ID: 929966898

View in Genome Browser
Species Human (GRCh38)
Location 2:46542969-46542991
Sequence GGGCTCAGCCCCAGCCCGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 2, 1: 2, 2: 6, 3: 47, 4: 397}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929966898_929966905 -10 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966905 2:46542982-46543004 GGCTGAGCCCGGGGCCGGGGCGG 0: 3
1: 0
2: 12
3: 134
4: 1005
929966898_929966913 1 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966913 2:46542993-46543015 GGGCCGGGGCGGGGGCTCCGGGG 0: 3
1: 4
2: 37
3: 217
4: 1422
929966898_929966915 3 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966915 2:46542995-46543017 GCCGGGGCGGGGGCTCCGGGGGG 0: 3
1: 1
2: 26
3: 133
4: 1098
929966898_929966917 14 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966917 2:46543006-46543028 GGCTCCGGGGGGACCATGCCCGG 0: 4
1: 0
2: 0
3: 17
4: 156
929966898_929966912 0 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966912 2:46542992-46543014 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914
929966898_929966918 17 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966918 2:46543009-46543031 TCCGGGGGGACCATGCCCGGAGG 0: 4
1: 0
2: 0
3: 5
4: 71
929966898_929966920 21 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966898_929966921 25 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966921 2:46543017-46543039 GACCATGCCCGGAGGCCGGCCGG 0: 4
1: 0
2: 0
3: 7
4: 114
929966898_929966914 2 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966914 2:46542994-46543016 GGCCGGGGCGGGGGCTCCGGGGG 0: 3
1: 3
2: 20
3: 213
4: 1517
929966898_929966911 -1 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG 0: 3
1: 4
2: 59
3: 473
4: 2369
929966898_929966908 -7 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
929966898_929966906 -9 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966906 2:46542983-46543005 GCTGAGCCCGGGGCCGGGGCGGG 0: 3
1: 1
2: 32
3: 298
4: 1571
929966898_929966907 -8 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929966898 Original CRISPR GGGCTCAGCCCCAGCCCGCC TGG (reversed) Exonic
900192422 1:1357063-1357085 GGGCTGTGCCCCAGCCCCCGAGG + Intronic
900290362 1:1921128-1921150 GCCCTCACCCCCAGCCCCCCAGG - Intergenic
900368854 1:2322655-2322677 GGGCTCTTCCTCCGCCCGCCAGG - Intronic
900417348 1:2541121-2541143 GGGCTGCGTCCCAGCTCGCCTGG + Intergenic
900573139 1:3369593-3369615 GAGCTCAGCCACAGTCCGGCTGG - Intronic
900661056 1:3783961-3783983 GGGCCCGGCCCCACCCCACCAGG + Intronic
900713703 1:4130659-4130681 GGACTCAGCCCCAGCGACCCTGG + Intergenic
901058361 1:6460193-6460215 CGCCCCAGCCCCAGCCAGCCAGG + Exonic
901188300 1:7388945-7388967 GGGCCCTGCCCCAGTCCGGCAGG - Intronic
901454446 1:9355055-9355077 GGGCTCATCCCCCGACCCCCGGG - Intronic
901678750 1:10901425-10901447 GAGCTCAGGCCCCGCCCCCCAGG + Intergenic
901791305 1:11654853-11654875 AGGCCCCGCCCCGGCCCGCCAGG - Exonic
902600887 1:17539676-17539698 CGGCGCCGCCCCCGCCCGCCCGG - Intergenic
902755294 1:18545506-18545528 GGCCTCAGTCCCAGCCCCACTGG + Intergenic
902782277 1:18712363-18712385 GGCCTCAGCTCCAGCCCACAAGG + Intronic
902864414 1:19268977-19268999 GGACTCAGCCCCAGGCCTCCTGG + Intergenic
902866640 1:19284392-19284414 GGACTCAGCCCCAGGCCTCCTGG + Intronic
903237878 1:21962069-21962091 GGGCTCAGCCCATGCCCGGTAGG - Intergenic
903467533 1:23562437-23562459 AGACTCAGCCCCAGACAGCCTGG + Intergenic
904244941 1:29181347-29181369 GGGCACAGCTCCAGGGCGCCCGG - Intronic
904460024 1:30671029-30671051 GGACTCAGCCCCAGCACGGGGGG + Intergenic
904460970 1:30679641-30679663 GGGCACAGTCACAGCCCGGCTGG + Intergenic
904625628 1:31800291-31800313 GGGTTCGGCCCCAGCCTGCATGG - Intronic
904754807 1:32762556-32762578 GGGCTCAAGCCCAGCCTCCCAGG + Intronic
904783089 1:32964951-32964973 GAGCTCCGCCCCAGCTCGCTCGG - Intergenic
905151397 1:35930917-35930939 GGGCTCGGCCGTACCCCGCCGGG - Intronic
905280590 1:36846583-36846605 GAGCACAGCCCCAGCCTGTCTGG - Intronic
905703858 1:40040086-40040108 TGGGTCAGCCCCAGCCCGGCTGG - Intergenic
905704060 1:40040905-40040927 GGCCTCAGCCCCGGCCCTCTCGG - Intronic
906567666 1:46812432-46812454 GTGCTTAGCCCCAGGCTGCCAGG + Intronic
906611756 1:47208709-47208731 GGGCTCAGCCAGAGCCCGGCTGG - Intergenic
906678575 1:47709933-47709955 ATGCTCAGCCCCACCCCGCCCGG - Intergenic
907237526 1:53062336-53062358 GGGCTCAGCCCCCGGCCCCTCGG - Intronic
908166640 1:61465434-61465456 GGACTCAGACCCAGTCAGCCTGG + Intergenic
910682566 1:89882526-89882548 GGGCTCATCCCCTGCCCTCAGGG + Intronic
912514784 1:110210809-110210831 CTGCGCAGCCCCCGCCCGCCCGG + Intergenic
912560343 1:110547137-110547159 GGGCTCAGACCCAGACTGCCTGG - Intergenic
912716471 1:111987432-111987454 AGGCTCAGCCCCTGTCCCCCTGG + Intronic
914884886 1:151576726-151576748 GGGTTCAGCCTCAGCCTCCCAGG + Intronic
914984291 1:152442852-152442874 GGGCTCAGCCCATGCTCGCTGGG + Intergenic
916714763 1:167439523-167439545 GGGCTCAGCCCCAGGAGGCAGGG - Intronic
919451150 1:197775000-197775022 GACCGCACCCCCAGCCCGCCCGG + Intronic
920006278 1:202835928-202835950 GGGCTCCTCCCCAGCTCTCCAGG - Intergenic
920057268 1:203201845-203201867 AGGTTCAGCCCCAGTCTGCCAGG + Intergenic
920401690 1:205680273-205680295 CGGCGCAGCCCCATCCCGCGGGG + Intronic
920705042 1:208244426-208244448 GGGCGCGGCCCCAGCCCGGGCGG - Intergenic
922792234 1:228316907-228316929 GCGCCCAGCCCCACCACGCCGGG + Exonic
923083767 1:230685795-230685817 GTGCTGAGCACCAGCCCGGCGGG + Intronic
923146726 1:231203680-231203702 GGCTTCATCCCCAGCCCACCTGG + Intronic
924514069 1:244751701-244751723 GTGCTCAGCCCCAGCAAGGCGGG + Intergenic
1063043675 10:2370663-2370685 GGGCTCAGTTCCAGCACACCTGG - Intergenic
1063385767 10:5615690-5615712 AGGCCCAGCCCCATCCAGCCTGG + Intergenic
1065579147 10:27154270-27154292 GGGCTCAGCGCCTCCCCGCCGGG - Exonic
1065625598 10:27625679-27625701 GGGCTCAGCGCAAGCCAGCCTGG - Intergenic
1067026480 10:42847492-42847514 GGGGTCAGCCCCTGCCAGGCCGG + Intergenic
1068071918 10:52206685-52206707 GGGCTCAGCCCAAACACTCCTGG + Intronic
1069535249 10:69248309-69248331 GGGCTGAGCCCCGCCCCGCAGGG + Intronic
1069744336 10:70705417-70705439 GCCCTGAGCCCCAGCCCGGCTGG - Intronic
1071465846 10:85939083-85939105 TTGCTCAGTCCCAGGCCGCCTGG + Intronic
1071507383 10:86240930-86240952 GGGCTCTGACCCAGCCTGGCAGG - Intronic
1072277620 10:93838460-93838482 GGATTCAGACCCAGCCTGCCTGG - Intergenic
1072757381 10:98030235-98030257 CGCCTCACCCCCAGCCCGCGGGG + Intronic
1073327555 10:102651330-102651352 GGGCTGAGCCCCACCCCCCCAGG + Intronic
1073380104 10:103071900-103071922 GGGAGCAGACCCAGCCAGCCAGG - Intronic
1074363048 10:112838154-112838176 GGGCTTGGCCCCAGCCCTCTTGG - Intergenic
1074759299 10:116654490-116654512 GGGCCCAGTCCCAGCTCCCCAGG - Intergenic
1074772432 10:116742630-116742652 GGGCCCCGCCCCGGCCCGCCCGG + Intergenic
1074866404 10:117546616-117546638 GGGCTCCGCACAAACCCGCCAGG - Intronic
1075031868 10:119029541-119029563 GCGCTCCGCTCCAGCCCGCGCGG - Intergenic
1075949322 10:126463325-126463347 GGGCTGAGGCCCAGCCGGCAAGG - Intronic
1076119353 10:127923093-127923115 GGGCTGAGCACCAGCTCTCCAGG - Intronic
1076737009 10:132463403-132463425 GGGCCCAGCCCCCCACCGCCTGG - Intergenic
1076878666 10:133229825-133229847 GGGCTCAGCACCTGCACGCGAGG - Intergenic
1077090833 11:777534-777556 CGGCTCCGCCCCCGGCCGCCAGG - Intergenic
1077178837 11:1203322-1203344 CGGCCCAGCCCAAGCCCTCCAGG - Intergenic
1077240688 11:1508879-1508901 AGGAGCAGCCCCTGCCCGCCCGG - Intergenic
1077328669 11:1974483-1974505 GGCCCCAGCCCCATCCGGCCGGG - Intronic
1077417652 11:2432370-2432392 GGGCCCAGCCCCTGCCCCCACGG + Intergenic
1077484002 11:2830611-2830633 GGGCTGGCCCCCAGCCTGCCTGG - Intronic
1077491452 11:2862722-2862744 GCCCTCGGCCCCAGCACGCCCGG - Intergenic
1077498367 11:2897544-2897566 GGGCTCTGTCCCAGCACCCCAGG - Intronic
1077672059 11:4166287-4166309 GAGCTCAGCCTCAGCCATCCAGG - Intergenic
1081670868 11:44941827-44941849 GCGCTCAGCCACTGCCCACCAGG + Intronic
1081998256 11:47378103-47378125 GGGCCTGGCCTCAGCCCGCCAGG + Intronic
1083198517 11:61105200-61105222 CCTCTCAGCCCCAGCCTGCCTGG + Intronic
1083765778 11:64840779-64840801 GGGCTCAGTCGCAGCCAGACAGG - Intronic
1083859222 11:65411167-65411189 GGGCTCAGGCCCAGGAAGCCAGG - Intronic
1083902217 11:65649181-65649203 AGCCCCACCCCCAGCCCGCCAGG - Intronic
1084112439 11:67022990-67023012 GGACTCAGAGCCAGCCGGCCTGG - Intronic
1084146569 11:67268041-67268063 GGCCCCATCCCCAGCCCGCTGGG - Intronic
1084531770 11:69731613-69731635 GGGGTCTGCCCCATCCCTCCAGG - Intergenic
1088116245 11:106317388-106317410 GGGGTCAGCCCCCACCCGGCAGG - Intergenic
1090036314 11:123252666-123252688 AGGCTCAGGTCCAGCCCTCCAGG - Intergenic
1091006080 11:131955168-131955190 AGCCTCAGCCTCAGCCCGCTTGG + Intronic
1091286104 11:134409408-134409430 TGGCCCTGCCCCAGCCCTCCTGG - Intronic
1202811648 11_KI270721v1_random:29662-29684 GGCCCCAGCCCCATCCGGCCGGG - Intergenic
1091605763 12:1949916-1949938 GGGCTGAGCAACAGGCCGCCCGG - Intronic
1091837057 12:3593425-3593447 GGGCCCAGCCACAGCACGCCAGG - Exonic
1094460784 12:30695448-30695470 GGCGTCAGCCCCAGCCCGGTGGG + Intronic
1096472419 12:51888049-51888071 CGGCTCAGGCCCCGCCCACCCGG + Exonic
1096606832 12:52772650-52772672 GGACTCAGCTCCACCCCACCTGG - Intronic
1097127988 12:56789493-56789515 GGGGTCAGCCCCCCCCCGCCCGG - Intergenic
1098560955 12:71871687-71871709 GGGCTCAAGCCCAGCCTCCCAGG + Intronic
1102033616 12:109758789-109758811 GGGCCTGGCCCCAGCTCGCCAGG - Intronic
1102651754 12:114447434-114447456 GGGCGCAGCCGGAGACCGCCCGG + Intergenic
1103443681 12:120980551-120980573 AGGCCCAGCCCCACCCCGTCAGG - Intronic
1103443759 12:120980848-120980870 GGTCTGAGCCCCCGCCCCCCTGG - Intronic
1103446709 12:120999606-120999628 CGGCTCAGCGCCAGCCCCACAGG + Exonic
1103741347 12:123093865-123093887 GGGCTCTGGCCCAGGCCTCCTGG - Intronic
1103779454 12:123389262-123389284 GGGCTCCGGCCCGGCCCTCCCGG + Intronic
1104634037 12:130426702-130426724 GGGCTGAGCCCCACCCCCACAGG - Intronic
1104758584 12:131283948-131283970 GCGCTCAGCCCCAGCGAGGCCGG - Intergenic
1104822060 12:131682636-131682658 GCGCTCAGCCCCAGCGAGGCTGG + Intergenic
1104846477 12:131849750-131849772 GGGCTCGGCCCCACCCCGAAGGG - Intronic
1105006397 12:132723523-132723545 GGGAGCAGCGCCAGCACGCCTGG + Intergenic
1106193626 13:27475255-27475277 AGGCTCAGCCCCAGCCCACCTGG + Intergenic
1106498641 13:30306870-30306892 GCGCTCAGCCCCACCCCGGCTGG - Intronic
1107086462 13:36432046-36432068 GCGGTCAGCCCCACCTCGCCCGG + Intronic
1108708963 13:53015018-53015040 GGGCCCTGCCTCAGCCCGGCAGG + Intergenic
1113598107 13:111548486-111548508 GGGCTCAGCCACAACCCGGGAGG - Intergenic
1114174280 14:20305725-20305747 GGGTGCAGCCGCAGCCAGCCAGG - Intronic
1114427970 14:22637906-22637928 GGGGTCAGCCCCCGCCCGGCCGG + Intergenic
1114494820 14:23125577-23125599 GGGGCCAACCCCAGCCTGCCGGG + Exonic
1114646089 14:24257037-24257059 GGGCTCAGGGCCAGCCAGACTGG - Intronic
1116817905 14:49599913-49599935 GGGCTCAGCCTCAGCCCGCCTGG - Intronic
1118309605 14:64682663-64682685 GGGCTGGGCCCCGGCCAGCCTGG - Intergenic
1121242323 14:92439778-92439800 GGGCCCACCCCCACCCCGCCAGG + Intronic
1122810196 14:104284008-104284030 TGGCCCAGCCCCAGCCAGGCAGG - Intergenic
1122813692 14:104301811-104301833 GGGATCCGCCCCAGGCCGCATGG + Intergenic
1122969906 14:105148287-105148309 GGGGGCAGCCCCAGGCGGCCAGG + Intronic
1123058146 14:105582030-105582052 AGGCCCAGCCCCAACCAGCCCGG - Intergenic
1202848114 14_GL000009v2_random:200140-200162 GGGGTCAGCCCACGCCCGGCCGG + Intergenic
1125499775 15:40232357-40232379 CATCTCAGCCCCAGCCCACCAGG - Intergenic
1127390008 15:58497745-58497767 GGGCTGAGCTCCTGCCAGCCAGG - Intronic
1127507904 15:59612618-59612640 GGGCGCAGTCCCAGACTGCCTGG - Intronic
1127916767 15:63461273-63461295 GGGCCCAGCCCCAGCGGGTCAGG + Intergenic
1128751715 15:70154833-70154855 GGGCTCAGCCCCTGCCCTGGAGG + Intergenic
1129404688 15:75308195-75308217 GGGTTCAGCTCCAGCCTTCCTGG - Intergenic
1129666674 15:77583104-77583126 GGGCTCCTCCCCAGCCTCCCTGG + Intergenic
1129893755 15:79089385-79089407 AGGCTCACCCCCACCCCGCCCGG + Intronic
1130787302 15:87114537-87114559 GGGCCCAGCCGGAGACCGCCAGG + Intergenic
1131827235 15:96331397-96331419 GGCCTCCGCCCCGGCCTGCCTGG + Exonic
1131827677 15:96333572-96333594 AGCCCCAGCCCCAGCCCGGCGGG - Intronic
1132022309 15:98373247-98373269 GGGCTCAGCACCAGCCAGCAAGG - Intergenic
1132468036 16:86614-86636 GGGCTCAGCCTCAGCACGGGGGG + Exonic
1132570439 16:641839-641861 GGGGTCAGCCCGAGCCCGTGCGG + Exonic
1132585930 16:705734-705756 GGGCACAGCCTCAGCCTCCCCGG - Exonic
1132691690 16:1184458-1184480 GGGCTCATCACCTGCCGGCCTGG + Intronic
1132855726 16:2043845-2043867 AAGCTCAGCCCCCGCCCCCCAGG + Intronic
1132929057 16:2449398-2449420 CGCCTACGCCCCAGCCCGCCTGG + Exonic
1136022524 16:27449100-27449122 GGGCTCACCCCTGGCCGGCCTGG + Exonic
1136383292 16:29907021-29907043 GGGCCCAGACCCAGCCCTCCTGG - Exonic
1137624613 16:49899932-49899954 GAGCTGAGCCCCAGCCCGAGAGG + Intergenic
1137774861 16:51046167-51046189 GGACTCAGACCCAGGCCTCCAGG - Intergenic
1138560483 16:57798117-57798139 CGCCCCAGCCCCAGCCAGCCCGG - Exonic
1139871850 16:70114396-70114418 GCGCTCAGCTACAGCCCGGCGGG - Exonic
1140364078 16:74368087-74368109 GCGCTCAGCTACAGCCCGGCGGG + Intergenic
1141179016 16:81739676-81739698 GGATTCAGCCCCAGGCCGTCTGG - Intronic
1141695509 16:85617255-85617277 GGACTCCGCCCCAGCCTCCCGGG - Intronic
1141701231 16:85643018-85643040 AGGCTCAGGCCCACCCCGCCAGG - Intronic
1141738432 16:85871972-85871994 GAGATCAGCCCCAGGCTGCCAGG - Intergenic
1141971528 16:87487400-87487422 GGGCCCCGCCCCTGCCCACCAGG + Intronic
1142148320 16:88501867-88501889 GGGATCAACCCCAGCCCGCGAGG + Intronic
1142411800 16:89920784-89920806 GGGCTCAGCCCCATACCACTAGG - Exonic
1142440335 16:90094100-90094122 GGGCCCAGCCCGGGCCTGCCGGG + Intergenic
1142837061 17:2594496-2594518 CGGCTCAGCCCCGCGCCGCCGGG + Intronic
1143017093 17:3896666-3896688 TGGCTCAGCCCCAGCTCCCAAGG - Exonic
1143166640 17:4900287-4900309 GGGCCCAGCCCCAGACGGCAGGG + Exonic
1143517509 17:7427154-7427176 GGGCTGAGGCTCTGCCCGCCTGG + Exonic
1143667758 17:8374044-8374066 GGGGGCAGCCCCCGCCCGGCCGG + Intronic
1143894875 17:10128077-10128099 GGGCTCGGCCCTACCCCGGCTGG + Intronic
1144056597 17:11548042-11548064 GGGCCTAGCGCCAGCCTGCCTGG + Intronic
1144768498 17:17746033-17746055 GGGCTCAGCCCCTGCCTACCAGG + Intronic
1145248182 17:21283552-21283574 GGGGTCAGCCCCTGGCCTCCAGG - Intergenic
1145249717 17:21290410-21290432 GGGGTCTGCCCCAGCCATCCGGG - Intronic
1146654273 17:34626144-34626166 CCGGCCAGCCCCAGCCCGCCGGG + Exonic
1146924515 17:36735010-36735032 GAGATGAGGCCCAGCCCGCCAGG - Intergenic
1147044741 17:37744275-37744297 CGGCCCAGCCCCAGCCCCGCGGG + Intronic
1147187994 17:38722893-38722915 GGGCCCAGCCCCAGTCCCACAGG - Intronic
1147636311 17:41966720-41966742 CGGCCCGCCCCCAGCCCGCCCGG + Exonic
1147753987 17:42756059-42756081 AGGATCAGCCCCTGCCAGCCAGG + Intergenic
1147980497 17:44271095-44271117 GGGCTCTGCTCAAGCCCTCCAGG - Intergenic
1148029253 17:44608520-44608542 GGCCTCAGCCCCAGCATTCCTGG + Intergenic
1148850970 17:50555166-50555188 GGGCTGAGCCCTAGACCACCAGG - Intronic
1150141941 17:62737602-62737624 TGGCCCAGCCCCAGCCAGTCAGG + Intronic
1150779504 17:68109218-68109240 GCACTCAGCCTCAGCCTGCCTGG + Intergenic
1151685393 17:75643274-75643296 GGCCTCAGCCTCAGCCGCCCTGG - Intronic
1151825761 17:76523355-76523377 GCTCACAGCCCCAGCTCGCCCGG + Intergenic
1152037228 17:77880858-77880880 GGGCTCTGGGCCAGCCTGCCTGG + Intergenic
1152307615 17:79530466-79530488 GGGCTCAGCGACAGCTCACCCGG + Intergenic
1152532056 17:80924519-80924541 CTGCTCAGCCCCAGCCCACCTGG + Intronic
1152598536 17:81249905-81249927 AGGCTCAGCCACAGCCCCTCAGG - Intronic
1152605315 17:81286633-81286655 GGGCCCAGCCCCTGCCAGGCTGG + Intronic
1152736539 17:82000094-82000116 GGGGTCAGCCCCTGCTCACCCGG - Intronic
1152801062 17:82330876-82330898 GGTCTCAGCCCCTGGCGGCCTGG + Intronic
1152957223 18:49458-49480 GGGCCCAGCCCGGGCCTGCCGGG - Intronic
1154031706 18:10758863-10758885 GGGCTGAGGCCAAGCCTGCCTGG + Intronic
1154115256 18:11608757-11608779 GGGGTCAGCCCCCGCCCGGCCGG + Intergenic
1154332926 18:13444328-13444350 GGGCTTAGCCCCTGCACGCCTGG - Intronic
1155054031 18:22169817-22169839 GGGAGCCGCCTCAGCCCGCCCGG - Intronic
1157514931 18:48304087-48304109 GGGCTCTGGCCCAGACCCCCTGG - Intronic
1158606280 18:58899001-58899023 GGGCTCTGCCCCGGCCTGCGTGG - Intronic
1158664452 18:59420129-59420151 GCCCACAGCCCCAGCCCCCCTGG - Intergenic
1160425105 18:78773905-78773927 GTGCCCAGCCCCAGCCCCCACGG + Intergenic
1160780810 19:877207-877229 GGGCGCAGCCCCATCTCACCGGG - Intronic
1161011002 19:1959443-1959465 GGGCTCAGCCGCAGCCTGTAGGG - Intronic
1161707812 19:5830192-5830214 GGGCGCGGGCCCAGCCCACCAGG + Intergenic
1161725974 19:5929308-5929330 GGGCTAATCCCCAGCCCCACTGG + Intronic
1162520369 19:11175975-11175997 GGGCTTAGCTCCATCCTGCCAGG + Exonic
1162567308 19:11451599-11451621 GGGCTGAGCCCCCTCCCCCCTGG + Exonic
1162797713 19:13095303-13095325 GGGGTCACCCCCTGCCCGCCTGG - Exonic
1163038078 19:14583212-14583234 GGCCCCAGCCCCAGCCTGGCCGG - Intronic
1163727200 19:18929446-18929468 GGGCGCAGCCTCAGCCAGGCGGG + Exonic
1163733183 19:18961934-18961956 AGCCCCAGCCCCAGCCCACCCGG - Intergenic
1164668951 19:30062356-30062378 GGGCTGATCCCCAGGCCCCCAGG - Intergenic
1165096116 19:33410811-33410833 GGGCTCAGCCACAGCCACGCAGG - Intronic
1165213898 19:34255200-34255222 ACGCTCAGCCCCGGCCCTCCCGG - Intronic
1166694474 19:44844879-44844901 GAGCCCAGCCCCACCCAGCCCGG + Intergenic
1166930595 19:46299073-46299095 GGCCTCACCCTGAGCCCGCCAGG + Intronic
1167119570 19:47508417-47508439 GGGCTCAGGCCCCGCCCTGCAGG - Intronic
1167390787 19:49193610-49193632 GGGCTCAGCCCCAGCCTCTCTGG - Intronic
1167428437 19:49441468-49441490 GGGTCCAGCCCCGGCCCGGCCGG + Exonic
1167451338 19:49571602-49571624 GGACTCAGACCCAGGCAGCCAGG + Intronic
1167955201 19:53058500-53058522 GGGCTCCGCCCCAGGCTACCCGG - Intergenic
1168097424 19:54123678-54123700 GTGCCCAGCCCCAGCCCTCTCGG - Intronic
1168717690 19:58538853-58538875 GGGCTGAGGCCCACCCCCCCGGG + Intronic
925260012 2:2520758-2520780 CTGCTCAGCCCCAGACAGCCCGG - Intergenic
926929386 2:18022397-18022419 GGGCCCAGTCCCAGCCACCCAGG - Intronic
927101236 2:19789272-19789294 GGGCTCAGTCCCAGAACACCTGG + Intergenic
927142472 2:20139767-20139789 GCCCGCAGCCCCAGCCCCCCAGG - Intergenic
927150265 2:20191515-20191537 GGGCACAATCCCTGCCCGCCAGG - Intergenic
927852829 2:26510815-26510837 GGCCTCAGCCCCGGCCCCACGGG + Intronic
929188821 2:39121157-39121179 GAGCGCAGCCACAGCCCGGCCGG - Intronic
929556134 2:42926756-42926778 AGGCCCAGGCCCAGCCAGCCTGG - Intergenic
929966898 2:46542969-46542991 GGGCTCAGCCCCAGCCCGCCTGG - Exonic
930024174 2:47020386-47020408 CAGCTCAGCCTCAGCCGGCCAGG - Intronic
930727890 2:54699151-54699173 GGGGTCGGCCCCCGCCCGGCCGG + Intergenic
932374838 2:71226709-71226731 GGGGTCAGCCCCTGCCCCTCGGG - Intronic
932715794 2:74100182-74100204 GGCCCCAGCCCCAGCCCCACTGG - Intronic
933133462 2:78701802-78701824 GGGCTCGCCCCCCGCCCCCCCGG - Intergenic
933655212 2:84881134-84881156 GGGCTCACCCCAGCCCCGCCCGG - Exonic
934558438 2:95299810-95299832 GGGCTCTGCCTCAGCCCTCCAGG + Intronic
934653893 2:96107568-96107590 GGGCACAGACCCAGCCCTGCTGG + Intergenic
934993315 2:98936322-98936344 GGTCTCGGCCCCACTCCGCCGGG - Intergenic
935781053 2:106509632-106509654 GGGCTCAGCTCCGGCCACCCAGG + Intergenic
937883761 2:126886579-126886601 GGGCTCTGCCCCTGCCTTCCCGG + Intergenic
938301065 2:130213547-130213569 GGGCTCAGCCCCAGCCCGCCTGG + Intergenic
938408801 2:131047137-131047159 GGGCTCCACGCCAGCTCGCCAGG - Exonic
938455654 2:131460921-131460943 GGGCTCAGCCCCGGCCCGCCTGG - Intergenic
938555074 2:132416736-132416758 GGTCTCACTCCCAGCCAGCCAGG + Exonic
938903434 2:135817630-135817652 GGGAGCAGCCCCAGCCTCCCAGG - Exonic
941197615 2:162470577-162470599 GGGGTCAGCCCCCGCCAGGCCGG + Intronic
943648287 2:190430829-190430851 GGGGTCAGCCCCCGCCCGGCCGG - Intronic
946196158 2:218033988-218034010 CGTCTCCGCCCCTGCCCGCCGGG - Intergenic
946362766 2:219229144-219229166 GAGCCCAGGCCCAGCCGGCCGGG - Exonic
946365263 2:219245252-219245274 GGGCTCGGCCCGAGGCCCCCAGG - Exonic
947472461 2:230411973-230411995 GGGCTCCGCCCCCGCCCGGCCGG - Intergenic
947765204 2:232633487-232633509 GGGCTCAGCGACTGCCAGCCTGG - Exonic
947815208 2:233032157-233032179 GGCCTCAGCCTCAGGCAGCCTGG + Intergenic
948392920 2:237625727-237625749 GGGGTCAGCGCCTGCCCTCCTGG + Intergenic
948912300 2:241010741-241010763 GGGCTCACACACAGGCCGCCTGG - Intronic
1169500689 20:6157891-6157913 GGGCCCAGTCCCAGCACCCCAGG - Intergenic
1171034727 20:21705935-21705957 GGGCCCAGCCCCGGCCACCCCGG + Exonic
1171767352 20:29297567-29297589 CGGCACAGCCCCGGCCGGCCGGG + Intergenic
1171811365 20:29746083-29746105 GAGCTCTGGCCCAGCCAGCCTGG - Intergenic
1172279983 20:33701599-33701621 GGGGTCAGCCCCCGCCCGGCTGG + Intergenic
1172516758 20:35540273-35540295 GGGCTCAACCCCAGCCTCCCAGG + Intergenic
1173658825 20:44719134-44719156 GGGCTCAGCCCCAGCCCTCTGGG - Intronic
1173662278 20:44742931-44742953 TGGCTCAGCCACAGCCTGGCTGG + Intergenic
1173741725 20:45406633-45406655 AGGCGCAGCCCCACCCCGGCCGG + Intronic
1174157418 20:48524790-48524812 GGGCTCACCCCAAGTCCCCCAGG + Intergenic
1174298152 20:49563259-49563281 GGGCTCACCCACAGGCCTCCAGG + Intronic
1174586043 20:51609131-51609153 GCCCTCAGCCCCAGCCCCACTGG - Intronic
1174800636 20:53560486-53560508 AGGCTCAACCCCACCCCGCCTGG + Intergenic
1175266863 20:57708722-57708744 GGGCTCAGCTCTGGCCCGTCTGG - Intronic
1175582619 20:60112365-60112387 GGCCTCAGCTGCAGCCCACCCGG - Intergenic
1175969243 20:62675584-62675606 GGTCCCGGCCCCAGCCCCCCAGG + Intronic
1176025910 20:62985570-62985592 GGAGTCCTCCCCAGCCCGCCCGG - Intergenic
1176131427 20:63498347-63498369 GGGCTCTGGCCCAGCCTGCCGGG - Intronic
1176218499 20:63959204-63959226 GTGCTCAGGCCCTGCCCCCCAGG - Exonic
1179359231 21:40689957-40689979 TGGCTCAGCCCCAGCCAGTGTGG + Intronic
1179655472 21:42841938-42841960 GGGCTCAGCCACTGCCCTGCAGG - Intergenic
1179781437 21:43703411-43703433 GGTCACAGCCCCACCTCGCCGGG + Intergenic
1179826296 21:43968266-43968288 CTGCTCATCCCCAGCCCTCCTGG - Intronic
1179888316 21:44323957-44323979 AGGCTCAGCCCCACCCCACAAGG - Intronic
1179985670 21:44919255-44919277 GGGCTCAGCCGCCGCCCTGCAGG + Intronic
1180695638 22:17749996-17750018 GGGCTGAGGCTGAGCCCGCCTGG - Intronic
1180695640 22:17750002-17750024 GGGCTCAGCCTCAGCCCTCAGGG + Intronic
1180891381 22:19291571-19291593 GGGCAGCCCCCCAGCCCGCCGGG + Intronic
1180929539 22:19579477-19579499 GGCCTCTGCCCCAGCTGGCCTGG + Intergenic
1181014900 22:20063260-20063282 GGGTCTAGCCCCAGCCCACCTGG - Intronic
1181162026 22:20965068-20965090 GGGCCCAGCACCGCCCCGCCGGG - Intergenic
1181532812 22:23526682-23526704 CGGCTCAGCCCCAGGCCTCTGGG + Intergenic
1182355503 22:29720738-29720760 CGGCCCAGCCCCTGCCCGCGTGG + Intronic
1183360029 22:37378653-37378675 GGGCCCAGCCCAAGCCATCCTGG - Intronic
1183424901 22:37734239-37734261 GGTCTCTGCCCCACCCCTCCGGG - Intronic
1183440103 22:37818226-37818248 GGGCTCTGGCCCAGCCCTGCAGG + Intergenic
1183451592 22:37898900-37898922 GAGCCCCGCCCCTGCCCGCCTGG - Intergenic
1184663063 22:45974449-45974471 AGGCTCAGCCCCTGCCCGCCAGG - Intronic
1184864322 22:47193947-47193969 TGCCTCAGCCCCAACCCTCCCGG + Intergenic
1185052190 22:48559727-48559749 GGGCACAGCCCGAGCCAGGCAGG + Intronic
1185082882 22:48719326-48719348 GGGCTCTGGCCCAGGCAGCCAGG - Intronic
1185241222 22:49748761-49748783 GGGCTCAGCCCCAGCCCCAGAGG + Intergenic
1185241237 22:49748813-49748835 GGGCTCAGCCTCAGCCCCAGAGG + Intergenic
949920289 3:8994653-8994675 GTCCTGAGCCCCAGCCCACCAGG - Intronic
950096957 3:10336057-10336079 TGCCCCAGCCCCTGCCCGCCTGG + Intronic
950201933 3:11050663-11050685 GGGCTCAGCTCCAACTCACCTGG + Intergenic
953024260 3:39135653-39135675 GGACTCAGACCCAGGCAGCCTGG - Intronic
954329847 3:49884066-49884088 GGCCTCAGCCCCAGCCTTTCAGG - Intergenic
954863275 3:53708020-53708042 GGGCACTGCCCCTGCCTGCCCGG + Intronic
954878667 3:53819620-53819642 GGGTTCATCCGCAGCCAGCCTGG - Exonic
956678091 3:71753908-71753930 GGGCTCAGCCCGCTCCCGGCCGG - Intronic
959591863 3:108090781-108090803 GGGCTGCGCCCCAGCCAGCCCGG - Intronic
960702480 3:120451313-120451335 GGCCACCGCCGCAGCCCGCCCGG - Intergenic
961464418 3:127072679-127072701 GGGCTGAGCCCAAGACCCCCTGG - Intergenic
961472509 3:127125002-127125024 GGGCTCCAGCCCAGCCCTCCTGG + Intergenic
962245278 3:133785626-133785648 GGGGTCAGCCCCCCCCCGCCCGG + Intronic
962974461 3:140434034-140434056 GAGGGCAGCCCCAGCCAGCCTGG + Intronic
963834233 3:150040276-150040298 GGGCTCTGTGCCAGCCCACCAGG - Intronic
966372156 3:179261416-179261438 GGGCCAAGAGCCAGCCCGCCGGG + Intronic
968581356 4:1396864-1396886 GCGCTCAGCCACAGCCTCCCAGG + Intergenic
968653226 4:1768026-1768048 GAGCTCAGCCCCAGGTCGCTGGG + Intergenic
968872429 4:3248666-3248688 GGGCCCAGCCCCAGGACCCCAGG + Exonic
969313179 4:6366271-6366293 GGTCTCAGCCCAGGCCCGCCAGG + Intronic
969445001 4:7239613-7239635 GGGCCCAGCCCCAGCTCCCCAGG - Intronic
969485573 4:7470740-7470762 GGCCCCAGCCCCAGCCTGCATGG + Intronic
969620209 4:8275157-8275179 GGTCTCAGCTCCAGTCCGGCTGG - Intronic
969622314 4:8284740-8284762 GGGGTCTGCCCCAGGCAGCCTGG - Intronic
971043335 4:22778738-22778760 GGCCTCAGCCGCCTCCCGCCCGG - Intergenic
972166594 4:36292746-36292768 GGGCTCTGCCCCAGCATGCGTGG - Intronic
973386153 4:49515615-49515637 GTGCTCACCCCCAGCCCTCAGGG + Intergenic
976030134 4:80741884-80741906 GGGATCAGCCCTAGCCAGACAGG - Intronic
978224940 4:106321579-106321601 GGGGGCAGCCCCCGCCCGGCCGG + Intronic
979942522 4:126779722-126779744 GGGCCCCGCCCCAGACAGCCAGG + Intergenic
983026075 4:162739598-162739620 CCGCTAAGCCCCCGCCCGCCCGG - Intergenic
985441497 4:189984772-189984794 GGGCCCAGCCCGGGCCTGCCGGG - Intergenic
985484060 5:139176-139198 GGCCACAGCCACAGCCCACCAGG - Intergenic
985491935 5:185432-185454 GGGCACAGCCCCTGCCTCCCAGG - Exonic
985515818 5:344080-344102 GAGCTCAGCCCCGGCCCGCCCGG - Intronic
985600723 5:828440-828462 GGGGTCAGCCCCCACCCGGCCGG - Intronic
985963790 5:3324587-3324609 GGACCCAGCCCCACCGCGCCGGG - Intergenic
986012184 5:3726151-3726173 GCGCTCAGACAGAGCCCGCCTGG + Intergenic
986708119 5:10468117-10468139 CGGCTCAGCTCCAGCCCCCAGGG + Intronic
987582954 5:19820024-19820046 GGGCTTAGTCCCAACCCTCCAGG + Intronic
989178724 5:38556235-38556257 GAGCGCTGCCCCACCCCGCCCGG + Intronic
989750241 5:44884156-44884178 GTGCTAAGCCCCTGCCTGCCCGG + Intergenic
990553790 5:56909890-56909912 GGCCTCAGTCCCCGCCCACCCGG - Intronic
991435716 5:66596134-66596156 GGGCTCCGCCCCCACCCTCCGGG + Intergenic
992450062 5:76868159-76868181 AGCCTCAGCCCCTGCCCTCCAGG - Intronic
993841347 5:92883677-92883699 GGGCTCAGACCAAGCCTCCCAGG + Intergenic
995479855 5:112583021-112583043 GGGCTGAGCCACAAACCGCCTGG + Intergenic
997716898 5:136049239-136049261 GGCCTGAGCTCCAGCCAGCCTGG - Intronic
998117557 5:139549562-139549584 GGCCTCAGCACCTGCCCGCAGGG + Intronic
998374584 5:141682272-141682294 GGGCCCAGCCCCGCCCCGCCCGG + Intergenic
999893260 5:156001806-156001828 GGGCGGAGCCCCAGTCCTCCTGG + Intronic
1000630191 5:163583670-163583692 GGGGTCAGCCCCCGCCCGGCCGG - Intergenic
1001258165 5:170201127-170201149 GGGCTCAGCACCCTCCCTCCTGG - Intergenic
1001897485 5:175393985-175394007 GGGCTGAGCCCAAGCCTGTCTGG - Intergenic
1002140427 5:177134146-177134168 GGGCTCAGGCCTAGCTGGCCGGG + Intronic
1002597686 5:180334873-180334895 GTGGTCAGCCCCAGGGCGCCGGG - Intronic
1004044471 6:12011839-12011861 GGCCTCAACCCCAGCCCCCGCGG + Intronic
1006386607 6:33734562-33734584 GGGCTCAGCCACACTCTGCCAGG - Intronic
1006832194 6:36975774-36975796 GGGCTCAGCCCCACACCAACGGG - Intronic
1008537671 6:52519187-52519209 GGGCACAGCCCCTGCCCTCTTGG + Intronic
1009724935 6:67526389-67526411 GGGCACAGCCTCAGCTTGCCTGG + Intergenic
1010883996 6:81215042-81215064 GGGCTCAGCCTCAACCCCACCGG - Intergenic
1013225541 6:108117708-108117730 GGGCACTGCCCCACCCAGCCCGG + Intronic
1016034173 6:139368869-139368891 AGGCTCAGCCTCAACCTGCCTGG + Intergenic
1019418203 7:936944-936966 AGGCCCAGCCCCAGCCCCACTGG - Intronic
1019429216 7:991017-991039 GGACTCAGGCCCCGCCCTCCCGG + Intergenic
1019699628 7:2468366-2468388 GGGCTCAGCACCACCCAGGCAGG - Intergenic
1020016529 7:4834922-4834944 AGGCCCAGCCCCTGCCCGCCCGG - Exonic
1020274444 7:6615863-6615885 GGGCTCAGGGCCGGCCCCCCGGG - Exonic
1024753684 7:52502458-52502480 TGGCTGAGCTCCAGCCTGCCAGG - Intergenic
1024990741 7:55233146-55233168 GGCCCAAGTCCCAGCCCGCCAGG + Intronic
1026850372 7:73719743-73719765 CGGCCCCGCCCCACCCCGCCCGG + Intergenic
1026868972 7:73839404-73839426 GGGCTCAGACCCTGCCCTCTGGG - Intronic
1027200994 7:76063788-76063810 GGGCCCAGCTCCAGCACGCAAGG + Intronic
1027539603 7:79452312-79452334 GCGCTCACCCCTAGCCAGCCCGG - Intronic
1028121445 7:87059790-87059812 GGGCTGCGGCCCAGCCCGGCGGG + Intergenic
1029483759 7:100827326-100827348 CGGCTCAGCCCCCGCCACCCGGG - Exonic
1029712559 7:102307593-102307615 GGACACAGCCCCTGCCCACCTGG + Intronic
1030018086 7:105244606-105244628 GGCGCCAGCCCCAGCGCGCCAGG + Intronic
1030725769 7:112922882-112922904 GGGGTCAGCCCCCCCCCCCCGGG + Intronic
1031631436 7:124048249-124048271 GGGCTCTCCCCCAACCCACCGGG + Intergenic
1031943922 7:127818654-127818676 GGGCTCAGCAGCAACCTGCCAGG - Intronic
1031992272 7:128206269-128206291 TGGCTCAGCTCAAGCCCACCAGG + Intergenic
1032706154 7:134422737-134422759 GACCTCAGCTCCAGCCTGCCTGG + Intergenic
1032787428 7:135211689-135211711 TGAGCCAGCCCCAGCCCGCCTGG + Intergenic
1034192739 7:149224132-149224154 AGGCTCCGCCGCAGCCCGCCAGG - Exonic
1035469388 7:159099990-159100012 GGGCCCAGCTCCAGCACGCATGG - Intronic
1037785331 8:21899610-21899632 AGGCTCATCTCCAGCCTGCCAGG + Intergenic
1037827829 8:22169848-22169870 GGGCTCAGCCACAGTGCTCCTGG + Intronic
1038256412 8:25954970-25954992 GGACTCAGACGCAGCGCGCCAGG + Intronic
1038910731 8:31960733-31960755 GGGCTCAGCCCCAGACACCTGGG + Intronic
1038978384 8:32727098-32727120 GCTCTCAGCCCCAGGCCACCAGG - Intronic
1040538522 8:48330575-48330597 GGCCTCAGGCACAGCCCGCAAGG - Intergenic
1040863178 8:52022100-52022122 GGGCTCTGCCTCAGCCTGTCTGG - Intergenic
1042399774 8:68331572-68331594 GGGCCCAGCCTCAGCCTGGCAGG + Intronic
1042695135 8:71547547-71547569 CGCCCGAGCCCCAGCCCGCCCGG - Exonic
1043969616 8:86514804-86514826 GGGCTCAGCTCCGGGCCGCAAGG + Intronic
1045547373 8:103140809-103140831 AGGCGCAGCCCCGGCCCGCAAGG - Exonic
1045583375 8:103501362-103501384 GGGTTCAGCCCCAGTCCCGCTGG - Intronic
1047965361 8:130042371-130042393 GGGCTCAGACACACCCCGGCTGG - Intergenic
1048317865 8:133375397-133375419 AGGCCCTGCCCCAGCCCTCCTGG - Intergenic
1048994748 8:139787450-139787472 TGGCTCTGCCCCTGCCCGGCAGG - Intronic
1049001175 8:139826431-139826453 GGCCACAGCCCCAGCTGGCCAGG - Intronic
1049004602 8:139846764-139846786 GGGCACAGCCCCAGCACAGCAGG - Intronic
1049332179 8:142060451-142060473 GGTCACAGCCCCAGCCCGAGAGG + Intergenic
1049479722 8:142816145-142816167 TGGCTCAGCCCCAGTCTGCAGGG - Intergenic
1049777958 8:144415147-144415169 GGGCTCCGGCCCTGCCCCCCAGG + Intronic
1051343672 9:16133601-16133623 GGGCTCAGGCCCTGCCTGTCGGG + Intergenic
1051780579 9:20684399-20684421 CAGCTCAGCCCCAGCCCCGCAGG - Intronic
1052942004 9:34137844-34137866 GGGGTCAGCCCCCGTCCGGCCGG + Intergenic
1052971030 9:34377183-34377205 GGGCTCGGCCCCAGGCCTGCTGG + Intergenic
1055079903 9:72258665-72258687 GGGCTCTGTCCCTGCCCACCTGG + Intergenic
1056413381 9:86354189-86354211 GGGCTCAGCCTCTGCCGGCCTGG + Intronic
1057390574 9:94639063-94639085 GGGCCCAACGTCAGCCCGCCGGG + Intronic
1057786001 9:98087733-98087755 GGCCTCGGCCGCCGCCCGCCTGG - Exonic
1057832903 9:98420283-98420305 TGGCTCAGCCCCAGCCCACCTGG + Intronic
1059392043 9:114005510-114005532 GGGGTCAGGCCCAGCTGGCCAGG + Intronic
1059942298 9:119369677-119369699 CGGCTCAGCCCCAGCCCACCCGG - Intergenic
1060087405 9:120714689-120714711 GAGCCCAGCTCTAGCCCGCCGGG + Intergenic
1060215586 9:121736563-121736585 CGCCCCAGCCCCAGCCCTCCGGG - Intronic
1060666042 9:125432782-125432804 TGGGGCAGCCCCAGCCCTCCAGG - Intergenic
1060940584 9:127540961-127540983 AGGCTCAGAACCTGCCCGCCTGG + Intronic
1061028757 9:128067275-128067297 GGGCCCAGCCCCGACCGGCCCGG + Exonic
1061275875 9:129569167-129569189 GAGCTCAGCCCGCGCCCACCCGG - Intergenic
1061453559 9:130681780-130681802 GGGCGCAACCCCAGCGCGCGGGG - Exonic
1061505065 9:131027133-131027155 GGGCTCTGCCCCAGGAGGCCAGG - Intronic
1061725585 9:132580473-132580495 GTCCTCACCCCCAGCCCGGCCGG + Intergenic
1061863230 9:133478556-133478578 GGCCTGAGCCCCAGCTCCCCTGG + Intronic
1061919722 9:133776204-133776226 GGACTTAGCCCCAGCGCCCCTGG + Intronic
1061976008 9:134068245-134068267 GGGCTCGGCGCCCGCCCGGCAGG + Intronic
1062033595 9:134372917-134372939 GGGCTGAGACCCAGCCTTCCTGG + Intronic
1062234808 9:135502680-135502702 GGGCCCAGGCCCATCCCTCCTGG - Intronic
1062584213 9:137241677-137241699 TGACTCAGCCCCGGCCCGCCCGG + Intronic
1062600056 9:137315522-137315544 TGGCTCACCCCCAGCCCTCCTGG - Intronic
1062740926 9:138175121-138175143 GGGCCCAGCCCGGGCCTGCCGGG + Intergenic
1185573359 X:1151813-1151835 GGGCTCAGCCCCACCGCAACTGG - Intergenic
1185736657 X:2500968-2500990 GGACTCTGCGCCCGCCCGCCCGG + Exonic
1185956724 X:4498823-4498845 GGGCTCTTCCCCCACCCGCCAGG - Intergenic
1186097343 X:6116565-6116587 GGCCTCAGCCCCCGCCTCCCAGG + Intronic
1187698119 X:21940923-21940945 GACCCCCGCCCCAGCCCGCCAGG - Intronic
1187704214 X:21993557-21993579 GGGCTCTGCCCCAGCCTGATGGG - Intronic
1192169346 X:68844648-68844670 TGAGTCAGCCCCAGCCTGCCTGG + Intergenic
1192374065 X:70541112-70541134 TAGCTCAGCCTCAGCCCCCCAGG - Intronic
1192585668 X:72316586-72316608 GGGCCCAGCTGCAGCCAGCCAGG + Intergenic
1193423065 X:81308052-81308074 GGGCTCAGTCCCAGTCCCCCAGG - Intergenic
1194364910 X:93003300-93003322 GAGCTCAGCCAGAGCCAGCCGGG + Intergenic
1194427502 X:93757555-93757577 GGGCGGATCACCAGCCCGCCTGG - Intergenic
1197846798 X:130811420-130811442 AGGCTCAACCCCAACCAGCCAGG + Intronic
1200154901 X:153970217-153970239 AGCCCCAGCCCCAGCCCGCTGGG + Intronic
1200673138 Y:6119557-6119579 GAGCTCAGCCAGAGCCAGCCGGG + Intergenic