ID: 929966897

View in Genome Browser
Species Human (GRCh38)
Location 2:46542968-46542990
Sequence GGCTCAGCCCCAGCCCGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 2, 1: 1, 2: 2, 3: 36, 4: 337}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929966897_929966908 -6 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
929966897_929966906 -8 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966906 2:46542983-46543005 GCTGAGCCCGGGGCCGGGGCGGG 0: 3
1: 1
2: 32
3: 298
4: 1571
929966897_929966915 4 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966915 2:46542995-46543017 GCCGGGGCGGGGGCTCCGGGGGG 0: 3
1: 1
2: 26
3: 133
4: 1098
929966897_929966913 2 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966913 2:46542993-46543015 GGGCCGGGGCGGGGGCTCCGGGG 0: 3
1: 4
2: 37
3: 217
4: 1422
929966897_929966921 26 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966921 2:46543017-46543039 GACCATGCCCGGAGGCCGGCCGG 0: 4
1: 0
2: 0
3: 7
4: 114
929966897_929966918 18 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966918 2:46543009-46543031 TCCGGGGGGACCATGCCCGGAGG 0: 4
1: 0
2: 0
3: 5
4: 71
929966897_929966917 15 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966917 2:46543006-46543028 GGCTCCGGGGGGACCATGCCCGG 0: 4
1: 0
2: 0
3: 17
4: 156
929966897_929966914 3 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966914 2:46542994-46543016 GGCCGGGGCGGGGGCTCCGGGGG 0: 3
1: 3
2: 20
3: 213
4: 1517
929966897_929966907 -7 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
929966897_929966911 0 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG 0: 3
1: 4
2: 59
3: 473
4: 2369
929966897_929966920 22 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966897_929966912 1 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966912 2:46542992-46543014 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914
929966897_929966905 -9 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966905 2:46542982-46543004 GGCTGAGCCCGGGGCCGGGGCGG 0: 3
1: 0
2: 12
3: 134
4: 1005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929966897 Original CRISPR GGCTCAGCCCCAGCCCGCCT GGG (reversed) Exonic