ID: 929966897

View in Genome Browser
Species Human (GRCh38)
Location 2:46542968-46542990
Sequence GGCTCAGCCCCAGCCCGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 2, 1: 1, 2: 2, 3: 36, 4: 337}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929966897_929966906 -8 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966906 2:46542983-46543005 GCTGAGCCCGGGGCCGGGGCGGG 0: 3
1: 1
2: 32
3: 298
4: 1571
929966897_929966918 18 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966918 2:46543009-46543031 TCCGGGGGGACCATGCCCGGAGG 0: 4
1: 0
2: 0
3: 5
4: 71
929966897_929966912 1 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966912 2:46542992-46543014 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914
929966897_929966907 -7 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
929966897_929966920 22 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966897_929966905 -9 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966905 2:46542982-46543004 GGCTGAGCCCGGGGCCGGGGCGG 0: 3
1: 0
2: 12
3: 134
4: 1005
929966897_929966908 -6 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
929966897_929966911 0 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG 0: 3
1: 4
2: 59
3: 473
4: 2369
929966897_929966917 15 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966917 2:46543006-46543028 GGCTCCGGGGGGACCATGCCCGG 0: 4
1: 0
2: 0
3: 17
4: 156
929966897_929966921 26 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966921 2:46543017-46543039 GACCATGCCCGGAGGCCGGCCGG 0: 4
1: 0
2: 0
3: 7
4: 114
929966897_929966915 4 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966915 2:46542995-46543017 GCCGGGGCGGGGGCTCCGGGGGG 0: 3
1: 1
2: 26
3: 133
4: 1098
929966897_929966914 3 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966914 2:46542994-46543016 GGCCGGGGCGGGGGCTCCGGGGG 0: 3
1: 3
2: 20
3: 213
4: 1517
929966897_929966913 2 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966913 2:46542993-46543015 GGGCCGGGGCGGGGGCTCCGGGG 0: 3
1: 4
2: 37
3: 217
4: 1422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929966897 Original CRISPR GGCTCAGCCCCAGCCCGCCT GGG (reversed) Exonic
900132382 1:1092567-1092589 GGCTGGGCCTCAGCCCCCCTCGG - Intronic
900289257 1:1916952-1916974 GGCTCAGCGCCAGGCCCCGTAGG + Exonic
900417349 1:2541122-2541144 GGCTGCGTCCCAGCTCGCCTGGG + Intergenic
900648222 1:3718495-3718517 GCCTGAGCTCCCGCCCGCCTGGG - Intronic
900902574 1:5526985-5527007 GGCTCAGCCCCATCAGCCCTGGG - Intergenic
900963911 1:5944377-5944399 GGCCCTGCCACAGCCCGCCCTGG + Intronic
901006087 1:6172120-6172142 GGCTCAGCCTAGGCCAGCCTGGG - Intronic
901635543 1:10668545-10668567 GGCCCCGGCCCAGCCCACCTCGG - Intronic
903139763 1:21332541-21332563 AGCTCTGGCCCAGCCTGCCTGGG - Intronic
903522180 1:23959364-23959386 GGCGCAGCCCCCTCCCGCCTCGG - Intronic
903694033 1:25194536-25194558 GGCTCAGACTCAGCCCTGCTGGG + Intergenic
904423044 1:30406352-30406374 GACTCACCCCCCGCCCCCCTTGG + Intergenic
904460971 1:30679642-30679664 GGCACAGTCACAGCCCGGCTGGG + Intergenic
905280589 1:36846582-36846604 AGCACAGCCCCAGCCTGTCTGGG - Intronic
905637170 1:39562055-39562077 GTCTGAGCCCCAGCTCACCTTGG + Exonic
907319609 1:53594347-53594369 GGCCCAGCCCCAGGCCTCCAAGG + Exonic
908166641 1:61465435-61465457 GACTCAGACCCAGTCAGCCTGGG + Intergenic
908703427 1:66925419-66925441 AGCTTAGCCCCACCCCGACTGGG - Intronic
911997841 1:104788991-104789013 GGATCTGCCCCTTCCCGCCTAGG + Intergenic
913112867 1:115671763-115671785 GGCTCTGCCACAGTCTGCCTGGG - Intronic
914932720 1:151949387-151949409 GGCTCAGCCCTAGCCTCCCCTGG - Intergenic
918450102 1:184649731-184649753 GGCCCCGGCCCAGCCCGCCCAGG - Intergenic
918955866 1:191205948-191205970 GGCCCAGCCCTAGGCCTCCTAGG - Intergenic
1065131729 10:22628561-22628583 GGCTCTGCCCCAGCCTCCTTGGG - Intronic
1065587901 10:27238208-27238230 GCCTCAGCATCAGCCTGCCTCGG + Intronic
1065807661 10:29409812-29409834 GGCTCCGCCCGCGCCCTCCTCGG + Intergenic
1065859469 10:29859407-29859429 GCTTCAGCCTCAGCCAGCCTTGG + Intergenic
1069557418 10:69407320-69407342 GCCCCAGCCCCAGCCCTCCGAGG + Intronic
1069712277 10:70497340-70497362 CGCTCAGACCCAGCCTGTCTGGG + Intronic
1070700818 10:78600436-78600458 GGCTGAGTCCCAGCATGCCTGGG - Intergenic
1070833615 10:79434953-79434975 AGCCCAGCCCCACCCAGCCTTGG + Intronic
1070846962 10:79531029-79531051 AGCTCAGCCACACCACGCCTGGG - Intergenic
1070926834 10:80229248-80229270 AGCTCAGCCACACCACGCCTGGG + Intergenic
1072154763 10:92714701-92714723 GGCTCAGCCCCAACCCTGCTTGG + Intergenic
1072757382 10:98030236-98030258 GCCTCACCCCCAGCCCGCGGGGG + Intronic
1073136948 10:101225482-101225504 GCCCCCGCCCCAGCCGGCCTTGG + Intergenic
1073328954 10:102658524-102658546 GGCCCAGCCCCATGCCACCTGGG + Intergenic
1074102012 10:110361131-110361153 AGCTCAGCCCCAACCTGCCCTGG + Intergenic
1074300119 10:112225952-112225974 AGCTCAGCCCCACCTCCCCTGGG + Intergenic
1074363047 10:112838153-112838175 GGCTTGGCCCCAGCCCTCTTGGG - Intergenic
1074618432 10:115093319-115093341 CGCTCGGCCCCCGCCCTCCTGGG + Intergenic
1075568215 10:123520026-123520048 GCCTGAGCCCCATCCCGCCTTGG - Intergenic
1075698083 10:124450135-124450157 GGCGCAGCCCGGGCCAGCCTCGG + Exonic
1075701187 10:124470287-124470309 GGCCCAGCCCAGGCCCGGCTCGG + Intronic
1075777683 10:124998847-124998869 GGCTCACCCCAAGCCACCCTCGG - Intronic
1076343238 10:129764324-129764346 GGGGAAGCCCCAGCCCCCCTTGG - Intronic
1076741786 10:132489231-132489253 GACTCAGCCCCACCAGGCCTGGG - Intergenic
1077038004 11:504478-504500 GGCTCCGCCCGCCCCCGCCTGGG - Intronic
1077090832 11:777533-777555 GGCTCCGCCCCCGGCCGCCAGGG - Intergenic
1077160206 11:1109222-1109244 GGCCCAGCCCCAGCCCGGCCAGG - Intergenic
1077377642 11:2212730-2212752 GCCTCGGCCCCAGCCCGTCTTGG - Intergenic
1077423723 11:2464773-2464795 GCCTCAGCCCCAGCCCACCTAGG - Intronic
1079116154 11:17641817-17641839 GGCTGAGGCCCACCCCGCCCTGG + Intronic
1081676474 11:44972887-44972909 GGCTGAGCCCCAGCCACCCACGG - Intergenic
1083178955 11:60972088-60972110 GGCACAGCCCCAGCCCCTCGAGG - Intronic
1083965711 11:66042563-66042585 GGCTCGGCCCGAGCCCGTCCTGG - Exonic
1084112438 11:67022989-67023011 GACTCAGAGCCAGCCGGCCTGGG - Intronic
1084709064 11:70832762-70832784 GGCTTAGCCCAAGCCTCCCTGGG - Intronic
1087027187 11:93661493-93661515 GCGCCAGCCCCAGCCTGCCTAGG - Intergenic
1089525550 11:119094598-119094620 GGCGCCGCACCTGCCCGCCTCGG - Exonic
1090669291 11:128934898-128934920 GGCTCAGCTGCAGCCCACCCAGG + Intronic
1090868824 11:130725260-130725282 CGCCCAGCCCCACCCTGCCTGGG + Intergenic
1091667834 12:2431944-2431966 GGCTCAGCCCAACCCTGCCAAGG + Intronic
1095951089 12:47782393-47782415 AGCTCAGCCCCAGCTCACCACGG - Exonic
1095952366 12:47788580-47788602 GGCCCAGCCCCATCCCTCGTAGG + Intronic
1096602831 12:52742430-52742452 GGCTCAGGCCCAACCCTGCTTGG - Intergenic
1096606831 12:52772649-52772671 GACTCAGCTCCACCCCACCTGGG - Intronic
1096674888 12:53221113-53221135 GGCCCCGCCCCACCCCGCCCAGG + Intronic
1097068831 12:56339980-56340002 GCCTCAGTCCCAGCCAGCCATGG + Exonic
1097107682 12:56634998-56635020 GGCGCAGCCGCCGCCCGGCTCGG - Intronic
1097999425 12:65924066-65924088 GACCCACCCCCAGCCCACCTTGG + Intronic
1101964065 12:109270111-109270133 GGCTCAGACCCAATCCCCCTGGG + Intergenic
1103624426 12:122207184-122207206 GGCTCAGCCCCAGCCGCCTCAGG - Exonic
1104729109 12:131095238-131095260 AGCTCAGCCCCAGCCCTGCCTGG + Intronic
1104822061 12:131682637-131682659 CGCTCAGCCCCAGCGAGGCTGGG + Intergenic
1106248730 13:27968569-27968591 CGCTCAACCCCGGCCCTCCTGGG - Exonic
1106498640 13:30306869-30306891 CGCTCAGCCCCACCCCGGCTGGG - Intronic
1107091897 13:36490378-36490400 GGCCAAGACCCAGCCCTCCTGGG - Intergenic
1111367531 13:87268953-87268975 GCCTCAGCCTCCGCCCTCCTCGG + Intergenic
1112457442 13:99575484-99575506 GGCTCTGGCGCAGCCAGCCTGGG + Intergenic
1113562300 13:111291443-111291465 GGCTAAGCTCCAGCGCGCCCTGG + Intronic
1114153466 14:20072127-20072149 GGCTCATCCCCAGCCGGGCACGG - Intergenic
1114646088 14:24257036-24257058 GGCTCAGGGCCAGCCAGACTGGG - Intronic
1116751190 14:48886670-48886692 ACCTCAGCCTCGGCCCGCCTCGG + Intergenic
1117637968 14:57766489-57766511 GGCTCTGGCCTAGCCTGCCTTGG - Intronic
1118864854 14:69694869-69694891 GGCTCAACCTAAGCCCTCCTCGG - Intronic
1118905297 14:70019076-70019098 GCCTCAGCCCCACCAGGCCTTGG - Intronic
1119438153 14:74611481-74611503 GGCGCAGCCCCAGACCGCTGTGG + Exonic
1120752456 14:88210554-88210576 GGCTCAGTGCCAGGCCGACTAGG - Intronic
1121242324 14:92439779-92439801 GGCCCACCCCCACCCCGCCAGGG + Intronic
1121449056 14:93996330-93996352 AGATCAGCCCCAGCCAGCCCAGG - Intergenic
1122126107 14:99579584-99579606 GGCGCAGCCCCAGACAGCCCAGG + Intronic
1122264696 14:100541137-100541159 GGCTGAGCCAGCGCCCGCCTGGG - Intronic
1122356274 14:101124764-101124786 GCCTCAGCCCCTGGCCACCTGGG + Intergenic
1122505482 14:102229186-102229208 GGCGCATCCCCAGCCCTCCGTGG + Exonic
1122660865 14:103293953-103293975 TGCTCACCCCCACCCCGCCCCGG + Intergenic
1122813693 14:104301812-104301834 GGATCCGCCCCAGGCCGCATGGG + Intergenic
1123004519 14:105314877-105314899 GCCGCAGCCCCAGGCCGCCGAGG + Exonic
1123058145 14:105582029-105582051 GGCCCAGCCCCAACCAGCCCGGG - Intergenic
1123082241 14:105700958-105700980 GGCCCAGCCCCAACCAGCCCAGG - Intergenic
1125238925 15:37550538-37550560 GACTCAGCCCCAACCCCACTCGG + Intergenic
1125504468 15:40258965-40258987 GGCACAGCCCCAGCCCCTCCTGG - Intronic
1125834797 15:42739565-42739587 GGCTCAAGCCCAGGCCACCTAGG + Exonic
1127507903 15:59612617-59612639 GGCGCAGTCCCAGACTGCCTGGG - Intronic
1128563166 15:68681995-68682017 GGCCCAGTCCCAGCCCACCCTGG + Intronic
1128964342 15:72042855-72042877 AGTTCAGGACCAGCCCGCCTAGG + Intronic
1129204724 15:74030128-74030150 TGCCCAGCCCCAGCTTGCCTGGG + Intronic
1129893756 15:79089386-79089408 GGCTCACCCCCACCCCGCCCGGG + Intronic
1130022477 15:80242845-80242867 GGCTCAGACCCAGCCAGCTTTGG + Intergenic
1131183524 15:90256441-90256463 GGTTCAGAACCAGCCTGCCTGGG + Intronic
1131827676 15:96333571-96333593 GCCCCAGCCCCAGCCCGGCGGGG - Intronic
1132180986 15:99752747-99752769 GGCTCAGCCCCAGGCAGAGTTGG - Intergenic
1132691691 16:1184459-1184481 GGCTCATCACCTGCCGGCCTGGG + Intronic
1133031487 16:3013321-3013343 TTCTCAGCCCCAGGCGGCCTAGG - Exonic
1135208180 16:20499912-20499934 GGCTCAGCCCCAACCATGCTTGG - Intergenic
1135210719 16:20523788-20523810 GGCTCAGCCCCAACCATGCTTGG + Intergenic
1136655914 16:31709177-31709199 GGCCCTGCCACAGCCCACCTGGG - Intergenic
1137061155 16:35792780-35792802 GGCTCACCCCCACACCGTCTAGG + Intergenic
1137567501 16:49542702-49542724 GGCTGGGCCCCAGCCCACCCTGG + Intronic
1137688447 16:50403009-50403031 GGCTGTTCCCCAGCCCACCTGGG + Intergenic
1140912756 16:79468602-79468624 TGCTCAGCCCCAGCTCACCCTGG + Intergenic
1141424089 16:83934402-83934424 CTCCCAGCCCCAGCCCCCCTCGG + Intronic
1141724777 16:85780564-85780586 GTCTCTGCCCCAGCCAGCGTGGG - Intronic
1142148321 16:88501868-88501890 GGATCAACCCCAGCCCGCGAGGG + Intronic
1203123949 16_KI270728v1_random:1560145-1560167 GGCTCAGCCCTGGCCAGCCTTGG + Intergenic
1142590502 17:1003358-1003380 AGCTCTGCCCCAGCCCCCGTGGG + Exonic
1142712786 17:1732509-1732531 GCCCCCGCCCCAGCCCGCCCTGG - Intronic
1142837062 17:2594497-2594519 GGCTCAGCCCCGCGCCGCCGGGG + Intronic
1143564797 17:7715060-7715082 GGCCCAGCCCCAGTCCCCTTGGG - Intergenic
1143719069 17:8797803-8797825 AGCTCAGCCCCAGCCCCACCAGG + Exonic
1143781547 17:9232026-9232048 GGCTCAGCCCCAGTGCTCCGAGG - Intronic
1143894876 17:10128078-10128100 GGCTCGGCCCTACCCCGGCTGGG + Intronic
1144056598 17:11548043-11548065 GGCCTAGCGCCAGCCTGCCTGGG + Intronic
1144576916 17:16435296-16435318 GGCTCAGCCCAGGCCTGGCTGGG - Intronic
1144586835 17:16492223-16492245 GGCCCCGCCCCGGCCCGGCTCGG + Intergenic
1145263759 17:21369634-21369656 GGCTCATCCCCAGCCCACACTGG + Intergenic
1145274207 17:21420388-21420410 GGCTCAGCCCCAGATCTCCAAGG + Intergenic
1145312069 17:21706287-21706309 GGCTCAGCCCCAGATCTCCAAGG + Intergenic
1145980509 17:29008384-29008406 GGCTCTGCCTCAACCTGCCTAGG - Intronic
1146258226 17:31404146-31404168 GACTCAGCCCCACACAGCCTGGG - Intronic
1146456702 17:33014590-33014612 AGCTCAGCCCCTCCCCGCTTAGG - Intronic
1146654274 17:34626145-34626167 CGGCCAGCCCCAGCCCGCCGGGG + Exonic
1147044742 17:37744276-37744298 GGCCCAGCCCCAGCCCCGCGGGG + Intronic
1147217112 17:38907204-38907226 GGCTCAGCTCCTTCCAGCCTGGG - Intronic
1147584973 17:41648767-41648789 TGCTCAGCCCCAGCCTGGGTTGG - Intergenic
1147636312 17:41966721-41966743 GGCCCGCCCCCAGCCCGCCCGGG + Exonic
1147887871 17:43696810-43696832 GGCACATCCCCTGCCTGCCTGGG + Intergenic
1148209380 17:45799034-45799056 GGCTTCTCCCCATCCCGCCTCGG - Intronic
1148733406 17:49851304-49851326 GGCCCTGCCCCAGCCCACCCCGG - Intergenic
1149734556 17:58980363-58980385 TGCTCAGCACCAGCCGACCTAGG + Exonic
1150779505 17:68109219-68109241 CACTCAGCCTCAGCCTGCCTGGG + Intergenic
1151954724 17:77374546-77374568 GGCTCTGCCCAAGTCAGCCTAGG - Intronic
1152037229 17:77880859-77880881 GGCTCTGGGCCAGCCTGCCTGGG + Intergenic
1152466927 17:80471740-80471762 GGCCCAGCACCAGCACGCCCTGG + Exonic
1154216465 18:12420136-12420158 GGCTCAGCACCTGCACGCCTCGG - Intronic
1157514930 18:48304086-48304108 GGCTCTGGCCCAGACCCCCTGGG - Intronic
1157552512 18:48591274-48591296 GGCCCATCCACAGCCAGCCTGGG - Intronic
1158664450 18:59420128-59420150 CCCACAGCCCCAGCCCCCCTGGG - Intergenic
1160453169 18:78979243-78979265 GCCCCCGCGCCAGCCCGCCTGGG - Intergenic
1160748603 19:723071-723093 GGCTCACCCCCAGCCCCGCCTGG - Intronic
1161066930 19:2243296-2243318 GGCTCCAGCCCAGCCCGCCCAGG + Intronic
1161412476 19:4124038-4124060 GCCTCAGCCCCAGCGCCCCTCGG - Exonic
1161719619 19:5895669-5895691 GGCCTACCCCCAGCCCGCCAAGG - Intronic
1161725975 19:5929309-5929331 GGCTAATCCCCAGCCCCACTGGG + Intronic
1162797712 19:13095302-13095324 GGGTCACCCCCTGCCCGCCTGGG - Exonic
1163529725 19:17842363-17842385 GGAGCAGCCCCAGCCCGTCGTGG + Exonic
1163548615 19:17952912-17952934 TGCTCTGCCCCAGCCCAGCTGGG - Intronic
1163617899 19:18340663-18340685 GGCACAGCCCGATCCCGCCATGG + Exonic
1163833469 19:19559079-19559101 GGCTCAGTCCCATCCCAACTGGG - Intergenic
1163862721 19:19750532-19750554 GCCTCAACCCCAGCCCTGCTTGG + Intergenic
1164389575 19:27806077-27806099 GGCCCAGGCCCAGGCTGCCTTGG + Intergenic
1164634283 19:29781226-29781248 GGACCAGCCCCAGCCCGTCCTGG + Intergenic
1164674454 19:30092164-30092186 GGCTCAGCCCCAGCTCTGATTGG + Intergenic
1164835250 19:31351468-31351490 AGCCCCGCCGCAGCCCGCCTCGG - Intergenic
1165093505 19:33398301-33398323 GGCTCAGCCCCTTGCAGCCTGGG + Intronic
1165150709 19:33758602-33758624 GGTCCAGCTCCAGCCGGCCTTGG - Intronic
1165645284 19:37430994-37431016 GGACCAGCCCCAGCCAGTCTAGG + Intronic
1167002753 19:46755753-46755775 GGCGCTGCTCCAGCCCGCCCTGG + Exonic
1167042734 19:47032271-47032293 GCCCCAGCCCCAGGCCGCCGCGG + Exonic
1167138464 19:47632774-47632796 GGCACAGGCCCACCCAGCCTAGG + Intronic
1167390786 19:49193609-49193631 GGCTCAGCCCCAGCCTCTCTGGG - Intronic
1167441912 19:49513527-49513549 GGCTTCGCCCCTGCCTGCCTGGG - Intronic
1168254714 19:55159103-55159125 GGCTCAGCCTCAGGGGGCCTTGG - Exonic
925309937 2:2875209-2875231 CACTGAGCCCCAGGCCGCCTGGG + Intergenic
927276554 2:21267099-21267121 GGCTCAGCCCCACCTAGACTTGG + Intergenic
927927662 2:27024870-27024892 GGAGCAGCCCCAGCCCGCGTCGG + Intronic
929584870 2:43107227-43107249 AGGTCAGCCCCAGCCCTCCAAGG + Intergenic
929966897 2:46542968-46542990 GGCTCAGCCCCAGCCCGCCTGGG - Exonic
932323237 2:70837370-70837392 GGCTCAGCCTCAGCAGGCCCAGG - Intergenic
932715793 2:74100181-74100203 GCCCCAGCCCCAGCCCCACTGGG - Intronic
933751074 2:85602467-85602489 GGCCCGGCCCCCGCTCGCCTGGG + Intronic
934601361 2:95661055-95661077 GGCTCTGCCCCAGCTTACCTGGG + Intergenic
934653894 2:96107569-96107591 GGCACAGACCCAGCCCTGCTGGG + Intergenic
936534731 2:113303223-113303245 GGCTCTGCCCCAGCTTACCTGGG + Intergenic
937207177 2:120244298-120244320 GGCTCAGGCCCAGCCCGTCCCGG + Intronic
937260876 2:120586270-120586292 GGCTGGGCCCCTGCCCACCTGGG + Intergenic
937905180 2:127049624-127049646 GGCTCAGCCCCTGAGCACCTCGG - Intronic
937956042 2:127422334-127422356 CTCTCAGCCCCAGCAGGCCTTGG + Intronic
938259909 2:129888138-129888160 GGCACAGCCCCAGCCCACCCAGG + Intergenic
938301066 2:130213548-130213570 GGCTCAGCCCCAGCCCGCCTGGG + Intergenic
938455653 2:131460920-131460942 GGCTCAGCCCCGGCCCGCCTGGG - Intergenic
939084970 2:137708136-137708158 GGAACAGCCCCCTCCCGCCTAGG + Intergenic
940303497 2:152200875-152200897 GGCTCAGCTTCAGCCTGCGTAGG - Intergenic
940774914 2:157875804-157875826 GGCTCAGCCCCCGGCCGCGGCGG - Intronic
945381321 2:209145222-209145244 AGCTCAGCCCCAGCCAGCCATGG + Intergenic
946196157 2:218033987-218034009 GTCTCCGCCCCTGCCCGCCGGGG - Intergenic
947257227 2:228180596-228180618 GGCGCAGCCCCACCTCTCCTGGG - Intronic
947669044 2:231925363-231925385 CGCCCAGCCCCAGCCCGGCCCGG - Intronic
947815209 2:233032158-233032180 GCCTCAGCCTCAGGCAGCCTGGG + Intergenic
948309185 2:236972354-236972376 GGCTCACCCTGAGCCAGCCTTGG - Intergenic
948853353 2:240718945-240718967 GGCTCAGCTCCTGCCCTGCTAGG + Intronic
948868615 2:240787341-240787363 GGAGCAGCCCCAGCCCTCCCTGG - Intronic
949069943 2:242018427-242018449 GACACAGCCCCAGCCTTCCTAGG + Intergenic
1168965466 20:1895460-1895482 GGCCCGGCCCCCGGCCGCCTCGG + Exonic
1169042824 20:2509624-2509646 GCCTCAGCCTCAGCCTCCCTCGG - Intronic
1169885567 20:10394881-10394903 GGATCAGCCCCCGCCCGGCCAGG - Intergenic
1170638297 20:18128832-18128854 GGCTCAGCACCATCCCCACTTGG - Intergenic
1171767353 20:29297568-29297590 GGCACAGCCCCGGCCGGCCGGGG + Intergenic
1172118707 20:32585480-32585502 GGCCCAGCCCCCGCCCGGCCCGG + Intronic
1172221081 20:33275641-33275663 AGATCAGCCCCTGCCCTCCTGGG - Intronic
1173456165 20:43203349-43203371 GGCTCAGGACCAGCCCGGATGGG + Intergenic
1173662279 20:44742932-44742954 GGCTCAGCCACAGCCTGGCTGGG + Intergenic
1175036077 20:56003347-56003369 GGCTCTGCCCCCGCCCTCCGCGG + Intronic
1175084365 20:56446094-56446116 GGCTGAGCCCCTGGCCGCCATGG - Intronic
1175281696 20:57808123-57808145 CTCTCAGCCCCAGCCAGCCCAGG - Intergenic
1175750567 20:61494124-61494146 GGCTCACACCCAGCCCGGCTCGG - Intronic
1176104507 20:63379597-63379619 GGCACTGTCACAGCCCGCCTGGG + Intergenic
1176380723 21:6111071-6111093 GGCCCCGCCCCGGCCCGCCCCGG - Intergenic
1176553642 21:8243093-8243115 GGCTCCGGCCCGGCCAGCCTCGG + Intergenic
1176572564 21:8426117-8426139 GGCTCCGGCCCGGCCAGCCTCGG + Intergenic
1176580473 21:8470678-8470700 GGCTCCGGCCCGGCCAGCCTCGG + Intergenic
1179416586 21:41203428-41203450 GGCTCCACCACAGGCCGCCTTGG - Intronic
1179470271 21:41605648-41605670 GCCTCAGGCCCAGCCGGCCGTGG + Intergenic
1179742749 21:43427169-43427191 GGCCCCGCCCCGGCCCGCCCCGG + Intergenic
1179826295 21:43968265-43968287 TGCTCATCCCCAGCCCTCCTGGG - Intronic
1179881451 21:44294873-44294895 GTCTCACCCCCAGCCCTCCCTGG + Intronic
1179884404 21:44307279-44307301 GCCTCAGCCCCAGTCCCCGTGGG + Intronic
1179888315 21:44323956-44323978 GGCTCAGCCCCACCCCACAAGGG - Intronic
1179949875 21:44703548-44703570 GGCCCCACCCCAGCCCACCTAGG - Intronic
1180247099 21:46555391-46555413 GGCCCAGCCCCATCCAGCCCAGG - Intronic
1180341737 22:11625820-11625842 GGCTCCGGCCCGGCCAGCCTCGG + Intergenic
1180949278 22:19714084-19714106 CGCTCCGCCCCACCCCGCCGAGG - Intergenic
1181037995 22:20179130-20179152 GGGTCACCCTCAGCCCACCTAGG - Intergenic
1181571990 22:23772789-23772811 GCCCCACCCCCGGCCCGCCTCGG - Intronic
1181621184 22:24092258-24092280 AGCTCAGCCCCTGCCAACCTGGG - Intronic
1182445457 22:30387143-30387165 GGCTCCGCCCCGCCCCGCCCCGG + Exonic
1183451591 22:37898899-37898921 AGCCCCGCCCCTGCCCGCCTGGG - Intergenic
1183525446 22:38319764-38319786 GGCTCATCCCCAGGCCTGCTAGG + Intronic
1184040256 22:41938943-41938965 GGCCCAGGCTCAGCCCGCCGTGG - Exonic
1184487006 22:44785835-44785857 CCCTCAACCCCAGCCCACCTTGG + Intronic
1184656157 22:45943240-45943262 GACTCAGCCCGAGCCCGGGTGGG - Intronic
1184864323 22:47193948-47193970 GCCTCAGCCCCAACCCTCCCGGG + Intergenic
1185338878 22:50282924-50282946 GGACCAGCCCCAGCCCGACCAGG + Intronic
950008047 3:9704105-9704127 GCCCCAGCCCCAGCCAGCCGCGG + Intronic
950096958 3:10336058-10336080 GCCCCAGCCCCTGCCCGCCTGGG + Intronic
953246458 3:41198957-41198979 GGTTCAGCGCCCGCCCGTCTTGG - Intronic
953876070 3:46667582-46667604 GGCTCAGGCCTGGCCCTCCTGGG - Intergenic
954463506 3:50640978-50641000 GGCTCAGCACCAGCCATCCTTGG + Intronic
954801527 3:53189753-53189775 GCCCCAGCCCCAGTCAGCCTGGG - Intronic
954876582 3:53806368-53806390 GCCCCAGCCCCAGCCCCTCTAGG - Intronic
954878666 3:53819619-53819641 GGTTCATCCGCAGCCAGCCTGGG - Exonic
960110375 3:113839203-113839225 GTCTCAGCCCCAGGCCCCCTTGG + Intronic
960959748 3:123061895-123061917 GGTTTAGCCCCATCCCCCCTTGG - Intergenic
960989615 3:123301948-123301970 GGCTTGGCCCCAGCTCACCTAGG - Intronic
961403838 3:126665384-126665406 GGCGAAGCCCCTGCCTGCCTGGG - Intergenic
961520607 3:127465522-127465544 AGCTCAGCCCCAGCCAGCATTGG + Intergenic
962243564 3:133772001-133772023 GGCTCAGCACCAGCCCCTCCAGG + Intronic
962974462 3:140434035-140434057 AGGGCAGCCCCAGCCAGCCTGGG + Intronic
969313180 4:6366272-6366294 GTCTCAGCCCAGGCCCGCCAGGG + Intronic
969340171 4:6535494-6535516 GGCACAGCTCCAGCCAGCCCTGG + Intronic
969421052 4:7096012-7096034 GTCTCAGCCACAGCCAGCCATGG + Intergenic
969445000 4:7239612-7239634 GGCCCAGCCCCAGCTCCCCAGGG - Intronic
969502149 4:7559640-7559662 GGCTCAGACCCAGGCCCCCTTGG - Intronic
969613172 4:8238190-8238212 GGCCCCGCCCCACCCTGCCTGGG - Intronic
969622313 4:8284739-8284761 GGGTCTGCCCCAGGCAGCCTGGG - Intronic
975376947 4:73657321-73657343 GCATCAGCTCCAGCCAGCCTGGG - Intergenic
979166523 4:117539509-117539531 GGTTCAGCACCATCCCCCCTTGG + Intergenic
982329330 4:154163946-154163968 GGCTTAGCACCAGCTCCCCTTGG - Intergenic
984811306 4:183798131-183798153 CGCCCTGCCCCAGCCCGCCGCGG + Intergenic
985576488 5:675660-675682 GGCTGAGCCCCAGCCCTTGTTGG + Intronic
985760617 5:1746842-1746864 GGCTCTGCCCCGGCCCTCCCTGG - Intergenic
986708120 5:10468118-10468140 GGCTCAGCTCCAGCCCCCAGGGG + Intronic
988486036 5:31668924-31668946 GGTCCAGCCCCAGCCCCACTTGG - Intronic
998164884 5:139837277-139837299 AGCTCAGTCCCATCCCGCCCTGG + Intronic
999265483 5:150264462-150264484 GGCTCTGTCCCAGCCTGCCATGG + Intronic
999311078 5:150552649-150552671 GGCCCTGGCCCTGCCCGCCTTGG + Intronic
999670969 5:153959076-153959098 AGCTCAGCCCCTGCCCGCTCAGG + Intergenic
999718162 5:154378849-154378871 TCCTCAGCCCCAGCCCTCCTTGG + Intronic
1000738526 5:164934730-164934752 GGCATAGCCCCACCCCGCTTTGG + Intergenic
1001382066 5:171311662-171311684 GGTTCCCCCGCAGCCCGCCTGGG - Exonic
1001816311 5:174672112-174672134 GACTCAGCCCCACCCCGGCCTGG + Intergenic
1002070565 5:176676932-176676954 GGCTCAGACCCAGCCCCGCACGG + Intergenic
1002213088 5:177609841-177609863 GGCCCAGCCCAAGCCTGCCTTGG - Exonic
1005048944 6:21666308-21666330 CGAGCAGCCCCAGCTCGCCTCGG + Intergenic
1005499109 6:26414415-26414437 GCCTTAGACCCAGCACGCCTTGG + Exonic
1006443447 6:34065966-34065988 GCCTCCTCCCCAGCCCGCCCAGG + Intronic
1007630546 6:43270745-43270767 TGCTCAGTTCCAGCCTGCCTTGG - Intronic
1007749786 6:44064839-44064861 GGCTCAGCCCCTGCCCTCAGAGG + Intergenic
1009952526 6:70413601-70413623 GGGTCAGCACCATCCCGCCCCGG - Exonic
1010774020 6:79864522-79864544 GGCTCAGCTGCAGCCTGACTTGG + Intergenic
1010952926 6:82058269-82058291 TGCTCAGCCCCAGCCTGCTCAGG + Intergenic
1014183881 6:118413296-118413318 ACCTCAGCCTCAGCCTGCCTTGG - Intergenic
1016034174 6:139368870-139368892 GGCTCAGCCTCAACCTGCCTGGG + Intergenic
1017671850 6:156777229-156777251 GCCTTAGCCCAAGCCCGGCTGGG + Intergenic
1018774906 6:167005582-167005604 GCCTCACTCCCAGCCAGCCTGGG - Intronic
1018784524 6:167097894-167097916 GCATCGGCCCCAGCCAGCCTTGG - Intergenic
1019383335 7:739767-739789 GGATCCGCCCCTGCCGGCCTGGG - Intronic
1019418202 7:936943-936965 GGCCCAGCCCCAGCCCCACTGGG - Intronic
1019447960 7:1081217-1081239 AGCTCACCCCCACCCGGCCTAGG - Intronic
1019543231 7:1560725-1560747 GCTTCAGGCCCACCCCGCCTTGG - Intronic
1020016528 7:4834921-4834943 GGCCCAGCCCCTGCCCGCCCGGG - Exonic
1022339582 7:29455788-29455810 GGTTTACCCCCAGCCCGCGTGGG + Intronic
1023113850 7:36841213-36841235 GGCCAAGCCCCACCCCGCCCAGG + Intergenic
1023844844 7:44114790-44114812 GGCCCAGCCCCAGGCCTCCCAGG + Exonic
1024475391 7:49803456-49803478 TTCTCAGGCCCAGCCAGCCTGGG - Intronic
1025194808 7:56924432-56924454 GGCTGCGCTCCAGCCCGCATTGG - Intergenic
1025677144 7:63652511-63652533 GGCTGCGCTCCAGCCCGCATTGG + Intergenic
1025810140 7:64870366-64870388 GACTCACCCCCACACCGCCTAGG - Intronic
1025818553 7:64942764-64942786 CGCTCAGCCCCGGGACGCCTCGG + Intergenic
1026727237 7:72879476-72879498 CGCACAGCTCCCGCCCGCCTAGG - Exonic
1026850373 7:73719744-73719766 GGCCCCGCCCCACCCCGCCCGGG + Intergenic
1026873690 7:73868096-73868118 GCCTCTGCCTCTGCCCGCCTAGG + Intergenic
1027116592 7:75486158-75486180 CGCACAGCTCCCGCCCGCCTAGG + Exonic
1027275209 7:76549452-76549474 CGCACAGCTCCCGCCCGCCTAGG - Intergenic
1029159417 7:98541097-98541119 GGCTGAGCCCCTGTCCTCCTGGG + Intergenic
1029459238 7:100685936-100685958 GGCCCAGCCCCAGGCCCGCTGGG + Intronic
1029483758 7:100827325-100827347 GGCTCAGCCCCCGCCACCCGGGG - Exonic
1029483815 7:100827490-100827512 AGCTCAGCCCCTGCCCGGCCCGG - Exonic
1029681173 7:102111831-102111853 GGGTCAGCCCCTGACCGCCCCGG + Intronic
1029720917 7:102364002-102364024 CGCACAGCTCCCGCCCGCCTAGG - Exonic
1032117004 7:129126333-129126355 GCCTCAGCCCCAGCGCCCCTCGG + Intergenic
1032706155 7:134422738-134422760 ACCTCAGCTCCAGCCTGCCTGGG + Intergenic
1032787475 7:135211855-135211877 GCCGCACCCCCTGCCCGCCTCGG - Intergenic
1033224334 7:139548688-139548710 GGCCCAGCTCCAGCCTCCCTGGG + Intergenic
1034192738 7:149224131-149224153 GGCTCCGCCGCAGCCCGCCAGGG - Exonic
1036474338 8:9079623-9079645 GACTCAGCCCCAGGTAGCCTTGG + Intronic
1038017609 8:23528867-23528889 CGCTCCACCCCAGCCCGCCATGG + Exonic
1038326527 8:26576999-26577021 GGAGCAGCCGCAGCCCGCCGAGG - Intronic
1038425628 8:27462195-27462217 GCCCCACCCCCAGCCTGCCTGGG - Intronic
1042396019 8:68292759-68292781 GGCTCAGCCCAAGCCCTGCTAGG - Intergenic
1042695134 8:71547546-71547568 GCCCGAGCCCCAGCCCGCCCGGG - Exonic
1045583374 8:103501361-103501383 GGTTCAGCCCCAGTCCCGCTGGG - Intronic
1046754793 8:117962316-117962338 GGCACAGCACCAGGCCCCCTTGG - Intronic
1048540196 8:135335102-135335124 GGCTGAGCCCCAGGCAGACTGGG + Intergenic
1048994747 8:139787449-139787471 GGCTCTGCCCCTGCCCGGCAGGG - Intronic
1049646302 8:143737345-143737367 GGCTCTGGCCCAGCATGCCTGGG + Intergenic
1049683999 8:143932057-143932079 GGCCCCGCCCCGCCCCGCCTGGG + Intronic
1051590519 9:18772773-18772795 GCCTCAGGCCCAGCCAGCCATGG - Intronic
1051640535 9:19220803-19220825 TGATCTGCCCCTGCCCGCCTTGG + Intergenic
1051780578 9:20684398-20684420 AGCTCAGCCCCAGCCCCGCAGGG - Intronic
1052971031 9:34377184-34377206 GGCTCGGCCCCAGGCCTGCTGGG + Intergenic
1053363164 9:37503906-37503928 GGATCTGGCCCAGCACGCCTGGG + Intergenic
1056413382 9:86354190-86354212 GGCTCAGCCTCTGCCGGCCTGGG + Intronic
1057234257 9:93346275-93346297 GGCTCAGCCCGACCCTGCTTTGG - Exonic
1057786000 9:98087732-98087754 GCCTCGGCCGCCGCCCGCCTGGG - Exonic
1059942297 9:119369676-119369698 GGCTCAGCCCCAGCCCACCCGGG - Intergenic
1060214681 9:121731661-121731683 GCCCCAGCCCCAGCCCCACTGGG - Intronic
1060643970 9:125262175-125262197 TCCTCAGCCCCAGGCCGCCCTGG - Intronic
1060666041 9:125432781-125432803 GGGGCAGCCCCAGCCCTCCAGGG - Intergenic
1060786376 9:126454505-126454527 CGCCCAGCCCCAGGCCACCTGGG - Intronic
1060855870 9:126914860-126914882 GGCCCGGCCCCGGCCCGGCTCGG + Exonic
1061216613 9:129225402-129225424 GGCCCAGCCCCTGCCCTCATAGG + Intergenic
1061863231 9:133478557-133478579 GCCTGAGCCCCAGCTCCCCTGGG + Intronic
1061864779 9:133486443-133486465 GGCCCAGCCCCAGCCTCCCACGG - Intergenic
1062243244 9:135550768-135550790 GGCTCCGCCTCAGCTCACCTCGG - Intergenic
1062278858 9:135743149-135743171 GGCTCTGGCTCAGCCCACCTTGG + Intronic
1062472497 9:136712600-136712622 GCCTCAGCCCCGGCCCGGCCCGG - Exonic
1062584214 9:137241678-137241700 GACTCAGCCCCGGCCCGCCCGGG + Intronic
1062657473 9:137611765-137611787 GGCTCAGCCGCAGCCCCACGTGG - Intronic
1203790829 EBV:150798-150820 GTCGCAGACCCAGCCCTCCTCGG + Intergenic
1203361994 Un_KI270442v1:223958-223980 AGCTCCGGCCCAGCCAGCCTTGG - Intergenic
1190153984 X:47972991-47973013 GGTTTAGCACCATCCCGCCTTGG - Intronic
1190735058 X:53250597-53250619 GGCCCAGCCCCAGCCCCACCAGG - Exonic
1192169347 X:68844649-68844671 GAGTCAGCCCCAGCCTGCCTGGG + Intergenic
1195536609 X:106014614-106014636 GCCTCAGCCCCAGCACTGCTGGG + Intergenic
1196403588 X:115341480-115341502 GGGTCAGCCCCATCCTGACTAGG + Intergenic
1198242298 X:134797893-134797915 ACCTCTGCCCCACCCCGCCTGGG + Intronic
1198436507 X:136621835-136621857 GCCTCACCCTCACCCCGCCTTGG - Intergenic