9614108 TCGCCACCCCAGCCCGCCTGGGG + Intronic
1157063590 18:44321399-44321421 TCTCAGCCTCAGCCTGGCTGCGG + Intergenic
1157602364 18:48902017-48902039 GCCCAGCCCCAGCCTGGTTGAGG - Intergenic
1158400458 18:57116873-57116895 GCTCATGGCCAGCCTGCCTGGGG - Intergenic
1158581930 18:58691365-58691387 GCTCAGGCCCAGCTCCTCTGTGG + Intronic
1158664448 18:59420127-59420149 CCACAGCCCCAGCCCCCCTGGGG - Intergenic
1159549943 18:69884390-69884412 GCTGAGCCCCAGTCTGCCAGTGG + Intronic
1159905301 18:74084436-74084458 CCTCTGCTCCTGCCCGCCTGAGG - Intronic
1160109818 18:76015698-76015720 GCTCATTCCCAGCTCTCCTGAGG + Intergenic
1160690488 19:458887-458909 GCGCAGGCCGAGCGCGCCTGGGG + Intronic
1160788766 19:913229-913251 GCCCCGCCCCTGCCCGCCTCCGG - Exonic
1161119367 19:2516941-2516963 CCCCAGCCCCAGCCCTGCTGGGG - Intronic
1161725976 19:5929310-5929332 GCTAATCCCCAGCCCCACTGGGG + Intronic
1162386761 19:10364763-10364785 GCTCAGCTCCTGCCAGCCAGGGG + Exonic
1162797711 19:13095301-13095323 GGTCACCCCCTGCCCGCCTGGGG - Exonic
1162810738 19:13163179-13163201 GCTCCGCCCCCGCCTCCCTGGGG - Intergenic
1162930622 19:13955816-13955838 GCTCAGCCCCAGCCCTGATGAGG + Intronic
1163248564 19:16112077-16112099 CCTCAGCCCCAGCCCCTCAGGGG - Intronic
1163833468 19:19559078-19559100 GCTCAGTCCCATCCCAACTGGGG - Intergenic
1164160639 19:22623612-22623634 GCCCAGCCCCTGCCCGGCGGTGG + Intergenic
1164179548 19:22807139-22807161 GCCCAGCCCCTGCCCGGCGGTGG - Intergenic
1164452813 19:28381335-28381357 GCTCAGGCCCAGGCCTCCTAAGG - Intergenic
1164941957 19:32257550-32257572 GCTAAGCACCAGCGCCCCTGCGG + Intergenic
1165073286 19:33267796-33267818 GTTCTGCCCCAGCTGGCCTGAGG - Intergenic
1165093506 19:33398302-33398324 GCTCAGCCCCTTGCAGCCTGGGG + Intronic
1165110143 19:33497647-33497669 GCTCAGCCCCATCTCACTTGGGG - Intronic
1166106736 19:40601340-40601362 CCGCCGCCCCAGCCCGCCCGAGG - Intronic
1166841333 19:45698918-45698940 GGTGGGCCCCAGCCCACCTGGGG + Intronic
1167277013 19:48545007-48545029 GCCCAGCCCCAGCCCAGCTCAGG + Intergenic
1167390785 19:49193608-49193630 GCTCAGCCCCAGCCTCTCTGGGG - Intronic
1167441911 19:49513526-49513548 GCTTCGCCCCTGCCTGCCTGGGG - Intronic
1168153537 19:54461322-54461344 GTCCAGCCCGTGCCCGCCTGCGG + Exonic
1168239160 19:55080669-55080691 GCTCAGTCCCAGCCCACGTGCGG - Intronic
1168296100 19:55377936-55377958 GCTCAGCCCCCGCCCTCCGCCGG - Intronic
1168404161 19:56102313-56102335 GCTGAGCCCCGGCCAGCGTGGGG + Intronic
1168726127 19:58583151-58583173 GCTCTGCCCCAGCAGACCTGTGG + Intergenic
925289672 2:2739121-2739143 GCTCAGCCCAAGGCCCCGTGAGG + Intergenic
926109054 2:10170579-10170601 GCTCAGCCCCAGGGTGACTGCGG + Intronic
927054822 2:19358347-19358369 GCTCAGCCCCAGGACCTCTGCGG - Exonic
928369896 2:30733064-30733086 GCTGAGCTCCTGCCTGCCTGAGG - Intronic
929584871 2:43107228-43107250 GGTCAGCCCCAGCCCTCCAAGGG + Intergenic
929966896 2:46542967-46542989 GCTCAGCCCCAGCCCGCCTGGGG - Exonic
931127400 2:59293207-59293229 GCCCAGCCTCAGACCACCTGGGG - Intergenic
932715791 2:74100180-74100202 CCCCAGCCCCAGCCCCACTGGGG - Intronic
932757237 2:74417331-74417353 GAGCAGCCCCAGCCCACCTCAGG + Intronic
934563441 2:95324995-95325017 GCCCAGCCTCAGCCAGCCAGGGG - Intronic
934653895 2:96107570-96107592 GCACAGACCCAGCCCTGCTGGGG + Intergenic
936561295 2:113541825-113541847 GCCCTGCACCCGCCCGCCTGGGG - Intergenic
937069439 2:119051839-119051861 ACTCAGCCCCAGCCCTTCTGCGG - Intergenic
937346711 2:121130478-121130500 GCTCAACCCCAACCTTCCTGAGG - Intergenic
937987459 2:127644477-127644499 GCTCAGCCCCAGACCTGCTGAGG - Intronic
938163873 2:129009554-129009576 GCTCAGGCTCAGCCTCCCTGTGG + Intergenic
938301067 2:130213549-130213571 GCTCAGCCCCAGCCCGCCTGGGG + Intergenic
938377717 2:130819548-130819570 GCTCAGCCCCGGCACAGCTGGGG - Intergenic
938408683 2:131046492-131046514 GCTCAGCCCAGGCCCAGCTGGGG + Exonic
938455652 2:131460919-131460941 GCTCAGCCCCGGCCCGCCTGGGG - Intergenic
938539321 2:132273350-132273372 CCTCAGCCTCAGCCAGCCTCTGG + Intergenic
938972991 2:136449181-136449203 GCAGAGCCGCAGCCAGCCTGGGG - Intergenic
942141145 2:172978468-172978490 GCTCACCCTCAGTCCTCCTGGGG + Intronic
943808882 2:192159343-192159365 GCTCAGCAGCAGACTGCCTGGGG - Intronic
944763479 2:202840943-202840965 TCTCAGCCTCAGCCTGGCTGTGG + Intronic
945381322 2:209145223-209145245 GCTCAGCCCCAGCCAGCCATGGG + Intergenic
946320917 2:218954002-218954024 TTTCAGCCTCAGCCCGACTGTGG + Intergenic
947669043 2:231925362-231925384 GCCCAGCCCCAGCCCGGCCCGGG - Intronic
947815211 2:233032159-233032181 CCTCAGCCTCAGGCAGCCTGGGG + Intergenic
947860409 2:233354181-233354203 ACACAGCCCCAGCCTGCCTGAGG + Intergenic
948200938 2:236129293-236129315 GATCTGCCCCAGCCCTGCTGTGG + Exonic
948459716 2:238123356-238123378 GCTCTGCGGCAGCCCGGCTGTGG + Intronic
1171062874 20:21983298-21983320 GCTGATCCCCAGCCAACCTGAGG + Intergenic
1171769450 20:29311175-29311197 CCTCAGCCGCAGCCAGCCTCTGG + Intergenic
1171907099 20:30908218-30908240 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1172221080 20:33275640-33275662 GATCAGCCCCTGCCCTCCTGGGG - Intronic
1172628190 20:36360718-36360740 GCTCAGGCCCCGCCCCACTGAGG - Intronic
1172867670 20:38112606-38112628 GCTGGGCCTCAGCCCTCCTGTGG + Intronic
1173254801 20:41386833-41386855 TCTCTGCCCCAGCCCACCTCTGG + Intergenic
1173437243 20:43044222-43044244 TCCCAGCCCCTGCCCACCTGTGG - Intronic
1174296635 20:49550027-49550049 GCTCATCCCCATCCCTCCCGAGG + Intronic
1175074200 20:56359462-56359484 GCTGCGCCCCAGCCTGGCTGAGG - Intronic
1175439634 20:58981531-58981553 GCCCCGCCCCCGCCCGCCCGGGG + Intronic
1176294102 21:5061412-5061434 GCACAGCCCCAGCCCTGCCGGGG + Intergenic
1176551801 21:8226361-8226383 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1176570710 21:8409360-8409382 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1176578619 21:8453507-8453529 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1176663217 21:9660149-9660171 GCTAAGCCCCTGACTGCCTGGGG - Intergenic
1178915299 21:36702498-36702520 CCTCAGCCCCAGACTGACTGAGG - Intronic
1179863157 21:44202236-44202258 GCACAGCCCCAGCCCTGCCGGGG - Intergenic
1179923540 21:44520482-44520504 GCTGTGCCCCAGCCTGCCAGAGG + Intronic
1180136519 21:45865838-45865860 GCACACCCTGAGCCCGCCTGAGG - Intronic
1180314874 22:11269547-11269569 CCTCAGCCGCAGCCAGCCTCTGG + Intergenic
1180340505 22:11614156-11614178 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1180843668 22:18970513-18970535 GCCCAGCCCCGGCCCGGCAGCGG - Intergenic
1181236479 22:21450486-21450508 GCTGACCCCCTGCCCTCCTGCGG + Exonic
1181361995 22:22344602-22344624 GCTCAGCCTCTGCCAGCCTGTGG - Intergenic
1181463847 22:23100350-23100372 GCTGTGACCCAGCCTGCCTGTGG - Intronic
1182447917 22:30400285-30400307 GCTCTTCCCCAGCCTGGCTGTGG + Intronic
1183050692 22:35258014-35258036 CCGCAGCCCCAGCCCTCCCGTGG - Intronic
1183490198 22:38111818-38111840 CCCCAGCCCCAGCCTCCCTGAGG - Exonic
1184421823 22:44386626-44386648 GCTCAGGTCCACCCCGCTTGTGG - Intergenic
1184502107 22:44880497-44880519 GCTCTGCCTGAGCCCTCCTGGGG - Intergenic
1184656156 22:45943239-45943261 ACTCAGCCCGAGCCCGGGTGGGG - Intronic
1184989181 22:48155697-48155719 GCTCAGCCCCAGGCCTCCGATGG + Intergenic
1203256823 22_KI270733v1_random:143283-143305 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
950046050 3:9949230-9949252 CCTCAGCGCCAGCCCTCTTGGGG + Exonic
950379958 3:12604153-12604175 GGTCAGCACCACCCTGCCTGTGG - Exonic
952837138 3:37612898-37612920 GATCAGCCCCAGGCCTCCTCAGG - Intronic
953876069 3:46667581-46667603 GCTCAGGCCTGGCCCTCCTGGGG - Intergenic
954801525 3:53189752-53189774 CCCCAGCCCCAGTCAGCCTGGGG - Intronic
954808640 3:53234573-53234595 GCCCAGCCCCGCCCAGCCTGGGG - Intronic
954812401 3:53256124-53256146 CTTCAGCCCCGCCCCGCCTGGGG + Intergenic
954878665 3:53819618-53819640 GTTCATCCGCAGCCAGCCTGGGG - Exonic
955228249 3:57078666-57078688 GCGCCGTCCCAGCCTGCCTGAGG - Intronic
956600069 3:71011235-71011257 TCTCATCCCCAGCCCCCATGTGG + Intronic
960110376 3:113839204-113839226 TCTCAGCCCCAGGCCCCCTTGGG + Intronic
961506549 3:127374332-127374354 GCTCTCCCACAGCCCGGCTGAGG - Intergenic
961520608 3:127465523-127465545 GCTCAGCCCCAGCCAGCATTGGG + Intergenic
963974025 3:151460883-151460905 GCCAAGCCCCAGCCGGCGTGGGG + Intergenic
965605739 3:170496247-170496269 TCTCAGCCTCAGCCCAGCTGCGG - Intronic
965733046 3:171792578-171792600 GCCCAGCCCCAGACTGGCTGAGG + Intronic
966594473 3:181713101-181713123 GGCCAGCTCCAGCCCCCCTGTGG + Exonic
969428756 4:7140815-7140837 GCTGTGCCCCAGCCTGCGTGGGG + Intergenic
969444999 4:7239611-7239633 GCCCAGCCCCAGCTCCCCAGGGG - Intronic
973271797 4:48269720-48269742 GGGCCGCCCCAGCCCGCCCGCGG + Intronic
974932821 4:68378786-68378808 CCTCTGCCCCAGCCCACCAGAGG - Intergenic
983649704 4:170026200-170026222 CCTCCGCCCCGGCCCGCCGGGGG + Intronic
984811307 4:183798132-183798154 GCCCTGCCCCAGCCCGCCGCGGG + Intergenic
985565099 5:611801-611823 GCTCAGCTCCCGCCCACCTCTGG + Intergenic
985731516 5:1551999-1552021 GCGCAGCCCAAGCCCGACAGTGG + Intergenic
989750243 5:44884158-44884180 GCTAAGCCCCTGCCTGCCCGGGG + Intergenic
990777949 5:59324378-59324400 CCTCAGCCCCAGCCACCATGAGG + Intronic
991091311 5:62696401-62696423 GCTCAGCCCCAGGCCTCTGGTGG + Intergenic
992197511 5:74354581-74354603 GCTCATCCCCAGCTCGGCTGTGG + Intergenic
993509514 5:88754223-88754245 ACGCAGCCTCAGCCAGCCTGTGG - Intronic
996695056 5:126385116-126385138 GCTGAGCTTCAGCCCTCCTGGGG - Intronic
997588610 5:135059358-135059380 GCTCAGACCCAGCCCAGCTTAGG - Intronic
997698992 5:135883209-135883231 TCTCATCCCCACCCCGGCTGGGG + Intronic
998887204 5:146706779-146706801 TCTCGGCCTCAGCCCGACTGCGG + Intronic
1001382065 5:171311661-171311683 GTTCCCCCGCAGCCCGCCTGGGG - Exonic
1001585391 5:172830713-172830735 TCTCACCCCCCGCCAGCCTGGGG - Intergenic
1001826858 5:174751917-174751939 GAACAGACCCAGCCCGCCTGTGG - Intergenic
1002184877 5:177449658-177449680 GCTCAGCTCCGGCCCTCCTCAGG - Intronic
1002698944 5:181109124-181109146 GGTCAGCCCCAGCACACCCGAGG - Intergenic
1002761949 6:209274-209296 GCTCGGCCCCAGCAGCCCTGGGG - Intergenic
1005927095 6:30453028-30453050 GCTCAGCCGCAGCCTGTTTGGGG + Intergenic
1006474507 6:34245670-34245692 GAGCAGCCCCAGCCCACCTCAGG - Exonic
1007630545 6:43270744-43270766 GCTCAGTTCCAGCCTGCCTTGGG - Intronic
1008456142 6:51713344-51713366 CCTCAGCCCAAGCCTGCCTCAGG + Intronic
1011194408 6:84766725-84766747 GCTGAGCCCCAGCAGGCCCGAGG - Intergenic
1015914959 6:138206689-138206711 GCTCACACCCAGCACACCTGGGG - Intronic
1017156318 6:151325588-151325610 GGCCAGCGCCAGCCCGCGTGTGG + Intronic
1017812869 6:157996685-157996707 GGTCAGCACCATCCCCCCTGGGG + Intronic
1018317234 6:162569126-162569148 TCTTAGCCTCAGCCCGGCTGAGG - Intronic
1018539001 6:164856436-164856458 CCTCAGCCCCATCCCGGCTAAGG + Intergenic
1019552000 7:1607854-1607876 GCCCAGCCCCAGCCCAGCTCAGG - Intergenic
1022300741 7:29099984-29100006 GCTCTGCCCCAACCTGCCTGTGG + Intronic
1023865597 7:44236788-44236810 GCCCAGTGCCAGCCAGCCTGAGG + Intronic
1024049294 7:45608770-45608792 GCTCTGCCGCAGCCCCCATGTGG - Intronic
1025850396 7:65239363-65239385 GCCCAGCCCCTGCCCGCAAGTGG - Intergenic
1026931174 7:74223798-74223820 TCCCAGCCCCAGCCTGCCTCTGG - Intronic
1027539601 7:79452310-79452332 GCTCACCCCTAGCCAGCCCGGGG - Intronic
1028171282 7:87600229-87600251 TCTCACCTCCAGCGCGCCTGAGG - Intronic
1029159418 7:98541098-98541120 GCTGAGCCCCTGTCCTCCTGGGG + Intergenic
1029373950 7:100166903-100166925 GCTCTTCCCCATCCCACCTGGGG - Intronic
1030639258 7:111985569-111985591 GCACTGCCCCAGCCACCCTGAGG + Intronic
1031013630 7:116549199-116549221 GCCCAGGCCCAGCCCTGCTGGGG - Intronic
1033249651 7:139747700-139747722 CATCAGCCCCAGCCCTCCTGTGG + Intronic
1035038653 7:155911666-155911688 GCTCAGCCCCGGCCTCCCTGTGG - Intergenic
1035459330 7:159029608-159029630 GCTCAGCCCCAGGCCAGCTGCGG - Exonic
1036963464 8:13271006-13271028 ACTCAGCCACAGGCAGCCTGAGG + Intronic
1038425626 8:27462194-27462216 CCCCACCCCCAGCCTGCCTGGGG - Intronic
1039880642 8:41623394-41623416 GCTCAGCCCCACCCTTGCTGGGG - Exonic
1040804381 8:51377816-51377838 GCGCAGCCCCAGCCTCCCGGAGG + Intronic
1041369463 8:57143469-57143491 GCTGAGTCCCAGCCCCGCTGCGG - Intergenic
1041781111 8:61579035-61579057 TCTCAGCCTCAGCCCGTCTTTGG - Intronic
1045252760 8:100495259-100495281 CCTGAGACCCAGCCTGCCTGCGG + Intergenic
1045583373 8:103501360-103501382 GTTCAGCCCCAGTCCCGCTGGGG - Intronic
1047514365 8:125540938-125540960 GGTCAGCCACAGCCCTCCTATGG - Intergenic
1049639335 8:143707590-143707612 GCTCACCCCCACCCCGCCCCCGG + Intronic
1049684000 8:143932058-143932080 GCCCCGCCCCGCCCCGCCTGGGG + Intronic
1050112771 9:2233827-2233849 CCTGAGCCCAAGCCCGCCTGAGG - Intergenic
1051012828 9:12439242-12439264 GGTCATCCCCAGGCCGCCTTTGG + Intergenic
1051314198 9:15810648-15810670 GCTAAGCCCCTCCCTGCCTGGGG + Intronic
1052966905 9:34347219-34347241 GCCCTGCCCCAGCCCCTCTGAGG + Intergenic
1053482809 9:38428508-38428530 GAACTGCCCCAGCCCCCCTGGGG + Intergenic
1053489500 9:38488280-38488302 GCGCAGCGCCAGCCACCCTGTGG + Intergenic
1053576008 9:39357877-39357899 GGTCAGCTCCAGGCTGCCTGTGG - Intronic
1053600498 9:39604214-39604236 GCCCAACCCCACCCCGGCTGCGG + Intergenic
1053732821 9:41074588-41074610 GCCCTGCGCCCGCCCGCCTGGGG + Intergenic
1053840523 9:42185814-42185836 GGTCAGCTCCAGGCTGCCTGTGG - Intronic
1053858146 9:42358070-42358092 GCCCAACCCCACCCCGGCTGCGG + Intergenic
1054097578 9:60916568-60916590 GGTCAGCTCCAGGCTGCCTGTGG - Intergenic
1054118980 9:61192198-61192220 GGTCAGCTCCAGGCTGCCTGTGG - Intronic
1054253031 9:62738170-62738192 GCCCAACCCCACCCCGGCTGCGG - Intergenic
1054293442 9:63317487-63317509 GGTCAGCCTCAGCCCGACTCAGG + Intergenic
1054567147 9:66772669-66772691 GCCCAACCCCACCCCGGCTGCGG - Intergenic
1054588771 9:66990364-66990386 GGTCAGCTCCAGGCTGCCTGTGG + Intergenic
1054695607 9:68356967-68356989 GCCCTGCACCCGCCCGCCTGGGG - Exonic
1055985518 9:82054579-82054601 GCTAAGCCCCTGACTGCCTGGGG + Intergenic
1056413383 9:86354191-86354213 GCTCAGCCTCTGCCGGCCTGGGG + Intronic
1056584606 9:87920035-87920057 GGTCAGCTCCAGGCTGCCTGTGG - Intergenic
1056612260 9:88132885-88132907 GGTCAGCTCCAGGCTGCCTGTGG + Intergenic
1056942175 9:90965015-90965037 CCTCAGCACCAGCAGGCCTGGGG + Intergenic
1057669842 9:97077600-97077622 GCCCAGCGCCAGCCACCCTGTGG + Intergenic
1057904697 9:98974730-98974752 CCTCAGCCCCGGCCCCCCAGTGG + Intronic
1059526222 9:114993172-114993194 TCTCTTCCCCAACCCGCCTGGGG + Intergenic
1059627286 9:116080774-116080796 GCCCCATCCCAGCCCGCCTGAGG + Intergenic
1060234338 9:121852061-121852083 GTTCTGCCCCTGCCTGCCTGTGG + Intronic
1060406344 9:123374910-123374932 ACCCAGCCTCAGCCCGCCTGTGG + Intronic
1060759114 9:126233768-126233790 GCTCAGCCCCATCCCGGCTCTGG - Intergenic
1061133703 9:128721842-128721864 GCTCAGTGCCAGCCCTGCTGTGG + Intronic
1061237839 9:129352482-129352504 GCTCAACCCCAGCCGCTCTGGGG - Intergenic
1062206728 9:135341723-135341745 GCTCAGCCCCACTTCCCCTGTGG + Intergenic
1062309928 9:135930115-135930137 GGTCAGCCTCAGCCCAGCTGTGG - Intergenic
1062400303 9:136369891-136369913 GCTCAGCCCCCACAGGCCTGAGG + Intronic
1062524730 9:136973598-136973620 GCCCAGACCCTGCCCTCCTGGGG + Intergenic
1203472980 Un_GL000220v1:124965-124987 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1203363182 Un_KI270442v1:235560-235582 CCTCAGCCGCAGCCAGCCTCTGG + Intergenic
1203662882 Un_KI270753v1:61616-61638 GCTAAGCCCCTGACTGCCTGGGG + Intergenic
1185621500 X:1453439-1453461 GCCCCTCCCCACCCCGCCTGCGG + Intronic
1185750951 X:2609321-2609343 GCTCCGCCCCACCCGGCCCGTGG + Intergenic
1186485590 X:9932296-9932318 GCTCGGCCCCGGCCCTCCCGGGG - Exonic
1188156617 X:26749145-26749167 GAGCAGCCCCAGCCCACCTCAGG - Intergenic
1189185505 X:39051421-39051443 GCTCAGCTCCAGCACTCATGTGG + Intergenic
1189893820 X:45632894-45632916 TCTCAGCCTCAGCCCAGCTGCGG + Intergenic
1191220732 X:57985498-57985520 TCTCAGCCTCAGCCCAGCTGCGG - Intergenic
1196754685 X:119147769-119147791 GTTCAGGCCCAGAACGCCTGGGG + Intronic
1198275810 X:135096327-135096349 TCTCAGCCCCAGCCCACCCCAGG + Intergenic
1198310709 X:135424410-135424432 TCTCAGCCCCAGCCCACCCCAGG - Intergenic
1198683374 X:139204430-139204452 CCTCAGCTTCTGCCCGCCTGCGG + Intronic
1199856090 X:151759716-151759738 GCTCATCCCCAGCCTGTCTCTGG - Intergenic
1199927229 X:152480388-152480410 TCTCAGCCTCAGCCAGGCTGCGG - Intergenic
1200051083 X:153432138-153432160 CCACAGCCCCAGCGCTCCTGAGG - Intergenic
1201075145 Y:10181229-10181251 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1202119968 Y:21511231-21511253 GCTCCGCCCCAGCAGGCCTGCGG - Intergenic
1202122419 Y:21534772-21534794 GCTCCGCCCCAGCAGGCCTGCGG - Intronic
1202156586 Y:21894611-21894633 GCTCCGCCCCAGCAGGCCTGCGG + Intronic
1202159034 Y:21918152-21918174 GCTCCGCCCCAGCAGGCCTGCGG + Intergenic
1202185483 Y:22183067-22183089 GCTCCGCCCCAGCAGGCCTGCGG + Intergenic
1202205877 Y:22403329-22403351 GCTCCGCCCCAGCAGGCCTGCGG - Intronic