ID: 929966907

View in Genome Browser
Species Human (GRCh38)
Location 2:46542984-46543006
Sequence CTGAGCCCGGGGCCGGGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1196
Summary {0: 3, 1: 0, 2: 11, 3: 129, 4: 1053}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929966883_929966907 30 Left 929966883 2:46542931-46542953 CCCTGCGGCGCGGAGCGGCGGCG 0: 1
1: 1
2: 1
3: 20
4: 146
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
929966897_929966907 -7 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
929966896_929966907 -6 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
929966895_929966907 -5 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
929966898_929966907 -8 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
929966884_929966907 29 Left 929966884 2:46542932-46542954 CCTGCGGCGCGGAGCGGCGGCGA 0: 1
1: 3
2: 1
3: 24
4: 163
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053
929966894_929966907 -4 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG 0: 3
1: 0
2: 11
3: 129
4: 1053

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929966907 Original CRISPR CTGAGCCCGGGGCCGGGGCG GGG Exonic
900115278 1:1025518-1025540 CTGAGCCCTGGGCAGGAGAGGGG - Intronic
900207993 1:1439748-1439770 CGGTCCCCGGGGTCGGGGCGCGG - Exonic
900294790 1:1943446-1943468 CTGTGCCTGGGGCCGGTGCCCGG + Intronic
900323448 1:2095968-2095990 CTGTGCCAGGGGCCAGGGCAGGG + Intronic
900342286 1:2194809-2194831 CTGGAGGCGGGGCCGGGGCGGGG - Intronic
900344683 1:2205144-2205166 GGGAGCCCGGGGGAGGGGCGGGG - Intronic
900368796 1:2322451-2322473 CCGAGCCCGTGGCCTGGCCGAGG - Intronic
900373727 1:2343966-2343988 CTGGGCCTGGGGCTGGGGCCAGG + Intronic
900578442 1:3395644-3395666 CTGAGGCCTGGGCCAGGGCACGG - Intronic
900584390 1:3425476-3425498 CGGGGCACGGGGCAGGGGCGCGG + Intronic
900629325 1:3625280-3625302 CAGGGGCCAGGGCCGGGGCGGGG + Intronic
900635640 1:3663736-3663758 CTGAACCGGGGGCTGGGGCCAGG + Intronic
901019758 1:6249699-6249721 CCGGGCCCGGGGCGGCGGCGCGG + Exonic
901023944 1:6269344-6269366 CTGTGCCGAGGGCCGGGGTGAGG - Intronic
901054030 1:6440441-6440463 GTGAGCTCCGGGCCCGGGCGGGG + Intronic
901068309 1:6505103-6505125 CTGGGGCCGGGGCCTGGGCCTGG - Intronic
901086485 1:6614592-6614614 CGGAGTCAGGGGGCGGGGCGCGG - Intronic
901088323 1:6625397-6625419 CTGGGCCCGGGGACAGGCCGAGG + Intronic
901332812 1:8423874-8423896 GCGGGGCCGGGGCCGGGGCGCGG - Intronic
901443364 1:9292788-9292810 CCGAGGTCGGGGGCGGGGCGGGG + Intergenic
901627001 1:10630195-10630217 CTGGGCCTGGGGCTGGGGCTGGG - Exonic
901738271 1:11325982-11326004 CTGCCCCCGGGGCTGGGGCTGGG + Intergenic
902289469 1:15427062-15427084 CTGAGGCTGGGGCCTGGGTGCGG + Intronic
902332271 1:15736442-15736464 CTGTGCCCGGGTCAGGGGCACGG - Exonic
902333747 1:15743230-15743252 GTGAGCCCGGGCCCTGGGCTGGG - Intronic
902372042 1:16013294-16013316 CTGACCCCGGGTGGGGGGCGTGG + Intergenic
902451489 1:16499329-16499351 CTCAGGCCGGGGCGGAGGCGAGG + Intergenic
902451497 1:16499346-16499368 GCGAGGCCGGGGCCGAGGCGGGG + Intergenic
902451507 1:16499358-16499380 CCGAGGCGGGGGCGGGGGCGGGG + Intergenic
902940972 1:19799944-19799966 CCGGGACCGGGGCCGGGACGCGG - Intronic
903153301 1:21428266-21428288 CGGGGCCCGGGCGCGGGGCGCGG - Intergenic
903190167 1:21651904-21651926 CTGGGGCGGGGGCGGGGGCGGGG - Intronic
903233906 1:21937418-21937440 CAGAGCCCGCGGCCCGGGGGCGG - Intergenic
903322934 1:22553440-22553462 CTGAGCTGGGAGCTGGGGCGAGG - Intergenic
903353131 1:22730214-22730236 CAGAGCCAGGGGCGGAGGCGGGG + Intronic
903739726 1:25551808-25551830 CTGGGCCTGGGGCCAGGGCTGGG + Intronic
903976775 1:27155097-27155119 CTGCCGCCGGGGCCGGGGCTAGG - Intronic
904011434 1:27392600-27392622 CGGTGGCCGGGGGCGGGGCGGGG + Intergenic
904171049 1:28592439-28592461 CGGGGCCCCGGGCAGGGGCGGGG + Intronic
904237367 1:29123942-29123964 CTGGAGGCGGGGCCGGGGCGGGG - Intergenic
904688309 1:32275785-32275807 ATGAGCCCGAGGTGGGGGCGCGG + Intronic
904696842 1:32335869-32335891 TAGGGCCCGGGGCCGGGGCCGGG - Intronic
904706448 1:32394508-32394530 CTGAGGGCGGTGCCGGCGCGAGG - Intronic
904782850 1:32964028-32964050 GTGAGCGCGGGGGCGTGGCGCGG - Intronic
904847423 1:33430761-33430783 CTGACCCCTGGTCCGCGGCGTGG - Intronic
905638999 1:39576028-39576050 CGGAGCCCGGGCCCGCGCCGCGG + Exonic
905665188 1:39759337-39759359 CTGTGACCGGGTCTGGGGCGAGG - Exonic
905847056 1:41242059-41242081 CTGAGGGCGCGGCGGGGGCGCGG + Intronic
905847111 1:41242216-41242238 CTGAGGCGGGGGGCGGGGCGGGG + Intergenic
906047914 1:42846819-42846841 GTGGGCCGGGGGCCAGGGCGAGG - Intronic
906062537 1:42958186-42958208 CCGGGGCCGGGGCCGGGCCGGGG + Intronic
906208239 1:43998189-43998211 CAGGGCCGGGGGCCGGAGCGCGG + Intronic
906317923 1:44800177-44800199 CTGCGCCCCGGGGCGCGGCGAGG + Intergenic
906525383 1:46490484-46490506 CGGAGCCCTGGGCGGGGGCTGGG + Intergenic
906538009 1:46562666-46562688 CTGTGGCTGGGACCGGGGCGAGG - Exonic
906543197 1:46603978-46604000 CTGTGCCTGGGGTCGGGGCGTGG - Intronic
907306799 1:53517800-53517822 CTGGCCCCGGGGCAGGGGCAAGG - Intronic
908195511 1:61742782-61742804 CTGACCCGGGAGGCGGGGCGGGG + Intronic
908292680 1:62684126-62684148 CTGAACCCGGGGCAGTGGGGTGG + Intronic
910251462 1:85201796-85201818 CGGAGCCCCGGGCCGCGACGGGG + Intergenic
910694306 1:89995389-89995411 CTGGGCCCGGGGCGGGCGGGCGG - Intronic
911092288 1:94027357-94027379 CTGAGCTCTTGGCCAGGGCGAGG - Intronic
911176141 1:94820318-94820340 CTGGAGCCGGGGCCGGGCCGGGG - Intergenic
911176159 1:94820354-94820376 CCGGGGCCGGGGCCGGGGCTGGG - Exonic
912246380 1:107965270-107965292 CTGTGGCCGAGGGCGGGGCGCGG + Intergenic
912449503 1:109760502-109760524 CTGGGCCCTGGGCAGGGGGGTGG - Intronic
912568889 1:110607469-110607491 CGGGGGCCGGGGCCGGGGCCGGG + Intronic
913971700 1:143421962-143421984 CTGAGCCAGGGCCACGGGCGGGG - Intergenic
914066077 1:144247575-144247597 CTGAGCCAGGGCCACGGGCGGGG - Intergenic
914113074 1:144718779-144718801 CTGAGCCAGGGCCACGGGCGGGG + Intergenic
914753242 1:150549610-150549632 CTGGGTCCGGGGTCGTGGCGGGG - Intronic
914758467 1:150579777-150579799 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
914833654 1:151189847-151189869 CGGAGCCGGGGGGCGAGGCGGGG - Intronic
915238579 1:154502927-154502949 CTGAGCCCGGGGGCACGGGGCGG - Intronic
915835332 1:159171629-159171651 CGGAGCCCGGGGCCGAGGTGGGG - Exonic
915903489 1:159862460-159862482 CTGAGCCCAGGTACGGGGCTGGG - Exonic
915937833 1:160099105-160099127 CGGAGCCAGGGCCAGGGGCGGGG - Intergenic
916548339 1:165827668-165827690 CGGAGCCCGGTGACGGGGCTGGG - Exonic
916549864 1:165839924-165839946 CTGGGGCGGGGGCCGGGGTGGGG - Intronic
917448120 1:175123893-175123915 CTGAGCGCTGGGCCGGGTGGAGG - Intronic
918048213 1:180953961-180953983 CTGAGGGCGGGGCGGGCGCGGGG - Intergenic
920038659 1:203082126-203082148 CTGAGCCCGGAGCTGGTGCAGGG + Intergenic
921024019 1:211260415-211260437 TTGAGCCTGGGGCAGGGTCGGGG + Intronic
921217544 1:212950646-212950668 CTGGGCCTGGGGCTGGGGCTGGG - Exonic
922116345 1:222617991-222618013 CTGGGGCGGGGGCTGGGGCGGGG - Intergenic
922139084 1:222863441-222863463 CTGAGCCCAGGGGTGGGGTGAGG + Intergenic
922739361 1:228006867-228006889 CCGGGGCCGGGGCCCGGGCGGGG - Intergenic
922811222 1:228416632-228416654 CTGCGGCCCGGCCCGGGGCGTGG + Intronic
923631147 1:235650093-235650115 CTGGGGCGGGGGCGGGGGCGGGG - Intronic
924274364 1:242370492-242370514 CTGAGCCAGGGGCCAGGGGAGGG + Intronic
924593622 1:245426668-245426690 CTGACCCCAGGGCCTGAGCGGGG - Intronic
924862304 1:247937156-247937178 GTGAGCCCGGGGCTCGGGTGCGG - Intergenic
1062874009 10:931280-931302 CCGGGGCCGGGGCCGGGGCAGGG - Intronic
1062885796 10:1015349-1015371 CTGAGCCTGGGTGCGGGGCTGGG + Intronic
1062885844 10:1015514-1015536 CTGAGCCTGGGAGCGGGGCTGGG + Intronic
1062885854 10:1015547-1015569 CTGAGCCTGGGAGCGGGGCTGGG + Intronic
1062885864 10:1015580-1015602 CTGAGCCTGGGAGCGGGGCTGGG + Intronic
1062913999 10:1233595-1233617 CACAGCCCAGGGCAGGGGCGCGG - Intronic
1063366374 10:5493332-5493354 CAGAGCCCAGGGCGGGGGTGTGG + Intergenic
1064443192 10:15371327-15371349 ACGGGCCCGGGGCCTGGGCGCGG - Intergenic
1064553025 10:16521325-16521347 CCGAGCCCGGGGTGGGGGCCGGG + Exonic
1067400836 10:45972177-45972199 CTCCGCCCGGGGCCGGCCCGGGG - Intergenic
1067445103 10:46337043-46337065 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1067445106 10:46337049-46337071 CCGGGGCCGGGGCCGGGGCCAGG + Intergenic
1067502318 10:46816335-46816357 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1067502321 10:46816341-46816363 CCGGGGCCGGGGCCGGGGCCAGG + Intergenic
1067578077 10:47420317-47420339 CGGAGCCTGGGGACGGGGCCAGG - Intergenic
1067592266 10:47523679-47523701 CCGGGGCCGGGGCCGGGGCCAGG - Intronic
1067592269 10:47523685-47523707 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1067639385 10:48031758-48031780 CCGGGGCCGGGGCCGGGGCCGGG - Intergenic
1067705711 10:48605130-48605152 CTGAGCGCGGGGGCGGGGCGGGG + Intronic
1067777506 10:49174244-49174266 CTGAGGCAGGGGCAGGGGCAGGG - Intronic
1067830787 10:49610165-49610187 CGGGGGCCGGGGGCGGGGCGTGG - Intronic
1067945386 10:50685476-50685498 CTGAGCCCAGGCCCTGGGTGGGG - Intergenic
1068030462 10:51698885-51698907 CAGAGCCCAGGGCCAGGGCCAGG + Exonic
1069101665 10:64330092-64330114 ATGAGCACGGGGCAGGGGCAGGG + Intergenic
1069761808 10:70816241-70816263 CTGCGGCCGGGGCGGGGGCGGGG + Intronic
1069821683 10:71232453-71232475 CTGGGGCTGGGGCCGGGGCTGGG - Intronic
1070025293 10:72626217-72626239 CGGGGCCCGAGGCTGGGGCGTGG - Intergenic
1070136375 10:73697908-73697930 CCGGGGCCGGGGCCGGGGCCAGG - Exonic
1070162529 10:73874626-73874648 CGGGGCCTGGGGGCGGGGCGGGG - Intergenic
1070333102 10:75431770-75431792 CTGCGCCCCGGGCGGAGGCGGGG - Intronic
1070752781 10:78973863-78973885 CCGGGGCTGGGGCCGGGGCGCGG + Intergenic
1071309367 10:84328528-84328550 CTGCGCACGGGCCCGCGGCGGGG + Intergenic
1071633808 10:87234571-87234593 CTGAGCCCAGGCCCTGGGTGGGG - Exonic
1071647257 10:87366787-87366809 CTGAGCCCAGGCCCTGGGTGGGG - Exonic
1072731455 10:97849853-97849875 CCGAGCCTGTGGCCCGGGCGGGG + Intergenic
1073045392 10:100634621-100634643 GTGGGCACGGGGCGGGGGCGAGG + Intergenic
1073137293 10:101227133-101227155 CCGAGTCCGGGGCCGGGGACAGG + Exonic
1073207421 10:101776279-101776301 TGCAGCCCGGGGCGGGGGCGGGG + Intronic
1073288801 10:102403254-102403276 CTGAGCCCGGGGCTGGCTGGAGG + Exonic
1073372577 10:103004081-103004103 TTGAACCCGGGGCGGGGGTGGGG - Intronic
1073378426 10:103057368-103057390 CTAAGACAGGGGGCGGGGCGGGG + Intronic
1073432230 10:103494101-103494123 CAGGGCCCTGGGCCGGGGCCGGG - Exonic
1074085713 10:110207900-110207922 CAGGGCCGGGGGCTGGGGCGCGG - Exonic
1074182604 10:111077395-111077417 CCCGGCCCGGGGCTGGGGCGCGG - Exonic
1074184080 10:111086203-111086225 CTGAGGCTGGGGCCCGGGTGAGG + Intergenic
1074377634 10:112952177-112952199 CAGAGCCCGGGGCCCTGGAGAGG + Intronic
1074782062 10:116809151-116809173 CTGAGCCAGGTGCCGGGAAGTGG - Intergenic
1075410710 10:122225955-122225977 ATGAGCCCAGGGCAGGGGCAGGG - Intronic
1075501732 10:122980717-122980739 CTGGGCCGCGGGGCGGGGCGGGG + Intronic
1075572784 10:123557636-123557658 CTGAGCCCCAGGCCAGGGCAGGG + Intergenic
1075902865 10:126057208-126057230 ATGAGCCCGGGGTCGGGGGAGGG + Intronic
1076161042 10:128244501-128244523 CAGAGCCCGGGGCCTGGGGAGGG - Intergenic
1076424914 10:130361069-130361091 CTGAGCCCGGGTCCTGGACGAGG - Intergenic
1076707093 10:132307984-132308006 CTGGGGGCGGGGCAGGGGCGGGG + Intronic
1076732308 10:132444915-132444937 CTGGGGCCGGGGCCAGGGCCGGG - Intronic
1076732311 10:132444921-132444943 CTGGGGCTGGGGCCGGGGCCAGG - Intronic
1076749993 10:132537750-132537772 CCGAGCCCGGGGCGGGGCCTGGG - Intergenic
1076817573 10:132922417-132922439 CCCAGCATGGGGCCGGGGCGGGG - Intronic
1076839865 10:133040634-133040656 CTGTGGGCGGGGCAGGGGCGGGG + Intergenic
1076857587 10:133124831-133124853 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1076908206 10:133373590-133373612 CTGGGGCGGGGGCGGGGGCGCGG - Exonic
1076993806 11:289029-289051 CCGGGCCCGGGGGCGGGACGTGG - Intergenic
1077043717 11:535431-535453 CTGCCCCCGGGGCCAGGGCCGGG + Exonic
1077043731 11:535449-535471 CCGGGGCCGAGGCCGGGGCGGGG + Exonic
1077081451 11:726243-726265 CTGGGCCGGGGGCGGGGGCAGGG + Intronic
1077094994 11:795482-795504 CAGTGCCAGGGGCCGGGGCCAGG + Intronic
1077103657 11:832886-832908 TTGAGGCCGGGGCGGGGCCGGGG + Exonic
1077107796 11:849561-849583 TGGAGGCCGGGGCCGGGGCCTGG - Intronic
1077121503 11:910943-910965 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1077121508 11:910949-910971 CCGGGGCCGGGGCCGGGGCGGGG + Intronic
1077155683 11:1089882-1089904 CTCAGGCCTGGGCCGGGGTGAGG - Intergenic
1077182970 11:1224605-1224627 CTGCGGCGGGAGCCGGGGCGTGG + Intronic
1077244968 11:1532355-1532377 CTGAGCCTGGGGCCAGGCCTGGG - Intergenic
1077308169 11:1877065-1877087 CTGAGCCAGGGCCACGGGCGGGG + Intronic
1077327108 11:1968663-1968685 GGGAGCCGGGGGCCAGGGCGTGG + Intronic
1077401417 11:2359856-2359878 TTGAGCCCGGTGCCTGGGGGCGG + Intergenic
1077410265 11:2400566-2400588 CGGACCCAAGGGCCGGGGCGTGG + Exonic
1077468535 11:2745796-2745818 CTGAGCCCGGGGCCAGGACCAGG + Intronic
1077495474 11:2884835-2884857 CCGCGTCCGGGGCCGGGGCCGGG + Exonic
1077495479 11:2884841-2884863 CCGGGGCCGGGGCCGGGGCGGGG + Exonic
1077495490 11:2884859-2884881 CGGGGGCCGGGGCCGGGGCCGGG + Exonic
1077495494 11:2884865-2884887 CCGGGGCCGGGGCCGGGGCCGGG + Exonic
1077495498 11:2884871-2884893 CCGGGGCCGGGGCCGGGGCTGGG + Exonic
1077495528 11:2884937-2884959 CCGGGGCCGGGGCCGGGGCCAGG + Exonic
1077898806 11:6473944-6473966 CGGAGGGAGGGGCCGGGGCGGGG + Intronic
1077918694 11:6627109-6627131 CTGAAGCTGGGGCCTGGGCGGGG + Exonic
1078093674 11:8283632-8283654 CTGGGGCTGGGGCCGGGGCTGGG - Intergenic
1079122517 11:17695908-17695930 CCGGGGCCGGGGCCGGGCCGGGG + Intergenic
1081636776 11:44727050-44727072 CTGGGGCCGGGGCCGGGGCTGGG - Intronic
1081636787 11:44727068-44727090 CCGGGGCCGGGGCCGGGGCTGGG - Intronic
1081636791 11:44727074-44727096 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1081636795 11:44727080-44727102 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1081636799 11:44727086-44727108 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1081636803 11:44727092-44727114 CCGGGACCGGGGCCGGGGCCGGG - Intronic
1081662366 11:44895881-44895903 CTGAGCCCTGGGGCTGGGCATGG + Intronic
1081807871 11:45900092-45900114 CAGGGGGCGGGGCCGGGGCGGGG - Intronic
1081990571 11:47335204-47335226 CTGAGCCTGGGGGTGGGGAGGGG + Exonic
1082805329 11:57445625-57445647 CTGAGCACGGGGCCAGGGGCTGG - Intergenic
1083317894 11:61827800-61827822 CGGCGCCCGGGGCCGGAGAGTGG + Exonic
1083609777 11:63999308-63999330 GTGAGTCCTGGGCCCGGGCGAGG - Intronic
1083658446 11:64241387-64241409 CGGAGCCCGGCGGCGGGGGGCGG + Intronic
1083741533 11:64713899-64713921 CGGAGCCCGCGGCGGGGGAGGGG - Exonic
1083753763 11:64778270-64778292 CTGCACCCGGGCCTGGGGCGGGG - Exonic
1083782290 11:64924837-64924859 CTCAGCCCCGGGCCGGGACTGGG - Exonic
1083879297 11:65540222-65540244 GTGAGGCCCGGGCCGGGGAGTGG - Intronic
1083957488 11:65993160-65993182 CTGTGGCCAGGGCCGGGGGGTGG - Intergenic
1083994641 11:66266013-66266035 GTGAGTCCGGGGCCTGGGCCGGG + Intronic
1084129176 11:67119736-67119758 CTGCGGCCGGGGCCGGCCCGGGG + Exonic
1084175128 11:67418926-67418948 CTGGGCCTGGGGCCTGGCCGGGG + Exonic
1084610989 11:70203016-70203038 CTGTGTGCAGGGCCGGGGCGGGG - Intergenic
1084611156 11:70203746-70203768 GTGGGCGCGGGGCCGGGCCGGGG + Intronic
1084621101 11:70270774-70270796 CGGGCCCCGGGGCCGCGGCGTGG + Exonic
1084888439 11:72224889-72224911 CTGGGGCCGGGCCCGGGGCCCGG - Exonic
1084888441 11:72224895-72224917 CTGAGGCTGGGGCCGGGCCCGGG - Exonic
1084930737 11:72553709-72553731 GTGAGCCCAGGGCTGGGGCTGGG + Intergenic
1085094376 11:73747442-73747464 GGGAGGCCGGGGGCGGGGCGGGG - Intronic
1085256295 11:75175480-75175502 CTGAGCCCTGAGCCTGGGAGGGG - Intronic
1085266806 11:75242168-75242190 CCGAGCCCGGGGAGGTGGCGCGG - Exonic
1085460211 11:76688998-76689020 CTGAGCCTGAGGCCTGGGAGGGG + Intergenic
1085507098 11:77066888-77066910 CGGAGGCCGCGGGCGGGGCGGGG + Intergenic
1086455326 11:86954979-86955001 CTGCTCCTGGGGCCGGCGCGGGG - Exonic
1088406043 11:109480270-109480292 TTGAGCGGGGGGCGGGGGCGGGG - Intergenic
1088797000 11:113273161-113273183 CTGAAGCTGGGGCCGGGGAGGGG - Intronic
1089291181 11:117438819-117438841 CTGGGCCCGGGGCAGGGAAGGGG - Intronic
1089518151 11:119046641-119046663 CTTAGGCCGGGGCCGGGGCTTGG + Exonic
1089533854 11:119149218-119149240 CGGCGGCCCGGGCCGGGGCGGGG - Exonic
1089845007 11:121451823-121451845 ATGAGGCCGGGGCCGGGGGGAGG + Intergenic
1090204507 11:124877065-124877087 CTGGGACCGGGGCCTAGGCGTGG + Intronic
1090375159 11:126283154-126283176 GTGAGCCCGGGGCGGGGTCGCGG + Intronic
1090830811 11:130419766-130419788 CTGAGGCCGGGGACGGGTGGGGG - Intronic
1091274705 11:134342441-134342463 CTGCTGCTGGGGCCGGGGCGGGG - Intronic
1202810090 11_KI270721v1_random:23843-23865 GGGAGCCGGGGGCCAGGGCGTGG + Intergenic
1091434013 12:459897-459919 CTGTGCCCGGGGCGGGGGCGGGG + Intergenic
1091434146 12:460297-460319 CTGGGCGCGGGGCCCGGCCGGGG + Intergenic
1091672499 12:2462325-2462347 CTGAGCCAAGGGGCGGGCCGAGG - Intronic
1091759372 12:3077178-3077200 GGGAGCCCGGGGACGGGGCACGG - Intergenic
1091773949 12:3172217-3172239 CTGAGGCTGGGGTGGGGGCGGGG - Intronic
1091799425 12:3315568-3315590 GTGAGCCCTGGGCTGGGGCCAGG - Intergenic
1092861828 12:12725252-12725274 CGGAGCGCGGGGCAGGCGCGCGG - Intergenic
1094492672 12:30970737-30970759 CTGAGCCCTGGGCTGGGGCCAGG + Intronic
1095943471 12:47740674-47740696 CTGGGCCCGGGGGCCGGGCACGG + Exonic
1095955656 12:47804279-47804301 CTCAGCACGGGGCCAGGGAGCGG - Intronic
1095960069 12:47828874-47828896 CAGGGCCTGGGGCCGGGGGGTGG + Intronic
1096241334 12:49961807-49961829 CCGGGCGCGGGGCCGGCGCGGGG - Intergenic
1096550702 12:52369956-52369978 CTGAGCCCAGGGCTGGGGCTGGG + Intergenic
1096796740 12:54082568-54082590 CGGGGCCGGGGGCCGGGGCCGGG + Intergenic
1096796744 12:54082574-54082596 CGGGGGCCGGGGCCGGGGCCGGG + Intergenic
1096796748 12:54082580-54082602 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1096796752 12:54082586-54082608 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1096796756 12:54082592-54082614 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1097166461 12:57088964-57088986 CAGAGCCGGGGGCGGGGGTGGGG - Exonic
1098750957 12:74292882-74292904 CAGAGCCTGGGGCCTGGGCAGGG - Intergenic
1099954794 12:89343301-89343323 CTCTGCCAGGGGCCGGGGCTGGG - Intergenic
1100260558 12:92928974-92928996 CGGAGCTCGGGGCCGCGGCGCGG - Intronic
1101371813 12:104137828-104137850 CCGGGCCCGGGGCCGAGGAGGGG - Intronic
1102258348 12:111428892-111428914 CTGGGCCCAGAGCCTGGGCGGGG + Intronic
1102636220 12:114326612-114326634 CTGTGGCGGGGGCGGGGGCGGGG - Intergenic
1102933865 12:116881317-116881339 CCGAGCGCGGGGCGGGAGCGAGG - Exonic
1103309006 12:119989655-119989677 CTGAGCCCGGGGGCGGGGGAGGG + Intergenic
1103474692 12:121210008-121210030 CGGGGCCCGGGGCCCGGGGGAGG - Intronic
1103828705 12:123762134-123762156 GAGATCCCGGGGCCGGGGCGTGG + Intergenic
1103968599 12:124655613-124655635 CTGGGCCTGGGGTCGGGGGGAGG - Intergenic
1104448887 12:128853680-128853702 CTGGGCCGGGGGCCGGGGGGCGG + Intronic
1104815880 12:131645102-131645124 CTGGGCCTGGGGCAGGGGCCTGG + Intergenic
1104939858 12:132390005-132390027 CTGAGCCCAGGTGGGGGGCGGGG - Intergenic
1104982578 12:132580862-132580884 CTGGGCCCGGGCCCTGGGAGGGG - Intronic
1105004218 12:132711001-132711023 CTGAGCCGCCGGCCTGGGCGGGG + Exonic
1105031408 12:132887158-132887180 CGGGGCCGGGGGCCGGGGCCGGG - Intronic
1105031413 12:132887165-132887187 CTGAGGCCGGGGCCGGGGGCCGG - Intronic
1105074527 12:133264217-133264239 CTGCGCCCCGCGCCGGCGCGGGG + Intergenic
1105813412 13:24013084-24013106 CTGAGCCCAGAGCCAGGGTGGGG + Intronic
1105859423 13:24395611-24395633 CTGAGCCTGGGCCTGGGGCAGGG - Intergenic
1105898826 13:24740151-24740173 CTGAGGCCTGGGCTGGGGTGCGG + Intergenic
1105943620 13:25171509-25171531 CGGAGGCCGGGGCCGGGACCGGG - Exonic
1106247284 13:27960993-27961015 CTGTGGGCGCGGCCGGGGCGCGG + Intergenic
1106340097 13:28819761-28819783 CTGAGGCGGGAGCTGGGGCGGGG + Intergenic
1107932160 13:45315432-45315454 CTGGGCCCTGGGGCTGGGCGCGG - Intergenic
1108555183 13:51584630-51584652 CTCAGCCCGGCCCCGCGGCGCGG + Exonic
1109789653 13:67230386-67230408 CAGAGCCCGGGGGCGGGGCCTGG - Intronic
1112196818 13:97234484-97234506 CTGAGCACAGTGCGGGGGCGGGG + Intronic
1112402308 13:99087055-99087077 CTGCGCCCGGGGCCTCTGCGGGG + Intergenic
1112570421 13:100588710-100588732 CTGAGCCCGGGCGGGGGTCGGGG - Intronic
1113120247 13:106917589-106917611 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1113120251 13:106917595-106917617 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1113120255 13:106917601-106917623 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1113120259 13:106917607-106917629 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1113120263 13:106917613-106917635 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1113769230 13:112897978-112898000 CCGGGGCCGGGGCCGGGGCTGGG - Intronic
1113874397 13:113585150-113585172 GTGGGGCCGGGGCCGGGGCCGGG + Intronic
1113874401 13:113585156-113585178 CCGGGGCCGGGGCCGGGGCTGGG + Intronic
1113906260 13:113820668-113820690 CTCAGCCGTGGGCCCGGGCGCGG - Exonic
1115768507 14:36647404-36647426 CTGAGCCGTGGCCCGTGGCGCGG + Intergenic
1115985780 14:39102896-39102918 CTGAGGCCCGGTCCGGCGCGGGG - Intronic
1116817852 14:49599759-49599781 CGGCGACCGGGGCCGGGGCGGGG + Intronic
1116817914 14:49599928-49599950 CTGAGCCCGGGGCCGGGGCGGGG + Intronic
1116958157 14:50944574-50944596 CTGGGGCAGGGGCCGGGACGCGG - Exonic
1117469085 14:56024142-56024164 CTGACTCCGGGGCAGGGGAGAGG - Intergenic
1118752348 14:68816424-68816446 CCGGGCGCGGGGCCCGGGCGAGG + Intergenic
1118779624 14:68998548-68998570 CTTAGCCCGGGGGTGGGGAGTGG + Intergenic
1118808960 14:69260228-69260250 GTGCTCTCGGGGCCGGGGCGGGG - Exonic
1118882343 14:69840449-69840471 CGGAGCACAGGGCAGGGGCGGGG - Intergenic
1119330134 14:73787297-73787319 CGGAGCCGGGGGCGCGGGCGGGG - Intronic
1119522166 14:75294369-75294391 CAGGGACCGGGGGCGGGGCGCGG - Intergenic
1119756749 14:77125127-77125149 CAGAGCCCGCGGCCGTGGCTCGG - Intronic
1120920800 14:89753880-89753902 CTGAGCACGGGGTGGGGGCGGGG - Intergenic
1121252966 14:92513538-92513560 CTGTGGCTGGGGCTGGGGCGCGG - Intergenic
1121559670 14:94865012-94865034 CGGAGCCCGGGGCCTGGGGCCGG + Intergenic
1121776188 14:96592688-96592710 CTGAGCCGAGGGCCGGCGCGGGG - Intergenic
1121828931 14:97033424-97033446 CTGGGGCGGGAGCCGGGGCGAGG - Intergenic
1122065969 14:99174791-99174813 TTGAGCCCGGGGCTGGGCAGCGG + Exonic
1122082210 14:99273882-99273904 TGGAGACCGGGGGCGGGGCGCGG + Intergenic
1122230865 14:100305875-100305897 ATGAGCCCGGGACCTCGGCGCGG + Intronic
1122414167 14:101540888-101540910 CTGGGCCCGGGGCAGGGCAGCGG - Intergenic
1122550008 14:102544623-102544645 CTGCGCCAGGGGCCGGGGGCCGG + Intergenic
1122555173 14:102575051-102575073 CACAGCACGGGGGCGGGGCGGGG - Intergenic
1122597483 14:102903430-102903452 GTGAGGCAGGGGCCGGGGCCGGG + Intronic
1122649899 14:103220579-103220601 CTGGGCCCGGGGGCGGGGCTGGG + Intergenic
1122778749 14:104134860-104134882 CTGAGCCTGGGGCGGGGAGGGGG - Intergenic
1122806789 14:104263874-104263896 CTGAGCCAGGGGCAGGGGTCGGG - Intergenic
1122975075 14:105167690-105167712 AAGCGCGCGGGGCCGGGGCGCGG + Intronic
1123032246 14:105457450-105457472 CAGAGCCGGGGGCCAGGGAGTGG - Intronic
1123036817 14:105475000-105475022 CTCGGTCCGGGGCCGGGGCCGGG - Intronic
1123110274 14:105863937-105863959 CTGAGCCCGGGGAGGGCCCGGGG + Intergenic
1123112152 14:105877776-105877798 CAGGGCCAGGGGCCGGGGTGGGG + Intergenic
1123709877 15:22979931-22979953 CTGTGCCATGTGCCGGGGCGCGG + Intronic
1123709934 15:22980084-22980106 GGGAGCCCGGGGCCGGGACCTGG + Intronic
1124249813 15:28099364-28099386 CTGTGGGCGGGGCCGGGCCGGGG - Intergenic
1124251265 15:28107605-28107627 CTGAGCGCGGGGCCCCTGCGCGG - Intergenic
1124696763 15:31870345-31870367 GCGACCGCGGGGCCGGGGCGCGG - Intronic
1125180996 15:36880722-36880744 CTCCGCCCGGGGCTGGGGCGCGG - Intergenic
1125444315 15:39736985-39737007 CTTAGCACAGGGCTGGGGCGTGG + Intronic
1125594038 15:40873253-40873275 CTGAGCCTGGGGTTGGGGCACGG + Exonic
1125903642 15:43370977-43370999 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1125903646 15:43370983-43371005 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1125937519 15:43649320-43649342 CTGGGCCGGGGCCGGGGGCGAGG + Intronic
1125950305 15:43746286-43746308 CGGAGCGCGGGGCGGGGCCGAGG - Intergenic
1126777606 15:52112807-52112829 GGGGGCCGGGGGCCGGGGCGGGG - Intergenic
1127606567 15:60592681-60592703 CTGCCCGCGGGGGCGGGGCGGGG - Intronic
1127753424 15:62067990-62068012 GTGGGCCCGGGGCCGGGGCGCGG - Exonic
1127763636 15:62164601-62164623 GTGGGCCCGGGGCCGGGGCGCGG + Exonic
1128322583 15:66703539-66703561 CGGAGCCAGGGGCCGGCGCTGGG + Exonic
1128456024 15:67831910-67831932 GGGAGGTCGGGGCCGGGGCGGGG + Intronic
1128547526 15:68578489-68578511 CTGTGCCCCGGGCCAGCGCGAGG + Intergenic
1128739833 15:70075994-70076016 CTGAGGCTGGGGCTGGGGCTGGG + Intronic
1128746699 15:70119928-70119950 CTGAGCTGGGGGCAGGGGAGTGG - Intergenic
1128995152 15:72289810-72289832 CTCGGCCCCGGGCCGGGGCCAGG - Intronic
1129273865 15:74433200-74433222 CCGAGCTCCGGGCCGGGGCGGGG + Intronic
1129329858 15:74821420-74821442 CTGAGGCTGGGGCTGGGGAGAGG + Intronic
1129386990 15:75201839-75201861 CTGGGGGCGGGGCGGGGGCGGGG - Intronic
1129412026 15:75355535-75355557 CTGGGCCTGGGGCTGGGGAGGGG - Exonic
1129483335 15:75844176-75844198 CTGCTCCCGGGACCGGGGCGGGG + Intronic
1129759966 15:78123650-78123672 CTGGGACTGGGGCCGGGGTGAGG - Intronic
1130059480 15:80559334-80559356 CTGTGGCCGGGGCTGGGGCTGGG - Intronic
1130115309 15:81000973-81000995 GCGAGCCCGGGGGCGAGGCGCGG + Exonic
1130301022 15:82680080-82680102 CTGGGACCGGGGCCGGGGAAAGG - Intronic
1130649937 15:85756687-85756709 CTGGGCCTGGGGCCGGGGCTGGG + Intergenic
1131144314 15:90001634-90001656 CTGGGGCTGGGGCTGGGGCGGGG - Intronic
1132273246 15:100544621-100544643 CGGGGCCCGGGGCGGGTGCGGGG - Intronic
1132320084 15:100919331-100919353 CTGGGCCCGGCCCCGGCGCGGGG + Exonic
1132464740 16:72362-72384 CCGGGGCCGGGGCCGGGGAGGGG - Intronic
1132541112 16:510234-510256 CGGAGCCTCGGGACGGGGCGTGG - Intronic
1132561923 16:599193-599215 CTTCGGCCGGGGCCGGGGCCTGG - Intronic
1132575246 16:661006-661028 CTGAGGCCGGGCCGGGGGGGGGG - Intronic
1132585768 16:705291-705313 CCGGGCCAGGGGCCGGGGCGCGG + Intronic
1132600014 16:769166-769188 CCGGGGCCGGGGCCGGGGCCGGG - Intergenic
1132600018 16:769172-769194 CTGGGGCCGGGGCCGGGGCCGGG - Intergenic
1132600042 16:769214-769236 CCGGGGCCGGGGCCGGGGCCGGG - Intergenic
1132600046 16:769220-769242 CTGGGGCCGGGGCCGGGGCCGGG - Intergenic
1132600049 16:769226-769248 CTGGGGCTGGGGCCGGGGCCGGG - Intergenic
1132692402 16:1187469-1187491 CTGAGCCAGGGGCAGGGGTGTGG - Intronic
1132694355 16:1195303-1195325 CTCAGGGCGGGGCAGGGGCGGGG + Intronic
1132741381 16:1414857-1414879 CGGGGCGCGGGGCTGGGGCGGGG - Intergenic
1132746429 16:1438224-1438246 CTCAGCCCTGGGCCAGGGAGGGG + Intronic
1132748516 16:1446845-1446867 CTGAGCACGGGGCTGGGGAGGGG + Intronic
1132779348 16:1614306-1614328 TAGACCCCGGGGCCGGGGCCGGG + Intronic
1132779354 16:1614312-1614334 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1132779358 16:1614318-1614340 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1132785834 16:1656606-1656628 AGGAGCCCGGGGCCGGGCCTCGG - Exonic
1132788317 16:1670545-1670567 TTGGGGCCGGGGCCGGGGCTAGG + Intronic
1132808571 16:1787077-1787099 CTGAGCCCTGTGCCTGGTCGTGG - Intronic
1132831248 16:1929545-1929567 CAGAGCCAGGGGCGGGGGCGGGG - Intergenic
1132842366 16:1984314-1984336 CGACGCGCGGGGCCGGGGCGCGG + Exonic
1132865819 16:2092199-2092221 CAGAGCCCCAGGCCGGGGCCAGG + Intronic
1132897743 16:2236961-2236983 GTGGGGCCCGGGCCGGGGCGGGG + Intronic
1132930044 16:2454434-2454456 CTGAGCACAGGGCCAGGGCCAGG - Intronic
1132959333 16:2613309-2613331 GTGAGCGCTGAGCCGGGGCGAGG + Intergenic
1132972393 16:2695284-2695306 GTGAGCGCTGAGCCGGGGCGAGG + Intronic
1133053873 16:3135111-3135133 CGGGGGCGGGGGCCGGGGCGGGG + Exonic
1133319200 16:4902591-4902613 CTGAGGCCGGGGTCTGGGTGGGG - Intronic
1133642570 16:7731921-7731943 CAGATTCCGGGGCGGGGGCGGGG - Intergenic
1135016078 16:18926121-18926143 CTCAGCCCCGGGCCGGAGCGGGG - Exonic
1135115378 16:19718805-19718827 CTGGGGCGGGGGCCGGGGTGGGG + Intronic
1135321704 16:21501966-21501988 CTCAGCCCCGGGCCGGAGCGGGG - Intergenic
1135335801 16:21599906-21599928 CTGGGGCCGGGGCCGGGGCGGGG + Intronic
1135335804 16:21599912-21599934 CCGGGGCCGGGGCGGGGGCGTGG + Intronic
1135437264 16:22437299-22437321 CTCAGCCCCGGGCCGGAGCGGGG + Intergenic
1136169186 16:28477897-28477919 CTAAGCCTGGGACCAGGGCGGGG + Intronic
1136333168 16:29595046-29595068 CTCAGCCCCGGGCCGGAGCGGGG - Intergenic
1136372415 16:29844711-29844733 CTGGTCCCGGGGCCTGGGCAGGG - Exonic
1136447862 16:30335112-30335134 CTCAGCCCCGGGCCGGAGCGGGG - Intergenic
1136453894 16:30369943-30369965 CTGGGGCCGGGGCTGGGGCCGGG + Exonic
1136462195 16:30418431-30418453 CAGACCCGGAGGCCGGGGCGAGG - Exonic
1136479968 16:30534923-30534945 CTGGGCCTGGAGCGGGGGCGCGG - Intronic
1136584216 16:31173557-31173579 CTGAGTCTGGGGCAGGGGGGTGG - Intergenic
1137269457 16:46893873-46893895 CTGAGGGCAGGGCAGGGGCGAGG + Intronic
1137559224 16:49492412-49492434 CTGGGCTCGGGTCCGCGGCGAGG + Intronic
1137559240 16:49492463-49492485 CGGAGGCCGAGGCCGGGGCCGGG + Intronic
1137559244 16:49492469-49492491 CCGAGGCCGGGGCCGGGGCCGGG + Intronic
1137559248 16:49492475-49492497 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1137676473 16:50305986-50306008 CTGGGCGGGGGGCAGGGGCGGGG + Intronic
1137738316 16:50741752-50741774 CTGATGCTGGAGCCGGGGCGGGG - Intergenic
1137926513 16:52546731-52546753 CTGGGCCCGGGGCCGGGGGCCGG + Exonic
1138327985 16:56191408-56191430 CTGGGCCCGGGGCGGGGAGGAGG - Intronic
1138457601 16:57130437-57130459 CTGAGCCCGGGGGCAGAGCAGGG + Intronic
1138572380 16:57884219-57884241 ATGAGCCCGGGCCCGGAGCCGGG - Exonic
1139850833 16:69950921-69950943 CAGGGCCCGGGGCTGGGGAGCGG + Intronic
1139879816 16:70173833-70173855 CAGGGCCCGGGGCTGGGGAGCGG + Intronic
1140124126 16:72106164-72106186 CTGAGCGTGGAGCCCGGGCGGGG + Intronic
1140372707 16:74421715-74421737 CAGGGCCCGGGGCTGGGGAGCGG - Intronic
1140715474 16:77722379-77722401 CGGAGGCCGGGATCGGGGCGGGG - Intergenic
1141366666 16:83450007-83450029 CTGGGCCCGGGGTCGGGGCGGGG - Intronic
1142106853 16:88309026-88309048 CTGGGCCCTGGGCAGGGGAGAGG - Intergenic
1142175561 16:88643455-88643477 CTCGGCCGGGGGCCGCGGCGGGG + Exonic
1142177295 16:88651083-88651105 CTGGGGGCGGGGCCTGGGCGGGG - Exonic
1142191323 16:88719547-88719569 CTGGGCCCAGGGCGGGGGCCGGG - Intronic
1142192164 16:88723068-88723090 GTGGGCCCGGGGCTGGGGAGTGG - Intronic
1142196718 16:88742447-88742469 CTGGTCCCGGGGACGGGGAGGGG + Intronic
1142292334 16:89198867-89198889 CTGAGCCTGGGGGTGGGGTGGGG - Intronic
1142367563 16:89657990-89658012 CTGGGCGCGGGCCCAGGGCGGGG + Intronic
1142406167 16:89891404-89891426 GGGAGCCCGGGGCCAGGGCAGGG + Intronic
1142598206 17:1039809-1039831 CTAAGCCAGGAGCCGAGGCGGGG + Intronic
1142631332 17:1228672-1228694 TCGAGCTCGGGGCCGGGGAGCGG - Intronic
1142738440 17:1916565-1916587 CTAAACCCGGGGACTGGGCGAGG + Intergenic
1142812561 17:2402019-2402041 CTGGGGCCGGGGCCAGGGCGGGG + Intergenic
1142836857 17:2593857-2593879 CTGGGCCCGGGCCCGGGGAGGGG - Exonic
1142852082 17:2709215-2709237 CTGAGGCCTTGGCTGGGGCGTGG - Intronic
1143119493 17:4598105-4598127 CTCAGCCCGTGGCCTGGGTGCGG + Intronic
1143766803 17:9143219-9143241 CAGAGCCCGGGGCCTTGGCCTGG + Intronic
1143882027 17:10036990-10037012 CTGGGGCCGGGGCCGGGGCCAGG - Intronic
1144586678 17:16491722-16491744 GTGAGCGCGGGGAGGGGGCGCGG - Intronic
1144641085 17:16937105-16937127 CTGAGCCCTGGGGAGGGGCCAGG + Intronic
1144712208 17:17409278-17409300 CGGAGCCCAGGGCTGGGGCAGGG - Intergenic
1144816694 17:18039903-18039925 GTGAGCGCCGGGCCGGGCCGGGG + Intronic
1144873984 17:18387428-18387450 CTGAGCCCTGGGGAGGGGCCAGG - Intronic
1145034838 17:19533800-19533822 CTGGGCGGGCGGCCGGGGCGGGG + Intronic
1145205537 17:20983252-20983274 CTGAGTCCTGGGTGGGGGCGGGG + Intergenic
1145243585 17:21253265-21253287 CTGCGCGCGGGGCTGCGGCGCGG + Exonic
1145884091 17:28370932-28370954 CTGAGCCTGGGGACAGGGAGTGG - Intronic
1145886442 17:28385296-28385318 CTGGGGCTGGGGCTGGGGCGGGG - Intronic
1146058696 17:29593539-29593561 CGGGGCCCGGGGCCGCGGGGCGG - Exonic
1146062733 17:29615616-29615638 CTGGGCCCGGGGGCGGGACTGGG - Exonic
1146183318 17:30710252-30710274 TGGGGCCCGGGGCCGGCGCGCGG - Intergenic
1146445293 17:32928089-32928111 GGGGGCCGGGGGCCGGGGCGCGG + Exonic
1146626674 17:34440224-34440246 CTGAGCCTGGTGCCGAGGCCAGG - Intergenic
1146955065 17:36932663-36932685 CTGGGCATGGGGCAGGGGCGTGG - Intergenic
1147110227 17:38256689-38256711 CTGGGGCTGGGGCCGGGGCAGGG - Intergenic
1147250845 17:39151685-39151707 CTGGGGCAGGGGGCGGGGCGGGG + Intronic
1147264132 17:39225042-39225064 CTGAGCCCGGGACTGGGACCCGG + Intronic
1147264226 17:39225365-39225387 GGGCGCCCGGGCCCGGGGCGCGG + Intronic
1147393130 17:40122215-40122237 CGGGGCGGGGGGCCGGGGCGGGG + Intergenic
1147608044 17:41785454-41785476 CTGAGGTAGGGGCCGGGGTGGGG - Intronic
1147617171 17:41836291-41836313 GTGGGGCCGGGGGCGGGGCGGGG + Intronic
1147672401 17:42184209-42184231 CGGCGCCCGAGGCAGGGGCGCGG + Exonic
1147722714 17:42548617-42548639 CCGAGGCTGGGGCCGGGGCTGGG + Intergenic
1147756744 17:42773570-42773592 CTGAGCCCAGGGTCCGGGGGAGG - Intronic
1147766696 17:42841575-42841597 CTGAGGCCAGGGCCAGGGCCAGG + Exonic
1147971164 17:44219709-44219731 CTGAGGCCGGGGCCGGCGGCGGG - Intronic
1148035584 17:44656903-44656925 CTGAGGCGGTGGCCGGGGAGGGG + Intronic
1148139310 17:45317061-45317083 CGGAGCCCGGGACCGGGGCGGGG - Intergenic
1148183965 17:45627880-45627902 CAGAGCCGGGGGCCGGAGAGGGG + Intergenic
1148419279 17:47531730-47531752 CTGGGGCTGGGGCCGGGGCAGGG + Intronic
1148443063 17:47721664-47721686 AAGAGCCTGGGGCCAGGGCGTGG + Intergenic
1148452627 17:47789980-47790002 GCGAGCCTGGGGCCGGGGCGAGG - Intergenic
1148553509 17:48564431-48564453 CAAAGCCGGGGGCGGGGGCGGGG - Intronic
1148736804 17:49869626-49869648 CTGGGCCCGGGGGTGGGGGGCGG - Intergenic
1148751971 17:49950553-49950575 CTGAGGCTGGGGGCGGGGTGTGG + Intergenic
1149314031 17:55421973-55421995 CGGAGCCGGGCTCCGGGGCGGGG - Exonic
1149610394 17:57954963-57954985 CTCATCCCGGGCCCCGGGCGCGG - Intronic
1149994630 17:61400132-61400154 CGGGGGCCGGGGCCGGGGCCGGG - Exonic
1150250113 17:63700300-63700322 GGGAGCGCGGAGCCGGGGCGGGG - Intronic
1150285233 17:63950431-63950453 CCGGGGCCGGGGCCGGGGCCTGG - Intronic
1150488762 17:65560880-65560902 CCGAGCCGGGGGCCGGGGCCGGG - Intronic
1150830120 17:68511882-68511904 GAGGGCCCCGGGCCGGGGCGGGG - Intronic
1151460267 17:74250084-74250106 CTGGCCCTGGGGCCGGGGCAGGG - Intronic
1151489992 17:74427184-74427206 CTGAGCCCTGGGCAGGGAGGGGG + Intronic
1151919230 17:77141141-77141163 CGGAGACCGGGACCGGGGCGAGG - Intronic
1152070686 17:78132310-78132332 GGGAGGCCGGGGCCGGGGCTGGG - Intronic
1152132299 17:78484801-78484823 GTGAGGGCGGGGCCAGGGCGGGG - Intronic
1152245613 17:79183226-79183248 CCGGGCCGGGGGCCGGGGCCGGG + Intronic
1152349697 17:79777931-79777953 CGGGGCCCCGGGCGGGGGCGGGG - Intergenic
1152426421 17:80220762-80220784 CGGGGCCGGGGGCCGGGGAGTGG + Intronic
1152545363 17:80997684-80997706 GTGAGCCTGGGGCCAGGACGCGG - Intronic
1152580970 17:81165536-81165558 CTGGGTCCGGGGCCCTGGCGTGG - Intronic
1152654825 17:81514646-81514668 CTGAGCCGCGGGGAGGGGCGGGG + Intronic
1152711187 17:81871152-81871174 CTGAGCCCGCGGCAGGGTCTCGG - Intronic
1152720852 17:81923266-81923288 CTGGGCCGGGGGCGGGGGGGGGG - Intronic
1152748412 17:82051631-82051653 GCGCGCGCGGGGCCGGGGCGGGG + Exonic
1152799678 17:82324952-82324974 CTGTGCCCAGGGCCAGGGCCAGG + Intronic
1152810530 17:82379804-82379826 ATGAGGACGGGGCCGGGGCTGGG - Intergenic
1152889609 17:82873033-82873055 CTGAGCCCCGGGCCAGGGCCTGG - Intronic
1152924492 17:83080872-83080894 CTCGGCCCGCGGCGGGGGCGGGG - Intronic
1152945757 17:83196592-83196614 CTGAGACGGGGGCCTGGGTGAGG + Intergenic
1154125610 18:11689662-11689684 CTGGGGCCAGGGCCGGGGCCGGG - Exonic
1156099612 18:33578331-33578353 CGGGGCCCGGGCCAGGGGCGGGG - Intergenic
1156249968 18:35343851-35343873 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1156275870 18:35581974-35581996 CGCTGCCTGGGGCCGGGGCGCGG + Intronic
1156331621 18:36129134-36129156 CTGCGCGCGTGGCCGGGCCGTGG - Exonic
1157435694 18:47667269-47667291 CTCTGCCGGGGGCGGGGGCGGGG + Intergenic
1157473693 18:48008328-48008350 CTGGGCCGGGGGCGGGGGCCAGG + Intergenic
1157528950 18:48406136-48406158 CTGAGGCTGGGGCGGGGGTGTGG - Intronic
1157557380 18:48621666-48621688 CTGAGCAGGGGGCCGTGACGGGG + Intronic
1157736626 18:50055239-50055261 GTGAGTCCGGGGCAGGGGGGCGG - Intronic
1157858523 18:51121722-51121744 CTGAGCCTGGGTGCGGGGTGAGG - Intergenic
1158137635 18:54224319-54224341 CTGTGGCCGTGGCCGGGGCCGGG - Exonic
1158437955 18:57447261-57447283 CTGAAGCCTGCGCCGGGGCGTGG - Intronic
1158512558 18:58104318-58104340 CTAAGATCGGGGCTGGGGCGCGG + Intronic
1159241732 18:65750906-65750928 CGGCGCCCGAGGCCGGGGCAGGG + Exonic
1159586600 18:70288839-70288861 CTGAGGCCGGGGGCCGCGCGGGG - Intergenic
1159586783 18:70289363-70289385 GGGAAGCCGGGGCCGGGGCGCGG + Intronic
1159798081 18:72867707-72867729 CCGGGGCCGGGGCCGGGGAGAGG + Exonic
1160019270 18:75167779-75167801 CAGAGCCCAGGGTGGGGGCGAGG + Intergenic
1160163209 18:76491269-76491291 CCGGGGCCGGGGCCGGGGAGGGG - Intronic
1160163214 18:76491275-76491297 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1160631209 18:80247424-80247446 CCGGGGCCGGGGCCGGGGCCTGG - Exonic
1160631267 18:80247596-80247618 CGGGGCTCGGGGGCGGGGCGGGG - Intergenic
1160659634 19:291866-291888 CGGAGCCCCGGGCGGGGACGTGG + Intergenic
1160724849 19:613559-613581 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1160774866 19:850763-850785 CGGAGCCCGGGGCTGGGTCCTGG + Intergenic
1160781140 19:878429-878451 CCGGGGCCGGGGCCGGGGCTGGG - Intronic
1160781144 19:878435-878457 GTGGGGCCGGGGCCGGGGCCGGG - Intronic
1160781299 19:878919-878941 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1160781303 19:878925-878947 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1160781307 19:878931-878953 CTGCGGCCGGGGCCGGGGCCGGG - Intronic
1160809614 19:1007774-1007796 GTGAGCCCGGGCGCGGGGTGAGG + Intronic
1160830414 19:1102096-1102118 CTGAGTCGGGGGCAGTGGCGGGG + Intergenic
1160836772 19:1128288-1128310 CTGTGCCGGAGGCAGGGGCGGGG + Intronic
1160880099 19:1315812-1315834 CTGAGCCCGGAGCCGCGGGGGGG - Intergenic
1160909124 19:1466697-1466719 CCGAGGCCGGGGCCTGGGGGTGG + Exonic
1160952911 19:1676058-1676080 CTGGGCCAGGGGCCTGGGAGGGG + Intergenic
1161063599 19:2227154-2227176 CTCCGGCGGGGGCCGGGGCGGGG - Intronic
1161189411 19:2944797-2944819 CCGAGCCCGGGCCCAGGGCGAGG - Intronic
1161203460 19:3028647-3028669 CTGGGCGCCGGGGCGGGGCGAGG - Intronic
1161215655 19:3094151-3094173 CGCAGCCGGGAGCCGGGGCGGGG - Intergenic
1161215817 19:3094592-3094614 CCGGGCCGGGGGCCGGGGGGCGG + Exonic
1161393619 19:4033581-4033603 GTGAGCCCGGGGCCCCGGGGAGG + Intronic
1161400648 19:4065347-4065369 CTGCGGCCGGGGCGGGGGAGGGG - Intronic
1161408357 19:4102761-4102783 CTGAGCCCCCGGCCGCGGCTTGG - Intronic
1161434994 19:4257986-4258008 CTGAGCCCTGGGGCAGGGTGGGG - Intronic
1161477285 19:4493758-4493780 CTGAGCCGGTGGCCATGGCGCGG + Exonic
1161505078 19:4639507-4639529 CCGGGGCCGGGGCCGGGGCGGGG - Intronic
1161608757 19:5229468-5229490 GTGGGCGGGGGGCCGGGGCGGGG - Intronic
1161648130 19:5467035-5467057 CTGAGCCTGGGGACGGGGCTCGG - Intergenic
1161682528 19:5687226-5687248 CGGAGCCCAGGGGCAGGGCGGGG - Intronic
1161779168 19:6279793-6279815 CGGGGCCCGGGGGCGGGGCGGGG - Exonic
1161991405 19:7686257-7686279 CTGGGCCCGGGGTTGGGGCAAGG + Exonic
1161993326 19:7697645-7697667 CTGAGCCTGGGGCATAGGCGGGG - Intronic
1162019777 19:7863107-7863129 CAGGGCCCGGGGCAGGAGCGGGG + Intronic
1162031850 19:7920883-7920905 ACGAGCCTGGGGGCGGGGCGTGG + Intronic
1162079361 19:8209303-8209325 GGGAGCCCGGGGCGGGGCCGTGG - Intronic
1162285613 19:9736406-9736428 GAGAGTCCGGGGCCAGGGCGCGG - Intergenic
1162332933 19:10041487-10041509 CTCAGTCAGGGGCCGGGGTGAGG - Intergenic
1162426879 19:10602428-10602450 CGGGGCCGGGGCCCGGGGCGGGG + Intergenic
1162471035 19:10872005-10872027 CTGAGCGCGGGGGCCTGGCGTGG + Intronic
1162481225 19:10928214-10928236 CTGAGTTCAGGGCGGGGGCGGGG + Intronic
1162530477 19:11233238-11233260 CAGAGCCAGGGGCCACGGCGAGG + Exonic
1162612428 19:11767060-11767082 CGGAGCCCAGTGCAGGGGCGTGG - Intronic
1162738161 19:12758001-12758023 CGGACCCCGGGGCCCGGGCATGG - Exonic
1162741373 19:12775588-12775610 CTGGGCTTGGGGGCGGGGCGGGG - Intronic
1162901015 19:13795617-13795639 CCGGGGCCAGGGCCGGGGCGGGG - Exonic
1162944162 19:14032151-14032173 CGGAGCCCCGGGGCGGGGTGGGG + Intronic
1162951110 19:14072655-14072677 CCGAGGGCGGGGCCAGGGCGGGG + Intronic
1162954592 19:14091015-14091037 GTTGGCCCGGGGCGGGGGCGGGG + Intronic
1163007482 19:14406000-14406022 CTGAGCCCCGGGAGTGGGCGGGG - Intronic
1163012175 19:14433271-14433293 CGGCGCCCGGGGAGGGGGCGGGG - Intronic
1163433523 19:17282216-17282238 TAGAGCCTGGGTCCGGGGCGGGG + Intronic
1163547229 19:17947796-17947818 CCGGGGCCGGGGCCGGGGCTAGG - Intergenic
1163585488 19:18161382-18161404 CGGGACCCAGGGCCGGGGCGCGG - Exonic
1163635836 19:18436945-18436967 CGGAGCCCTGGGCCGGGGTGGGG - Intronic
1163655744 19:18543732-18543754 CTGGGGCGGGGGCTGGGGCGGGG + Intronic
1163655751 19:18543744-18543766 CTGGGGCGGGGGCTGGGGCGGGG + Intronic
1163655758 19:18543756-18543778 CTGGGGCGGGGGCTGGGGCGGGG + Intronic
1163720250 19:18895309-18895331 CTGCGCCCCGGCCCGGAGCGAGG - Intronic
1163843865 19:19628031-19628053 CTGGGCCCGGGGGAAGGGCGCGG - Intronic
1164274226 19:23702658-23702680 CTGAACCAGGGGCGGGGGCGGGG - Intergenic
1164624064 19:29715096-29715118 GAGCGCCCGGAGCCGGGGCGGGG - Intronic
1164671380 19:30074014-30074036 CTAAGTCCAGGGCCGGGGCAGGG - Intergenic
1165169796 19:33883961-33883983 CTGAGCCCAGGGCTGAGGCTTGG + Intergenic
1165236473 19:34426246-34426268 CTGGTGCCGGGGCCGGGGCCGGG + Intergenic
1165256053 19:34577802-34577824 CTGGGGGCGGGGCAGGGGCGGGG - Intergenic
1165349738 19:35269190-35269212 CCGGGGCCGGGGCCGGGGCGCGG - Intronic
1165751723 19:38264439-38264461 GTGCGCCCAGGGCCGGGGAGCGG + Exonic
1165763324 19:38335446-38335468 TTGAATCCGGGGCAGGGGCGCGG + Intergenic
1165922349 19:39307245-39307267 CGTCACCCGGGGCCGGGGCGAGG - Exonic
1166121666 19:40690585-40690607 CAGGGCCCGGGGCCGGGGGATGG + Exonic
1166547051 19:43639901-43639923 CCGAGGCCGGGGCGGGGCCGGGG + Intergenic
1166753770 19:45178350-45178372 CTGAGTCCGGGGCGGGGAGGCGG - Intronic
1166774915 19:45306649-45306671 CTGGGACAGGGGGCGGGGCGAGG + Exonic
1166809348 19:45506632-45506654 CTCAGCCCGGAGCCGGCGTGTGG + Intronic
1167134536 19:47609001-47609023 CTGGGCGCGGGGCGGCGGCGGGG + Intronic
1167268031 19:48493190-48493212 CTGAGCCTAGAGCGGGGGCGGGG - Intronic
1167306852 19:48714554-48714576 CTGAGACCTGGGGAGGGGCGGGG + Exonic
1167352026 19:48981498-48981520 CTGCGCCAGGGGCCGGAGCGAGG + Intronic
1167368082 19:49065067-49065089 CAGGGCCCGGGTCGGGGGCGGGG + Intronic
1167622760 19:50568345-50568367 CCGGGGCCGGGGCCGGGGCCTGG - Intergenic
1167622763 19:50568351-50568373 CGGGGGCCGGGGCCGGGGCCGGG - Intergenic
1167622766 19:50568357-50568379 CCGAGGCGGGGGCCGGGGCCGGG - Intergenic
1167648304 19:50717393-50717415 CTCATCCCAGGGCCGGGGGGTGG + Intronic
1167688258 19:50969595-50969617 CCCAGCCCGGGGCAGGGGCGGGG - Intronic
1167740794 19:51323895-51323917 GTGAGCCCTTGGCCGGGGCCTGG + Intronic
1167889349 19:52527524-52527546 CAGAGGGCGGGGCCGGGGCGGGG - Intergenic
1167940562 19:52942706-52942728 CAGAGGGCGGGGCGGGGGCGGGG + Intronic
1168076194 19:53982014-53982036 CGGGGCCGGGGGCGGGGGCGGGG + Intronic
1168243487 19:55098627-55098649 CTGAGGCTGGGGCTGGGGCTGGG + Intronic
1168288934 19:55347687-55347709 CTGAGGCTGGGGCAGGGGTGGGG - Exonic
1168293763 19:55369347-55369369 CTGGGCCCCGGGGCGGGGCATGG + Intronic
1168305503 19:55433137-55433159 CTGAGGCCAGGGCCGGGTCTGGG - Exonic
1168382254 19:55933734-55933756 CTGAGCAAGGGGGCTGGGCGCGG + Intergenic
1168489372 19:56795396-56795418 CCCAGCCAGGGGCCTGGGCGGGG - Intronic
1168604411 19:57747069-57747091 CTGAGCCGGGGGCCTCAGCGCGG - Exonic
1168685986 19:58350015-58350037 GCGGGACCGGGGCCGGGGCGGGG + Intronic
1168713693 19:58515398-58515420 CTGAGCCAGGTGCCTGGGCCAGG - Intronic
924987842 2:287946-287968 CGGAGCGCGGGGCGGGGGAGGGG + Intronic
925042159 2:740385-740407 CAGAGCCTGGGGAGGGGGCGGGG + Intergenic
925157496 2:1658752-1658774 ATGAGCCCGATGCCGGGGGGTGG - Intronic
925923894 2:8657244-8657266 CTGAGCTCAGGGTGGGGGCGGGG - Intergenic
926095692 2:10079822-10079844 CGGCGCCCAGGGCTGGGGCGGGG + Intronic
926130928 2:10302831-10302853 CGGAGGCGGGGGCCGGGGCGGGG - Intergenic
926285261 2:11482824-11482846 CCGTGGCCGGGGCCGGGGCCAGG + Intergenic
927207179 2:20618090-20618112 CTCAGCCTGGGGCCTGGGCAGGG - Exonic
927539142 2:23891734-23891756 CTGAGGTGGGGGTCGGGGCGGGG - Intronic
927713793 2:25340855-25340877 CCGGGCCCGGGCCCGGGCCGCGG - Intronic
927714075 2:25341520-25341542 TTGAGCCCGGAGCCGGGCGGGGG + Intronic
927809341 2:26173032-26173054 CGGGGCCCGGGGGCGGGGCCGGG + Intergenic
927881488 2:26692812-26692834 CGGCGGCCGGGGCCGAGGCGCGG + Exonic
927914416 2:26925674-26925696 CTGACCCTGGGGCCTGGGCAGGG - Intronic
927981143 2:27375875-27375897 CCCAGGCCGGGGCCGGGGTGAGG + Exonic
927982113 2:27380669-27380691 CTGAGCTGGGCGCCGGGGCCAGG - Exonic
928471415 2:31580446-31580468 CGGGGGCCGGGGCCGGGGCTTGG - Intronic
928928022 2:36598032-36598054 CCGAGCCTGGGGCGGAGGCGGGG - Exonic
929454081 2:42054248-42054270 CTCAGCCCAGGGCTGGTGCGAGG + Exonic
929775466 2:44928748-44928770 CTGGGGCCGGGGCCAGGGCCGGG - Intergenic
929966837 2:46542815-46542837 CGGCGACCGGGGCCGGGGCGGGG + Exonic
929966907 2:46542984-46543006 CTGAGCCCGGGGCCGGGGCGGGG + Exonic
930177408 2:48314855-48314877 CTGCGCCGCGGGCTGGGGCGGGG - Intronic
930411055 2:51027457-51027479 CGGGGGCCGGGGCCTGGGCGGGG - Intronic
931825524 2:65996628-65996650 CAGAGACGGGGGCGGGGGCGGGG - Intergenic
931940245 2:67244113-67244135 CTGAGCCCAGTGCAGGGGAGGGG + Intergenic
932036642 2:68252576-68252598 CAGCGCGCGGGGCGGGGGCGGGG + Intronic
932137480 2:69243805-69243827 CTGGGCCTGGGGCTGGGGTGTGG - Intronic
932317232 2:70793077-70793099 CTGATCCCTGGGCTGGGGCTGGG - Intergenic
932477157 2:72013487-72013509 CTCAGCCTAGGGCAGGGGCGGGG - Intergenic
932591464 2:73070631-73070653 CGGAGACCGGAGCCGGGGAGGGG - Intronic
933658112 2:84905719-84905741 GTGAGTGCGGCGCCGGGGCGGGG + Intronic
933847462 2:86337415-86337437 CGCAGCCCGGGGCCGGGGGCGGG + Intronic
934567681 2:95349606-95349628 CTGAGCCCGGGGTGGTGGCATGG + Intronic
934936969 2:98472636-98472658 GTGAGCCCTGGGCTGGGGCTAGG - Intronic
934947739 2:98554222-98554244 CTGAGCCCAGGCCAGGGGCTGGG - Intronic
935046628 2:99489499-99489521 CTGCGCCAGGGGTCGGCGCGGGG + Intronic
935592475 2:104855365-104855387 GGGGGCCCGGGGCGGGGGCGGGG + Intergenic
935653175 2:105399182-105399204 CGCAGCCCGGGGCGGGGGCACGG - Intronic
935820212 2:106886648-106886670 CGGAGCTCGGGGGCGGGGCGCGG - Intronic
936600583 2:113890509-113890531 CTGGGACTGGGGCGGGGGCGCGG + Intronic
938054975 2:128208130-128208152 CCGAGCCCGGGGCTGTGGCCGGG - Intergenic
938073080 2:128318577-128318599 CGGGGCCCGGGCGCGGGGCGCGG + Exonic
938301057 2:130213532-130213554 CTGAGCCCGGGGACCGGGGCGGG - Intergenic
938301123 2:130213703-130213725 CAGCGACCGGGGCCGGGGCGGGG - Intergenic
938455593 2:131460764-131460786 CGGCGACCGGGGCCGGGGCGGGG + Intergenic
938455664 2:131460936-131460958 CTGAGCCCGGGGCCGGGGCGGGG + Intergenic
938727229 2:134119873-134119895 CTGAGCGCGCGGCCGGGGGCGGG + Intergenic
939178807 2:138780925-138780947 CAGAGTCCTGGGGCGGGGCGTGG + Intergenic
939629637 2:144516848-144516870 AGGATCCCGGGGCGGGGGCGGGG - Intronic
940831461 2:158470868-158470890 CTGAGTGCGGGGCTGGGGAGGGG + Intronic
940831784 2:158474755-158474777 CTGAGTGCGGGGCTGGGGAGGGG - Intronic
941131072 2:161651105-161651127 CTGAGTCCGGAGGCGGGGTGGGG - Intronic
941619290 2:167758366-167758388 CTGAGCCCAGGACTGGGGCAGGG - Intergenic
941666360 2:168247288-168247310 CCGGGGCCGGGGCCGGGGCCGGG + Exonic
942292577 2:174487085-174487107 CTGAAGGCGGGGCGGGGGCGGGG - Intronic
942414491 2:175744859-175744881 CTGCTTCCGGGGCCGGGGCAGGG - Intergenic
942890260 2:180980275-180980297 CTGGGCCCGCCTCCGGGGCGAGG - Intronic
945245249 2:207711704-207711726 CCCTGCCCGGGGCCGGGCCGCGG + Intronic
946170108 2:217890091-217890113 CTGAGCCGAGGGAGGGGGCGTGG - Intronic
946418620 2:219552704-219552726 CGGAGCCCGGGGCGTGAGCGGGG + Intronic
946440415 2:219690474-219690496 TTGAGCCTGGGGCCCAGGCGGGG + Intergenic
947629592 2:231643440-231643462 TTGAGGCAGGGGCCAGGGCGGGG + Intergenic
947963574 2:234260096-234260118 CTGAGGCTGGGGCTGGGGCTGGG - Intergenic
948202856 2:236142366-236142388 CAGGGGCCGGGGCGGGGGCGGGG - Intergenic
948206309 2:236164448-236164470 CTGAGCGCAGGGCCGGGGTTGGG + Intergenic
948207281 2:236168798-236168820 CTGCGCCTGGGGTCCGGGCGAGG + Intergenic
948216537 2:236237336-236237358 CGGGGGCCGGGGCCGGGGCGCGG + Intronic
948216552 2:236237361-236237383 CGGGGGCCGGGGCCGGGGCGCGG + Intronic
948216567 2:236237386-236237408 CGGGGGCCGGGGCCGGGGCGCGG + Intronic
948216582 2:236237411-236237433 CGGGGGCCGGGGCCGGGGCGCGG + Intronic
948387568 2:237591132-237591154 CTGAGGGCGGGGTGGGGGCGTGG + Intronic
948393337 2:237627568-237627590 CCGGGGCCGGGGCCGGGCCGGGG + Intronic
948575536 2:238947185-238947207 CTGTGCCTGGGGCAGGGGCGGGG + Intergenic
948697166 2:239737927-239737949 CTGGGGCTGGGGCCGGGGCTGGG - Intergenic
948697178 2:239737950-239737972 CTGGGGCTGGGGCCGGGGCTGGG - Intergenic
948697218 2:239738030-239738052 CTGGGGCTGGGGCCGGGGCTGGG - Intergenic
948697264 2:239738126-239738148 CTGGGGCTGGGGCCGGGGCTGGG - Intergenic
948697271 2:239738138-239738160 CTGGGGCCGGGGCTGGGGCTGGG - Intergenic
948697274 2:239738144-239738166 CTGGGGCTGGGGCCGGGGCTGGG - Intergenic
948697281 2:239738156-239738178 CTGGGGCCGGGGCTGGGGCTGGG - Intergenic
948697314 2:239738210-239738232 CCGGGGCCGGGGCCGGGGCCGGG - Intergenic
948697318 2:239738216-239738238 CCGGGGCCGGGGCCGGGGCCGGG - Intergenic
948697322 2:239738222-239738244 ATGGGGCCGGGGCCGGGGCCGGG - Intergenic
948824641 2:240568385-240568407 CTGTGCGCGGGGCCGGGGCGCGG - Intronic
948862109 2:240757652-240757674 CAGGGGCCGGGGCCGGGGCTGGG + Intronic
948886686 2:240888365-240888387 TTGAGCCCGGAGCCGATGCGCGG + Exonic
948911110 2:241003118-241003140 CTGAGCGGGGGGCCCGGGGGAGG - Intronic
1168769757 20:407956-407978 CGGGGGCCGGGGCCGGGGCCGGG - Intronic
1168769761 20:407962-407984 GTGGGCCGGGGGCCGGGGCCGGG - Intronic
1169198253 20:3694705-3694727 CTGAGCCTGGGGCCTGGGCTTGG + Exonic
1169214271 20:3784512-3784534 CTCAGCCCCGGGCCCGGCCGAGG + Exonic
1169262515 20:4148989-4149011 CGGGGCCCGGGGCCGGAGAGCGG - Intronic
1171115549 20:22522078-22522100 CAGAGCCCGGGGGCGGGGAGTGG - Intergenic
1171393542 20:24816458-24816480 CTCAGCCCAGGGCCAGGGCAGGG + Intergenic
1171452835 20:25248021-25248043 CTGCGCGCCGCGCCGGGGCGGGG - Intergenic
1171878645 20:30600287-30600309 CTGAGCCAGGGGCCAGGGCCAGG - Intergenic
1172100932 20:32483642-32483664 CCGGGCACGGGGCGGGGGCGGGG + Intronic
1172143920 20:32743285-32743307 GTGGGCCCGGCGGCGGGGCGTGG - Intronic
1172274942 20:33674287-33674309 CTGGGGCTGGGGCTGGGGCGCGG + Exonic
1172474567 20:35226992-35227014 TGGCGCGCGGGGCCGGGGCGCGG + Intronic
1172529412 20:35619506-35619528 CTGAGGCCCGGGCTGGGGAGCGG + Intronic
1172533511 20:35652822-35652844 CCGGGGCCGGGGCCGGGGCCAGG + Exonic
1172596569 20:36154624-36154646 CCGAGGCCGGGGCGGGGGCGGGG + Intronic
1172702763 20:36863170-36863192 CTGAGCCCGGGCCTGGGCCGCGG + Exonic
1172846701 20:37933975-37933997 CTGGCCCCGGGGACGGGGTGGGG + Intronic
1173516155 20:43666990-43667012 CGGAGCCAGGGGGCGGGGCGGGG - Intergenic
1173548092 20:43914672-43914694 CGGGGGCCCGGGCCGGGGCGTGG - Intergenic
1173800424 20:45891411-45891433 CCGAGCCCGGGATCGGTGCGCGG + Intronic
1174067305 20:47874935-47874957 CTGGGCCCTGGGCCTGGGCGAGG + Intergenic
1174156994 20:48521938-48521960 CTGGGCCCTGGGCCTGGGCGAGG - Intergenic
1174407199 20:50310171-50310193 CTGAGCAAAGGGCAGGGGCGGGG - Intergenic
1174506890 20:51022935-51022957 CTGCCCACGGGTCCGGGGCGAGG + Exonic
1175218248 20:57402706-57402728 TTGGGCCTGCGGCCGGGGCGGGG + Intronic
1175626135 20:60489559-60489581 GGGAGCACGGGGCAGGGGCGGGG + Intergenic
1175783145 20:61696290-61696312 CTGAGCCAGGGGCAGGGCCTGGG + Intronic
1175847038 20:62064853-62064875 CGGCGGCCGGGGCGGGGGCGGGG + Exonic
1175847188 20:62065263-62065285 CCGGGGCCGGGGCCGGGGCCGGG + Exonic
1175877806 20:62238667-62238689 CTGGGGCTGGAGCCGGGGCGGGG + Intronic
1175877832 20:62238738-62238760 TCGAGGCCGGGGCCGGGGCCGGG - Intronic
1175950857 20:62582377-62582399 CGGGGCGCGGGGGCGGGGCGGGG - Intergenic
1175978947 20:62727500-62727522 CTGAGCCCGGCGGCCGGGCAAGG - Intronic
1176005580 20:62860958-62860980 CCGAGGCCGGGGCCGGGGCCGGG - Intronic
1176016794 20:62938105-62938127 CGGAGGCGGGGGCGGGGGCGGGG - Exonic
1176068849 20:63215820-63215842 CCGCGGCCGGGGCCGAGGCGCGG - Intronic
1176093108 20:63327613-63327635 CCGGGCCCGGGGCCCGGGAGGGG + Intronic
1176100443 20:63362072-63362094 CTGAGGCTGGGCCAGGGGCGCGG - Intronic
1176128959 20:63488207-63488229 CGGCGCGCGGGGCGGGGGCGGGG + Exonic
1176135489 20:63520477-63520499 CTGGGCCCGGGAGAGGGGCGGGG + Intergenic
1176137530 20:63530701-63530723 CTGGGGTCGTGGCCGGGGCGTGG - Intronic
1176194602 20:63831378-63831400 CGGTGGCCGCGGCCGGGGCGCGG - Intergenic
1176207213 20:63895487-63895509 CCGCGGCCTGGGCCGGGGCGGGG + Intronic
1176216744 20:63951673-63951695 CTGAGCCCTGGGCGGGGAGGTGG - Intronic
1176216758 20:63951715-63951737 CTGAGCCCTGGGCGGGGAGGTGG - Intronic
1176216772 20:63951757-63951779 CTGAGCCCTGGGCGGGGAGGTGG - Intronic
1176222146 20:63974770-63974792 CTAAGCCTGGGCCCTGGGCGCGG + Exonic
1176519196 21:7812251-7812273 CTGAGCCAGGGGCCCTGGAGTGG - Intergenic
1178440672 21:32595583-32595605 CTGTGCCCGGGGTCGGGATGCGG + Intronic
1178653224 21:34442264-34442286 CTGAGCCAGGGGCCCTGGAGTGG - Intergenic
1178922429 21:36747588-36747610 CTGCGCCCGGGGCTTGGGGGTGG + Intronic
1179628965 21:42665236-42665258 CTGAGCTCGAGGCATGGGCGGGG - Intronic
1179988320 21:44932957-44932979 CAGAGGACGGGGCCGGGGCCGGG + Intronic
1180032983 21:45224665-45224687 GGGAGCCCTGGGCCGGGGCAGGG + Exonic
1180101822 21:45590981-45591003 CGGAGGCGGGGGCGGGGGCGGGG + Intergenic
1180140855 21:45892756-45892778 CTGAGCTTGGGGCCTGGGGGTGG - Intronic
1180198036 21:46208976-46208998 CTGAGGCCGTGGCCGGGACAGGG + Intronic
1180891486 22:19291871-19291893 CAGAGGCGGGGGCAGGGGCGGGG - Intergenic
1180908314 22:19431390-19431412 CCGAGCCCGGAGTCGGGTCGGGG - Intronic
1181006597 22:20016560-20016582 CTGAGCCAGTGGGCGGGGTGTGG - Intronic
1181009592 22:20032622-20032644 CTGAGCCCAGGGCAGGGGTGGGG + Intronic
1181017676 22:20080477-20080499 CCGAGGCCGCGGGCGGGGCGGGG + Intronic
1181115662 22:20631414-20631436 CTGGTCCCGGGGCCTGGGCTGGG + Intergenic
1181121444 22:20670389-20670411 CCAAGCCGGGGGCCGGGGGGCGG - Intergenic
1181299137 22:21867232-21867254 CTGAGGCCGAGGCGCGGGCGAGG + Intronic
1181334403 22:22117413-22117435 CCAAGCCGGGGGCCGGGGGGCGG - Intergenic
1181408902 22:22704383-22704405 CTGAGCCTGGGGCAGGGTCTGGG - Intergenic
1181422552 22:22811836-22811858 CTGAGCCTGGGGCAGGGCCTGGG - Intronic
1181592656 22:23894665-23894687 CGGAGCTGGGGGGCGGGGCGGGG + Exonic
1181811418 22:25405591-25405613 CTCGGCGCGGGGCTGGGGCGCGG + Intergenic
1182295972 22:29311452-29311474 CTGATCCCGGGGCCTGGGGCAGG - Intronic
1182301945 22:29341918-29341940 ATGAGCCCGGGGCCAGGGCATGG - Intronic
1182358777 22:29734824-29734846 CTGGGGCTGGGGCTGGGGCGGGG - Intronic
1182445463 22:30387155-30387177 GCGAGCCGGCGGCCGGGGCGGGG - Exonic
1182903899 22:33920596-33920618 CCGCGCCCCAGGCCGGGGCGAGG - Intronic
1183205981 22:36419257-36419279 CGGAGCCAGGGGCTGGGGCTGGG + Intergenic
1183228149 22:36564289-36564311 CGGTCCCCGGGGGCGGGGCGGGG - Exonic
1183408390 22:37641219-37641241 CGGAGCAGAGGGCCGGGGCGGGG + Intronic
1183465839 22:37980049-37980071 CTGGGCTCAGGGCCGGGGTGGGG - Intronic
1183483008 22:38075176-38075198 CGGAGCCTGGGAGCGGGGCGGGG + Exonic
1183720135 22:39557778-39557800 CGGCGCTCCGGGCCGGGGCGGGG - Intergenic
1183994219 22:41620943-41620965 CCGAGCCCGGGCCCGGGCTGAGG + Exonic
1184115160 22:42417867-42417889 CCAAGCCCGGGGACGGGGCGGGG - Intronic
1184412175 22:44331716-44331738 CTGGGGCCGGGGCCGGGGCTGGG + Intergenic
1184431072 22:44441817-44441839 ATGAGCCTGGGGCCAGGGCGGGG + Intergenic
1184439196 22:44498235-44498257 CCGGGGCCGGGGCAGGGGCGGGG + Exonic
1184465876 22:44668723-44668745 CGGAGCCCGGGGCCGGGGGAGGG - Intronic
1184562110 22:45269263-45269285 CGGAGGCGGGGGCGGGGGCGGGG + Intergenic
1184676308 22:46045143-46045165 CTTCGCCGGGGGCCGGGCCGCGG - Intergenic
1185241274 22:49748942-49748964 CTGGGGCTGGGGCCGGGGCTGGG - Intergenic
1185278763 22:49961054-49961076 CCGGGGCCGGGGCCAGGGCGGGG + Intronic
1185376986 22:50487211-50487233 CTGAGGCCAGGGCAGGGGCTGGG + Intronic
1185409456 22:50674480-50674502 CCGGGGCCGGGGCCGGCGCGGGG - Intergenic
1185418312 22:50721582-50721604 CTGGGCCCGGGGGCTGGGCAGGG - Intergenic
949105756 3:198019-198041 CTCAGCCAGGGGCAGGGCCGGGG + Intronic
949260727 3:2099753-2099775 CTGGGCCCGGGGAGGGGACGGGG - Intronic
950400961 3:12768911-12768933 CCGGGGCCGGGGCCGGGGCGGGG + Intronic
950510007 3:13420324-13420346 ATGAGCGCGGGGGCGGGGCGAGG + Intergenic
950518224 3:13480751-13480773 CTGAGCCAGGGCGGGGGGCGGGG - Intronic
950531936 3:13557223-13557245 CTGAGCCTGGGGACTGAGCGAGG + Intronic
950650209 3:14402538-14402560 CCGGGGGCGGGGCCGGGGCGGGG - Intergenic
950682416 3:14594309-14594331 CAGAGCCCGGGGCAGGGCTGAGG - Intergenic
951543669 3:23806195-23806217 CAGGGCACGGGGCCGGCGCGGGG + Intronic
951881465 3:27484462-27484484 ACGAGCCCGGCGCCGGGGCCAGG + Intergenic
952076375 3:29701951-29701973 CTCTGCCCGCGGCCGTGGCGCGG + Intronic
952867212 3:37862054-37862076 CAGAGCGCGGGGCCGGGCGGCGG + Intronic
954004021 3:47578323-47578345 CCGGGGGCGGGGCCGGGGCGGGG - Intronic
954277963 3:49554675-49554697 CCGGGGCCGGGGCCGGGGCCCGG - Exonic
954277999 3:49554783-49554805 CCGGGGCCGGGGCCGGGGCCAGG - Exonic
954278002 3:49554789-49554811 CCGGGACCGGGGCCGGGGCCGGG - Exonic
954292275 3:49655941-49655963 CTGAGCCCGGGCCCGTGCTGGGG - Exonic
954316220 3:49803200-49803222 TTGGCCGCGGGGCCGGGGCGGGG + Intergenic
954339372 3:49940496-49940518 GTGAGGCTGGGGCCGGCGCGTGG + Intronic
954361325 3:50124304-50124326 CCGGGGCCGGGGCCGGGGCCTGG - Intergenic
954361328 3:50124310-50124332 GTGGGGCCGGGGCCGGGGCCGGG - Intergenic
954581799 3:51707004-51707026 CCGGGGCCGGGGGCGGGGCGGGG + Intergenic
954610356 3:51941802-51941824 CTGGGGCCGGGGCTGGCGCGGGG - Exonic
954632779 3:52056259-52056281 CCGAGCCCGGTGCGGGGTCGGGG - Exonic
954664805 3:52246056-52246078 CTGAGCTGGGGGTCGGGGAGGGG - Intronic
954684032 3:52361022-52361044 CTGACCCCGGAGCCAGGGCTGGG + Intronic
954800259 3:53183207-53183229 GTGAGCCTGGGTCCGGGGCAGGG + Intronic
954812363 3:53256018-53256040 CCGAGGCCGGGCGCGGGGCGGGG + Exonic
956406417 3:68932674-68932696 CTGAGCAGGGGTGCGGGGCGGGG - Intergenic
956659326 3:71583068-71583090 CCGGGCGCGGGGCCGGTGCGGGG - Intronic
956825854 3:72996644-72996666 CTGGGCCTGGGGCTGGGGCTGGG + Intronic
958650102 3:96927253-96927275 CTGAGCCCTGGGCCTGGCCCAGG + Intronic
959045133 3:101465234-101465256 CTGAGCCAGTGGCGGGGGTGAGG - Intronic
961081669 3:124033441-124033463 CGGGGCCCGGGGCCGGGGTGCGG - Intergenic
961360530 3:126364557-126364579 CTGAGCCTGGGGCTGGAGAGTGG - Intergenic
961368271 3:126414869-126414891 CTGAGCCCTGAGTCAGGGCGAGG - Intronic
961446223 3:126983012-126983034 CAGAGCCCGGGGGCGGGGCGGGG - Intergenic
961603406 3:128077075-128077097 CTGACCCCCGGGCAGGGGCCCGG - Intronic
961666839 3:128497942-128497964 CCGGGGCCGGGGCCGGGGCAGGG - Intergenic
961666843 3:128497948-128497970 CTGGGGCCGGGGCCGGGGCCGGG - Intergenic
961827557 3:129606809-129606831 CGCAGCCCGGGGGCGGGGCGGGG + Exonic
962604691 3:137023728-137023750 CGGAGCCAGGGGCAGGGGAGCGG - Intergenic
962809116 3:138946684-138946706 CCGAGCCCGAGGACGCGGCGGGG - Exonic
963974059 3:151460991-151461013 CTGAGCCCGGGACCGAGCCCGGG - Intergenic
965837895 3:172871233-172871255 CTCAGCCTGGGGGCTGGGCGTGG + Intergenic
966350143 3:179024843-179024865 GGGGGCCCGGGGGCGGGGCGGGG - Exonic
966886446 3:184380178-184380200 CCGGGGCCGGGGCCGGGGCCGGG - Exonic
967652957 3:192008981-192009003 CTGAGGCTGGGGCAGGGGAGTGG - Intergenic
967780723 3:193436812-193436834 CTGATCCCCGGGGCCGGGCGCGG + Intronic
968051579 3:195658302-195658324 GAGAGCCCTGGGCCGGTGCGAGG + Intergenic
968104237 3:195990031-195990053 GAGAGCCCTGGGCCGGTGCGAGG - Intergenic
968302538 3:197627621-197627643 GAGAGCCCTGGGCCGGTGCGAGG - Intergenic
968433844 4:575251-575273 CGGAGCCCGGAGCCGCCGCGGGG + Intergenic
968433902 4:575495-575517 CCGAGCCCGGCGCCGAGCCGGGG + Intergenic
968433914 4:575519-575541 CCGAGCCCGGGGCCGAGCCGGGG + Intergenic
968433925 4:575543-575565 TTGAGCCCGGGGCCGAGCCGGGG + Intergenic
968450458 4:673881-673903 CCGCGGGCGGGGCCGGGGCGGGG - Intronic
968479215 4:826306-826328 GTGGACCCGGGGCGGGGGCGGGG + Intergenic
968479270 4:826392-826414 GTGGACCCGGGGCGGGGGCGGGG + Intergenic
968479313 4:826459-826481 GTGGACCCGGGGCGGGGGCGGGG + Intergenic
968506440 4:973352-973374 CCGGGGCCGGGGCCGGGGCCGGG - Exonic
968506445 4:973358-973380 GCGCGCCCGGGGCCGGGGCCGGG - Exonic
968506481 4:973447-973469 CCGAGCCCGGGGCCCGCGCCTGG - Exonic
968512281 4:1001007-1001029 CTGGGGCCCTGGCCGGGGCGGGG + Intronic
968514841 4:1011702-1011724 CGGGGCCGGGGGCCGGGGCCGGG - Intronic
968521817 4:1037616-1037638 CTGAGGCCCGGGCCGCGGTGCGG + Intergenic
968547919 4:1208030-1208052 CTGAGCCCGGCGCCCGGAGGAGG - Intronic
968568305 4:1326620-1326642 CTGAGGCAGGGGCGGGGGTGGGG - Intronic
968651992 4:1763818-1763840 CTGGCCGCGGGGCCGGGCCGGGG + Intergenic
968750604 4:2387057-2387079 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
968801136 4:2743917-2743939 CTGAGCCCAGGGGTGGGGTGAGG + Intronic
968820183 4:2844065-2844087 CTGAGGCGGCGGCGGGGGCGCGG + Intronic
968879821 4:3293108-3293130 GCGGGGCCGGGGCCGGGGCGGGG + Intronic
968879878 4:3293287-3293309 CTGGTCCCGGGCCCGGCGCGGGG + Intronic
969052800 4:4385376-4385398 CTGAGACGGGGGGCGGGGCGGGG + Intronic
969285709 4:6200674-6200696 ATCTGCCCGGGGCGGGGGCGGGG - Intergenic
969344742 4:6563680-6563702 GTGAGCGCGGGCCCGGGGCGGGG + Intergenic
969344821 4:6563898-6563920 CGGAGCGCGGGTGCGGGGCGCGG + Intergenic
969368660 4:6716424-6716446 TGCTGCCCGGGGCCGGGGCGCGG + Exonic
969694229 4:8725708-8725730 CTGAGCCGAGGGCCGGGAGGAGG - Intergenic
969701008 4:8767852-8767874 TTGAGCCAGGGGCCAGGGGGTGG - Intergenic
973292341 4:48483298-48483320 CGGGGCGCGGGGCCGCGGCGCGG + Intergenic
976297273 4:83484963-83484985 GTGAGCCGAGGGACGGGGCGGGG - Intronic
976608723 4:87007225-87007247 CCGAGCCCGGGGCTGCGCCGAGG + Intronic
976702514 4:87986699-87986721 TTGAACCCGGGGCCGGGGGGAGG - Intergenic
977693772 4:99946248-99946270 CCCAGCCCGGAGCCGGGGCTGGG + Intronic
977932166 4:102760999-102761021 CTAGGGGCGGGGCCGGGGCGGGG - Intergenic
978777056 4:112515284-112515306 CTGAGGCCGGGCAGGGGGCGCGG - Exonic
979624137 4:122827090-122827112 CGGAGGCCGGGGCCGGGGCCGGG + Exonic
980405036 4:132344815-132344837 CTGCGGCTGGGGCCGGGGCCGGG + Intergenic
980405039 4:132344821-132344843 CTGGGGCCGGGGCCGGGGCTGGG + Intergenic
980405061 4:132344894-132344916 CTGCGGCTGGGGCCGGGGCTGGG + Intergenic
980405064 4:132344900-132344922 CTGGGGCCGGGGCTGGGGCCGGG + Intergenic
980405071 4:132344912-132344934 CTGGGGCCGGGGCTGGGGCCGGG + Intergenic
980929991 4:139176463-139176485 CTGCGGCCGGCGCCGGGGCTGGG - Intronic
981508362 4:145527953-145527975 CCAGGGCCGGGGCCGGGGCGGGG - Intronic
981508368 4:145527959-145527981 TTGAACCCAGGGCCGGGGCCGGG - Intronic
981782675 4:148444911-148444933 CAGGGCCCGGGGAGGGGGCGCGG - Intergenic
982042394 4:151409109-151409131 CGGGGGCGGGGGCCGGGGCGGGG - Intergenic
984889041 4:184474900-184474922 CCGAGTCGGGGTCCGGGGCGGGG + Intergenic
984950637 4:185005107-185005129 CTGAGCCTGGGGCCTTGGCTTGG - Intergenic
985068354 4:186144728-186144750 CCGGGGCCGGGGCCGGGGCCCGG + Intronic
985472398 5:53997-54019 CTGAGACCGGGGGCGGCGCCTGG + Intergenic
985497642 5:218555-218577 GAGAGCCCTGGGCCGGTGCGAGG + Intronic
985593615 5:777898-777920 GGGAGCCCGGGGCGGGGGAGGGG + Intergenic
985830327 5:2223399-2223421 CTGAACCTGGGGCCGCAGCGAGG - Intergenic
986674126 5:10168606-10168628 CTGTGCCAGTGGCAGGGGCGAGG - Intergenic
986721610 5:10564430-10564452 GCGGGCCGGGGGCCGGGGCGCGG - Intronic
986733277 5:10650132-10650154 CTGGGGCCGGGGCTGGGGCCGGG + Exonic
986733282 5:10650138-10650160 CCGGGGCTGGGGCCGGGGCGGGG + Exonic
987050286 5:14143164-14143186 CGGAGCCTGGGGGAGGGGCGGGG - Intergenic
987258434 5:16179999-16180021 GTGAGCGCGGGGCCGGCCCGTGG - Intronic
988516788 5:31912035-31912057 CTGGGGCTGGGGCCGGGGCCAGG - Intronic
989146966 5:38258644-38258666 CGGATCCCCGGGCCGGGGCGAGG - Exonic
990545449 5:56816388-56816410 AGGAGCCCGGGGGCGGGGCACGG + Intronic
990825452 5:59893413-59893435 CTGGGGCTGGGGCTGGGGCGAGG + Exonic
991371611 5:65925711-65925733 CTGCGGCGGGGGCGGGGGCGGGG - Intergenic
992939567 5:81750241-81750263 CTGGGGCTGGGGCGGGGGCGGGG - Intronic
992939571 5:81750247-81750269 CTGGGGCTGGGGCTGGGGCGGGG - Intronic
995724676 5:115170237-115170259 CCGAGGGCGGCGCCGGGGCGGGG + Intronic
996978497 5:129461474-129461496 CTGGGCCGGGGGCGGGGACGGGG - Exonic
997305082 5:132830679-132830701 CTGAGGCCGCGGCCGGAGCCTGG - Exonic
997602273 5:135148781-135148803 CTGGGCCAGGGGCCTGGGCTTGG + Intronic
999321613 5:150618728-150618750 CTGGGCCCAGGGCCAGGGCTGGG - Exonic
999650656 5:153764346-153764368 CTGAGCACGGGTCCGGGGCTTGG - Intronic
1001370596 5:171196626-171196648 CTGAGCAGGGGGATGGGGCGAGG + Intronic
1001424857 5:171616344-171616366 CGGAGCCAGGGGGCGGGGGGAGG - Intergenic
1001597646 5:172908294-172908316 CTGAGGCGGGGGCGGGGGGGGGG + Intronic
1002046320 5:176543453-176543475 ATTCGCGCGGGGCCGGGGCGGGG - Intronic
1002061332 5:176627648-176627670 CTGAGCCCGGCGGGGGGGTGGGG + Intronic
1002163916 5:177332962-177332984 CTGGGCCCGAGGCCTGGGTGTGG - Intronic
1002170335 5:177371073-177371095 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1002170339 5:177371079-177371101 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1002170343 5:177371085-177371107 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1002170347 5:177371091-177371113 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1002170351 5:177371097-177371119 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1002170355 5:177371103-177371125 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1002176545 5:177404212-177404234 CTGAGGCGGGGTCCGGGTCGTGG + Exonic
1002487653 5:179550627-179550649 CTGGAGCCGGGGCCGGGGCCCGG + Exonic
1003078054 6:2999777-2999799 CGGGGCTCGGGGGCGGGGCGGGG + Intronic
1003567004 6:7230424-7230446 CTGCGGCCGCGGCCTGGGCGGGG + Exonic
1005859264 6:29888445-29888467 CTGACCGCGGGGGCGGGGCCAGG + Intergenic
1005864425 6:29927156-29927178 CTGACCGCGGGGGCGGGGCCAGG + Intergenic
1005866829 6:29943246-29943268 CTGACCGCGGGGTCGGGGCCAGG + Exonic
1005883172 6:30075277-30075299 CTGAGCCTGGGGCCCGTGCGGGG - Exonic
1005926683 6:30451133-30451155 CTGAGCCCGGGGCCACCGCTGGG - Intergenic
1005963158 6:30707657-30707679 CAGAGCCTGGGGTGGGGGCGGGG - Exonic
1006043112 6:31271348-31271370 CTGACCGCGGGGGCGGGGCCAGG - Exonic
1006052703 6:31356442-31356464 CTGACCGCGGGGCCGGGGCCAGG - Exonic
1006294380 6:33163556-33163578 GGGAGCCCTGGGCCAGGGCGTGG - Exonic
1006300729 6:33192500-33192522 CCGGGCCGGGGGCGGGGGCGAGG - Intergenic
1006406888 6:33850738-33850760 CTGAGCCCTGGGGCTGGGAGAGG + Intergenic
1006472230 6:34235652-34235674 CTGGGCCCGGCGCGGAGGCGGGG - Intergenic
1006558469 6:34889200-34889222 GTGAGCTAGGGGGCGGGGCGCGG + Intergenic
1006814078 6:36839236-36839258 CTGCGTCCAGGGCCGGGGCAAGG + Intronic
1007421671 6:41723537-41723559 CTGAGCCCGGCCCTGGGGCTGGG - Intronic
1007424087 6:41735573-41735595 CGGAGCCCGGGCGCCGGGCGCGG - Intronic
1007479021 6:42137804-42137826 CCGAGGCAGGGGCGGGGGCGGGG + Intronic
1007557812 6:42782000-42782022 CGGGGCCGGGGGCCGGAGCGCGG - Intronic
1007591157 6:43021677-43021699 CCGGGGCCGGGGCCGGGGCCGGG + Exonic
1007625387 6:43243624-43243646 CATCCCCCGGGGCCGGGGCGGGG - Intergenic
1007634660 6:43291646-43291668 CTGAACCCAGGGCTGGGGAGGGG - Intergenic
1007759906 6:44127630-44127652 CGGAGCCCCGGGTTGGGGCGGGG - Intronic
1010083067 6:71886630-71886652 CGGGGCGCGGGGCGGGGGCGGGG - Intergenic
1011044669 6:83068001-83068023 CTGGGGCCGGGGCCTGGGCCGGG + Intronic
1011277439 6:85643763-85643785 CGGAGCCGGGGGCGGGGGCCGGG - Intronic
1012111804 6:95244451-95244473 CTGAGCCCTGGGGAGGGGTGGGG - Intergenic
1012912914 6:105137256-105137278 CGGAGCCCGGCGCCGCGGCCAGG + Intergenic
1013372666 6:109483542-109483564 TTGGGGCCGGGGCCGGGGCCGGG + Intergenic
1013372670 6:109483548-109483570 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1013372674 6:109483554-109483576 CCGGGGCCGGGGCCGGGGCAGGG + Intergenic
1013792726 6:113855258-113855280 CGGAGCACTGGGCCGGGGAGGGG - Intergenic
1014045241 6:116877203-116877225 CGGAGCCCCAGCCCGGGGCGGGG - Intronic
1015625891 6:135181062-135181084 GGGAGCCCGGGGCCAGGGAGGGG - Intergenic
1015635660 6:135271503-135271525 CTGAGCCCAGGGCAGAGGGGCGG + Intergenic
1015732257 6:136360971-136360993 CTGGGGCCGGGGCCAGGGTGGGG + Intronic
1016820627 6:148343000-148343022 CTGCGCGCGGGTGCGGGGCGAGG + Exonic
1016936411 6:149451656-149451678 CTGGGCGCGGGGCCGAGGTGGGG + Intronic
1017096757 6:150811720-150811742 CTGAGGCAGGGGCTGGGGCAGGG + Intronic
1017671837 6:156777207-156777229 CTGGGGCCGGGGCCGGGGCCGGG - Intergenic
1017671840 6:156777213-156777235 CTAAGGCTGGGGCCGGGGCCGGG - Intergenic
1018150284 6:160931181-160931203 TGGGGCCCGGGGCGGGGGCGCGG + Intergenic
1018628711 6:165804744-165804766 GTGAGCGCGGGGTCGGGGAGCGG + Intronic
1018731755 6:166656774-166656796 CTGAGCCAGGGGCTGGGGATCGG - Intronic
1019151305 6:170007766-170007788 GTGAGCCCGGGGGCGGCGCAGGG + Intergenic
1019198430 6:170295850-170295872 TGGAGCCCGGGGCCGAGGCCAGG + Intronic
1019246285 6:170712485-170712507 CTGCGGCCGGGGCCAGCGCGGGG - Intergenic
1019343089 7:517633-517655 CTGGTTCCAGGGCCGGGGCGAGG - Intronic
1019379121 7:712227-712249 CTGAGGCCGGGTTTGGGGCGGGG - Intronic
1019421890 7:954499-954521 CCGATGCCGGGGCCGGGGCCGGG + Intronic
1019422582 7:957965-957987 CTGAGCACGGGGCCTGCGCGTGG + Intronic
1019466782 7:1194016-1194038 CTGAGCCGGGTGCCAGGGGGTGG + Intergenic
1019472600 7:1229574-1229596 CGGAGTCCGGGTCCGGGTCGGGG - Intergenic
1019472643 7:1229678-1229700 CAGAGGCCGCGGCCCGGGCGGGG + Intergenic
1019488599 7:1300758-1300780 CTGAGCCCGGCAGCTGGGCGGGG + Intergenic
1019506337 7:1393363-1393385 CTGAGCCAGGGACCAGGGCCAGG + Intergenic
1019786388 7:2980135-2980157 CAGTGCCAGGGGCCGGGGAGTGG - Intronic
1019986326 7:4658955-4658977 CTGATTCCCGGTCCGGGGCGTGG + Intergenic
1020106989 7:5426791-5426813 CAGGGCGCGGGGCCGGGGAGCGG - Intergenic
1020137378 7:5594578-5594600 CTGGGCCCGGGGGCGGCGCGGGG - Intronic
1020137383 7:5594585-5594607 CCGAGCCCTGGGCCCGGGGGCGG - Intronic
1020274298 7:6615510-6615532 CGGCGGCGGGGGCCGGGGCGCGG + Intergenic
1020274330 7:6615600-6615622 CCGGGCCGGGGGCGGGGGCGCGG - Exonic
1020274370 7:6615696-6615718 CGGGGGCCGGGGCGGGGGCGGGG - Exonic
1020278188 7:6637188-6637210 CTGGGCCTCGGGCCGGGGCGAGG - Intergenic
1022031116 7:26492601-26492623 CTGAGCTCGGGGCAGGGGTGAGG - Intergenic
1022105374 7:27192811-27192833 CTGAGCCCGGAGCCGAGCGGTGG - Intergenic
1022471154 7:30682528-30682550 CTGCGCCGGGGGGCGGGGCCGGG + Intronic
1022830357 7:34059555-34059577 CTGAGGCCGGGGCCTTGGCAGGG - Intronic
1023873686 7:44275896-44275918 CTGACCCTGGGGCAGGGGAGGGG + Intronic
1025795588 7:64736777-64736799 CTGAGCCCGGGTCCCTGCCGAGG + Intergenic
1025850504 7:65239782-65239804 CTGAGCGCGAGGGCGGGGCGGGG + Intergenic
1026806925 7:73434556-73434578 CGGAGACCTGGGCCCGGGCGCGG + Exonic
1026828899 7:73599967-73599989 CTAAGCCTGGGGCTGGGGAGGGG - Intronic
1026968587 7:74454701-74454723 CCCTCCCCGGGGCCGGGGCGGGG - Intronic
1028171333 7:87600479-87600501 CTGAGCCCGCGGGCGGTGGGTGG - Intronic
1029110554 7:98211376-98211398 CTCGGGGCGGGGCCGGGGCGGGG - Intergenic
1029270572 7:99374756-99374778 CAGAGTCCGCGGCCGGGGCGCGG + Exonic
1029351481 7:100015913-100015935 CTGATCCTGGGGGTGGGGCGGGG - Intronic
1029585067 7:101465373-101465395 CTGAGCCCTGGGCTGTGGCGGGG + Intronic
1030188722 7:106789798-106789820 CTGAGCCCAGGGCGGGGAGGAGG + Intergenic
1031833923 7:126659037-126659059 CTGAACCTGGGGGCGGGGCGGGG - Intronic
1031887004 7:127253420-127253442 GCGAGCCCGGGACCGGCGCGGGG + Intergenic
1032014537 7:128369599-128369621 CCGAGGCCGGAGCGGGGGCGGGG + Intergenic
1032068902 7:128791856-128791878 CTGAGCGCGGGGCGAGGGTGGGG + Intronic
1032410797 7:131692269-131692291 CGGAGCCCAGGGCCGTGGCCGGG - Intergenic
1032501429 7:132403170-132403192 CTGAGTCTGGGGCCGGGACCTGG - Intronic
1033390740 7:140924882-140924904 CTGCGCCCGGGGCCGCGGGCCGG - Intergenic
1033401175 7:141026711-141026733 CTGAGCCCTGGGCTGGTGCTAGG + Intergenic
1033477133 7:141702039-141702061 CTGGGGCCGGGGCGGCGGCGGGG - Exonic
1034162767 7:149005118-149005140 GTGAGCCCGTGGCTGGGGCTGGG - Intronic
1034445989 7:151114700-151114722 CTGGGCCCGGGCCGGGGCCGCGG - Intronic
1034483615 7:151341991-151342013 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1034494200 7:151410249-151410271 CTGAGCCAAGGGCCGGGACGAGG + Intronic
1034646876 7:152655626-152655648 CTGAGCCCGGGGGTTGGTCGAGG + Intronic
1035167451 7:157000068-157000090 GGGAGCCCGGGGGCGGAGCGGGG + Intronic
1035212334 7:157337339-157337361 CTGGGGCCGGGGCCGGGGCTGGG + Intronic
1035404255 7:158587833-158587855 CCGGGGGCGGGGCCGGGGCGGGG - Intergenic
1035431802 7:158828742-158828764 GTGGGCCGGAGGCCGGGGCGGGG + Intronic
1035431830 7:158828814-158828836 CGGGGCCGGGGGGCGGGGCGGGG + Intronic
1035496816 7:159335242-159335264 CTGCGCCCCGCGCCGGCGCGGGG + Intergenic
1035501787 8:95204-95226 CTGCGGCCGGGGCCAGCGCGGGG + Intergenic
1037450802 8:19014015-19014037 CTGGGCCCAGGGCGGGCGCGCGG - Intronic
1037589951 8:20303965-20303987 CGGGTCCCGGAGCCGGGGCGGGG + Intergenic
1037769161 8:21788983-21789005 CCGAGCCCGGGGCGGAGGAGAGG - Intronic
1037820623 8:22133146-22133168 GTGAGCCAGGGGTCGGTGCGGGG - Intronic
1037936484 8:22918379-22918401 CTCAGCCCGGGGGTGGGGTGGGG - Intronic
1038726074 8:30083297-30083319 CCGCGCCCGCGGGCGGGGCGAGG + Intergenic
1038727678 8:30095660-30095682 CCAAGCGCAGGGCCGGGGCGGGG - Intronic
1038761263 8:30385217-30385239 CGGGGCGCGGGCCCGGGGCGCGG + Intronic
1039936869 8:42052525-42052547 CGGAGCCCGAGGGCGGGGCCTGG + Intergenic
1042591494 8:70402774-70402796 CTGGGGCCGGGGCCGGGGGCGGG - Intronic
1043147287 8:76674183-76674205 CGTCGCCCGGAGCCGGGGCGCGG - Intergenic
1044591298 8:93916812-93916834 CTGCGGCCGGGGGTGGGGCGGGG - Intronic
1045387996 8:101689672-101689694 CTGGGCCCGGGACTGGGGAGAGG + Intronic
1045432053 8:102123817-102123839 CGGGGGCCGGGGCCGGGGCCGGG - Intronic
1046713389 8:117539647-117539669 CAGGGCCTGGGGCCGGGGCTGGG + Intronic
1047393728 8:124475038-124475060 CAGGGCCCGGGGCCGCGGCCGGG - Exonic
1049145880 8:141000947-141000969 CAGAACCCGGGCCGGGGGCGCGG + Intronic
1049194680 8:141308606-141308628 CCGGGGCCGGGGCCGGGGCCGGG - Intergenic
1049264914 8:141662666-141662688 CTGAGCCTGGGGCTGGGGAAGGG + Intergenic
1049419572 8:142510823-142510845 CCGGGGCCGGGGCCGGGGCGCGG + Intronic
1049462786 8:142737805-142737827 CTGAGCCCTGGAGCAGGGCGGGG + Intergenic
1049693686 8:143973577-143973599 CTGGGTGCGGGGGCGGGGCGGGG - Intronic
1049706588 8:144046003-144046025 CTGGGCCTGGGGCCAGGGCCAGG - Intronic
1049717692 8:144100682-144100704 CCGGGGCCGGGGCCGGGGCCAGG - Intronic
1049752417 8:144291514-144291536 CTGGGCCGGGGACCAGGGCGGGG + Intergenic
1049756636 8:144313797-144313819 CAGCACCCGGGGGCGGGGCGGGG - Intronic
1049801196 8:144518167-144518189 GGGAGCCCGGGGCCGAGGCCGGG + Intronic
1050472314 9:6007100-6007122 CTGGGCCAGGGGCCTGGGGGCGG - Intronic
1050537687 9:6645107-6645129 CTGGGTCCCGGGCCGTGGCGTGG - Intronic
1051170454 9:14315003-14315025 CCCAGGCCGGGGCTGGGGCGCGG + Intronic
1051629556 9:19128899-19128921 CTGTGTCGGGGGCCGGGGGGGGG - Intronic
1052362245 9:27573520-27573542 CCGGGGCCGGGGCCGGGGCGTGG - Intronic
1053163532 9:35829428-35829450 CATGGCCCGGGGCGGGGGCGGGG - Intronic
1053163537 9:35829434-35829456 CTGGGCCATGGCCCGGGGCGGGG - Intronic
1053786337 9:41655233-41655255 CTGGGCCGGGGTCCGGGGCCGGG + Intergenic
1055730816 9:79277868-79277890 CAGGGCACGGGGCCGGGGAGGGG + Intergenic
1055757323 9:79570985-79571007 CTGGGGCCGGGGCCGCGGGGTGG - Intergenic
1055785199 9:79863724-79863746 CCGGGGCCGGGGCCGGGGCCAGG - Intergenic
1055785202 9:79863730-79863752 CCGGGGCCGGGGCCGGGGCCGGG - Intergenic
1055785207 9:79863736-79863758 AGCAGCCCGGGGCCGGGGCCGGG - Intergenic
1055829159 9:80359500-80359522 CTGGGGCCGGGGCCGGGGCCGGG + Intergenic
1056126094 9:83537802-83537824 CTGCGCCCGGGCTAGGGGCGCGG - Intronic
1056382590 9:86068524-86068546 CTGAGACCTGGGCAGGGGCAGGG - Intronic
1056459939 9:86799964-86799986 CTGAGCCCAGGGTAGGGGCCGGG - Intergenic
1056765608 9:89442896-89442918 CTGGGCCCCGGGCCTGGGCTGGG + Intronic
1056853370 9:90103449-90103471 CTGAACCTGGGGTGGGGGCGGGG - Intergenic
1057025632 9:91732432-91732454 CTGAGCCCGGGGCCTGGGTGTGG - Intronic
1057054449 9:91949993-91950015 CAGAGCTTCGGGCCGGGGCGCGG + Exonic
1057265824 9:93617119-93617141 CTGAGCCAGGGGCCAGGGCCAGG + Intronic
1057311081 9:93943697-93943719 CTGAGGCAGGGGCAGGGGCAGGG - Intergenic
1057353539 9:94318580-94318602 CTGAGCCCAGGCCCTGGGTGCGG + Exonic
1057470175 9:95349863-95349885 CGGAGCCCGGGACCCGGGCGGGG - Intergenic
1057654212 9:96939012-96939034 CTGAGCCCAGGCCCTGGGTGCGG - Exonic
1057747627 9:97764405-97764427 TTGAGCACGGGCCGGGGGCGGGG - Intergenic
1058432039 9:104928245-104928267 CAGAGGCCGGGAACGGGGCGGGG - Intergenic
1058908590 9:109500022-109500044 CTGAGCCCGGGGGCGCTGGGTGG - Intergenic
1058967278 9:110049376-110049398 CCGGGACCGGGGCCGGGGCCCGG - Intronic
1058967281 9:110049382-110049404 CTGGGGCCGGGACCGGGGCCGGG - Intronic
1059769857 9:117414889-117414911 CGGAGCCCCGAGCCGGGGCCGGG + Exonic
1060209103 9:121699486-121699508 CGCAGCCCGGGGCGGCGGCGCGG - Intronic
1060283492 9:122228885-122228907 CTGCGCGCGGGCCGGGGGCGGGG - Intronic
1060407803 9:123381470-123381492 CCGAGTCTGGGGCCGGGGCCAGG + Exonic
1060417172 9:123439126-123439148 CTGAGCCTGGAGCTGGGGGGAGG + Intronic
1060478062 9:124000024-124000046 CGGCGCGCGGGGCCGGGGAGGGG - Intergenic
1060485736 9:124045348-124045370 CTGAGCCCGGGGCGGGGGTGGGG + Intergenic
1060550500 9:124482698-124482720 CTGGGGGCGGGGCCTGGGCGGGG - Exonic
1060550523 9:124482739-124482761 TTGAGCCTGGGCCGGGGGCGGGG - Exonic
1060596459 9:124851983-124852005 ATGTGCCCAGGGCCGGGGCATGG + Intergenic
1060695657 9:125707049-125707071 CAGAGCTCGGGGCAGGGGCCGGG - Exonic
1060814197 9:126626243-126626265 CTGCGCCCGGAGCCTGGGCTCGG - Intronic
1060897058 9:127224988-127225010 TTGGGAGCGGGGCCGGGGCGGGG + Intronic
1060939310 9:127534581-127534603 CTGAGGCAGGGCCCGGGGTGTGG - Intronic
1060951811 9:127608672-127608694 CTGGGACCGGGTCGGGGGCGCGG + Intergenic
1061089922 9:128420794-128420816 CGGGGCCTGGGGCCCGGGCGGGG - Exonic
1061275898 9:129569216-129569238 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1061275901 9:129569222-129569244 CCGGGGCCGGGGCCGGGGCCAGG + Intergenic
1061293711 9:129666162-129666184 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1061293714 9:129666168-129666190 CCGGGGCCGGGGCCGGGGCGCGG + Intronic
1061415883 9:130446547-130446569 CTGAGCGCCTGGCCGGTGCGGGG + Intronic
1061484636 9:130914152-130914174 CTGAGGCCCAGGCCTGGGCGAGG + Intronic
1061559651 9:131394275-131394297 CCGGGGCCGGGGCCGGGGCGTGG + Intronic
1061627856 9:131852041-131852063 CTGGGCCTGGGGCCGGGCTGTGG + Intergenic
1061671785 9:132192917-132192939 CTGCTTCCCGGGCCGGGGCGGGG + Intronic
1061765590 9:132879050-132879072 CTGACCCAGAGGCCGGGGTGGGG - Intronic
1061799416 9:133105827-133105849 CTGGGGCGGGGGCTGGGGCGGGG - Intronic
1061799423 9:133105839-133105861 CTGGGGCGGGGGCTGGGGCGGGG - Intronic
1061799440 9:133105869-133105891 CTGGGGCGGGGGCTGGGGCGGGG - Intronic
1061799447 9:133105881-133105903 CTGGGGCGGGGGCTGGGGCGGGG - Intronic
1061799454 9:133105893-133105915 CTGGGGCGGGGGCTGGGGCGGGG - Intronic
1061816447 9:133200076-133200098 CTGAGCCCGGGGACGGGCAAAGG + Intergenic
1061901134 9:133672650-133672672 CAGAGCCCGGTGCTGGGCCGGGG - Intronic
1061961776 9:133992359-133992381 CGGGGCTCAGGGCCGGGGCGGGG + Intronic
1062022725 9:134326840-134326862 CTTTTCGCGGGGCCGGGGCGGGG + Intronic
1062024359 9:134333430-134333452 CTGTACCCGGGGCCAGGGCTGGG + Intronic
1062035906 9:134382414-134382436 CAGAGCTGGGGGCTGGGGCGGGG + Intronic
1062230638 9:135479891-135479913 CTCCGCCCTCGGCCGGGGCGCGG - Exonic
1062287765 9:135780716-135780738 CTGAGCCGGGGACTGGGGCCAGG - Intronic
1062361080 9:136188431-136188453 CTGGGGCCGGGGGCGGGGCGTGG + Intergenic
1062385306 9:136307010-136307032 CTCACCCTGGGGCTGGGGCGGGG + Intergenic
1062389343 9:136327774-136327796 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1062389347 9:136327780-136327802 CCGGGGCCGGGGCCGGGGCTGGG + Intronic
1062414280 9:136439868-136439890 CTGTGGGCGGGGCCGGGGCGCGG - Intergenic
1062547459 9:137070116-137070138 CTGATCCCCGGGCCGGGCCGGGG + Exonic
1062565801 9:137163477-137163499 CTGGGGGCGGGGCCGGGGCGGGG - Intronic
1062591896 9:137278103-137278125 TTGAGCCTGGGGACGGGGCCCGG + Intronic
1062595108 9:137295863-137295885 CAGAGCCGAGGGCCGGGCCGAGG - Intergenic
1062596425 9:137301947-137301969 CTGAGCCCCGGCCCGGCCCGCGG - Exonic
1062653422 9:137590112-137590134 CGGCGGCCGGGGCGGGGGCGCGG - Intronic
1062659145 9:137619202-137619224 CTCAGGCCGAGGCCGGGCCGAGG + Intronic
1203607049 Un_KI270748v1:67868-67890 CTGCGGCCGGGGCCAGCGCGGGG - Intergenic
1185464205 X:345694-345716 CTGAGCGCGGGGCCTCTGCGGGG + Intronic
1186466240 X:9786355-9786377 CCGGGGCCGGGGCCGGGGCCGGG - Intergenic
1187416512 X:19097689-19097711 CTGCCACCGGGGCCGGGGTGGGG - Intronic
1187443965 X:19344319-19344341 CTGGGCCCGGGGGCGGGAGGTGG - Intronic
1188141597 X:26558102-26558124 CAGAGCCTGGGGCCTGGGCAGGG - Intergenic
1189294474 X:39908987-39909009 CTGATCCCAGGGCGGGGGTGGGG - Intergenic
1189310629 X:40014936-40014958 CGGAGCGCGGGGCGGGGGCGGGG - Intergenic
1189320988 X:40087119-40087141 CTGGGGCCGGGGCCGGGACAGGG + Intronic
1189335729 X:40169807-40169829 CTGGGCCGGGAGCCAGGGCGGGG + Intronic
1190008128 X:46759165-46759187 CTGCGCCCGGGGCCGCGCGGGGG + Intronic
1190385630 X:49879955-49879977 CCGGGGCCGGGGCCGGGGCGGGG - Exonic
1190783976 X:53625833-53625855 CCGGGGCCGGGGCCGGGGCCAGG + Intronic
1190783992 X:53625857-53625879 CCGGGGCCGGGGCCGGGGCCGGG + Intronic
1190783995 X:53625863-53625885 CCGGGGCCGGGGCCGGGGCCAGG + Intronic
1191253377 X:58269692-58269714 CTGGGCCCGGGGTGGGGGCGGGG - Intergenic
1192122028 X:68465279-68465301 CTGAGTCCTGGGCTGGGGCAGGG + Intergenic
1192152008 X:68718372-68718394 CTGGGGCCGGGGCCGGGGCTGGG - Exonic
1192203667 X:69082581-69082603 CTGAGGCTGGGGCTGGGGCTGGG - Intergenic
1192452632 X:71253476-71253498 GTGGGCACGGGGCCAGGGCGGGG - Intronic
1195095099 X:101494051-101494073 CTGAGGCTGGGGCTGGGGCTGGG + Exonic
1195095113 X:101494087-101494109 CTGAGGCTGGGGCTGGGGCTGGG + Exonic
1196707339 X:118727683-118727705 CTGCGCCGGCGGCGGGGGCGGGG + Exonic
1196909276 X:120469133-120469155 CTGAGCCCGGAACCGGGAAGAGG + Exonic
1197734891 X:129843400-129843422 CGGAGTCCGGGGCCGAGCCGCGG + Intronic
1198265402 X:135004206-135004228 CTCAGAACGGGGCCGGGCCGCGG - Intergenic
1198276272 X:135098201-135098223 CTGAGACCGCGGCCAGGGCCAGG + Intergenic
1198310234 X:135422539-135422561 CTGAGACCGCAGCCGGGGCCAGG - Intergenic
1198748816 X:139918539-139918561 TTGAACCCGGGGCGGGGGTGGGG + Intronic
1198767145 X:140091495-140091517 CTGAGCCGGCGGGCGGGGCGGGG + Intergenic
1199718530 X:150525159-150525181 CTGGGTGCAGGGCCGGGGCGGGG - Intergenic
1199736883 X:150693582-150693604 CCGAACCCGGGGCCGGCGGGCGG + Exonic
1200036328 X:153334091-153334113 ACGAGACTGGGGCCGGGGCGGGG + Intergenic
1200038200 X:153346701-153346723 CTGAGCACGGGGCCTGGGCCCGG - Intronic
1200107684 X:153724134-153724156 CTGGTCTCGGGGGCGGGGCGGGG - Intronic
1200209648 X:154341590-154341612 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1200209652 X:154341596-154341618 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1200209656 X:154341602-154341624 CCGGGGCCGGGGCCGGGGCCGGG + Intergenic
1200221196 X:154390490-154390512 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1200221200 X:154390496-154390518 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1200221204 X:154390502-154390524 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1200221208 X:154390508-154390530 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1200221212 X:154390514-154390536 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1200221216 X:154390520-154390542 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1200221220 X:154390526-154390548 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1200221224 X:154390532-154390554 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1200221228 X:154390538-154390560 CCGGGGCCGGGGCCGGGGCCGGG - Intronic
1200239609 X:154486745-154486767 CGGGGGGCGGGGCCGGGGCGCGG - Intergenic
1200277899 X:154751277-154751299 CTGTGCCCGGGGGGGGGGTGTGG + Intronic