ID: 929966908

View in Genome Browser
Species Human (GRCh38)
Location 2:46542985-46543007
Sequence TGAGCCCGGGGCCGGGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1337
Summary {0: 3, 1: 0, 2: 20, 3: 144, 4: 1170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929966895_929966908 -4 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
929966884_929966908 30 Left 929966884 2:46542932-46542954 CCTGCGGCGCGGAGCGGCGGCGA 0: 1
1: 3
2: 1
3: 24
4: 163
Right 929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
929966896_929966908 -5 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
929966894_929966908 -3 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
929966897_929966908 -6 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170
929966898_929966908 -7 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG 0: 3
1: 0
2: 20
3: 144
4: 1170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929966908 Original CRISPR TGAGCCCGGGGCCGGGGCGG GGG Exonic
900094776 1:935916-935938 TGAGGGCGGGGTCGGGGCTGTGG + Intronic
900115277 1:1025517-1025539 TGAGCCCTGGGCAGGAGAGGGGG - Intronic
900180376 1:1308534-1308556 AGCGGCCGGGGCCGGGGGGGAGG + Intronic
900243357 1:1627056-1627078 TGAGCCTGGGGGCAGGGCTGAGG - Exonic
900245064 1:1632817-1632839 TGGGCCCGGGACCCGGGTGGGGG - Exonic
900256295 1:1699976-1699998 TGGGCCCGGGACCCGGGTGGGGG - Intronic
900342231 1:2194664-2194686 TGAGGCCGGGAGCCGGGCGGGGG - Intronic
900342285 1:2194808-2194830 TGGAGGCGGGGCCGGGGCGGGGG - Intronic
900372413 1:2337822-2337844 GGAGGCAGGGGCTGGGGCGGTGG + Intronic
900388199 1:2420155-2420177 TGAGGTAGGGGCTGGGGCGGGGG - Intergenic
900580766 1:3407509-3407531 GGAGTCAGGGGCTGGGGCGGGGG + Intronic
900584878 1:3427985-3428007 TGTGCCTGGGGACGGGGCTGTGG - Intronic
900629322 1:3625275-3625297 TGAGGCAGGGGCCAGGGCCGGGG + Intronic
900629326 1:3625281-3625303 AGGGGCCAGGGCCGGGGCGGGGG + Intronic
900970806 1:5991768-5991790 GGAGCCGGGGGGCGGGGAGGAGG + Intronic
901007727 1:6179906-6179928 TGCGCCTGGGGCCAGAGCGGCGG - Intronic
901019756 1:6249694-6249716 GGGGGCCGGGCCCGGGGCGGCGG + Exonic
901054153 1:6440810-6440832 TCAGCGCGGGCCCGGGGTGGGGG + Intronic
901055271 1:6446293-6446315 TGAGCCTGGGGCTGTGGGGGTGG - Intronic
901266352 1:7913858-7913880 TGAGCCGGGCGTCGTGGCGGAGG - Intergenic
901332811 1:8423873-8423895 CGGGGCCGGGGCCGGGGCGCGGG - Intronic
901433921 1:9234811-9234833 TGAGGCCTGGGGCGGGGTGGCGG + Exonic
901434001 1:9235090-9235112 AGGCGCCGGGGCCGGGGCGGCGG - Intronic
901523767 1:9806208-9806230 TGAACCCAGGGCAGGGGGGGTGG + Intronic
901627000 1:10630194-10630216 TGGGCCTGGGGCTGGGGCTGGGG - Exonic
901659860 1:10792331-10792353 TGTGTGCGGGGCCGGGGGGGGGG - Intronic
902209206 1:14892667-14892689 TGAGCCATGGGCAGGGGTGGTGG - Intronic
902332453 1:15737085-15737107 TGAGCCAGGGGAGGGGGCAGAGG + Intronic
902333746 1:15743229-15743251 TGAGCCCGGGCCCTGGGCTGGGG - Intronic
902350113 1:15847974-15847996 GGAGGCGGGTGCCGGGGCGGCGG - Exonic
902395863 1:16132315-16132337 TGAGCCCGGGGCTGGCCTGGCGG - Intronic
902451498 1:16499347-16499369 CGAGGCCGGGGCCGAGGCGGGGG + Intergenic
902479099 1:16702320-16702342 TGAGCCTGGGGCTGTGGGGGTGG + Intergenic
902480157 1:16707521-16707543 TCAGCGCGGGCCCGGGGTGGGGG - Intergenic
902585737 1:17437962-17437984 CGCGCCCGGGCCCGCGGCGGGGG - Intronic
902771306 1:18646961-18646983 GGAGCCCGGGGGTGGGGTGGGGG + Intronic
902893330 1:19461079-19461101 TCACCCCTGGGCGGGGGCGGGGG + Intronic
903269445 1:22178386-22178408 TGTGCTCGGGGCCCGGGGGGTGG - Intergenic
903323547 1:22556462-22556484 TGGGCCAGGGGGCGGGGCAGGGG + Intergenic
903353132 1:22730215-22730237 AGAGCCAGGGGCGGAGGCGGGGG + Intronic
903396357 1:23004469-23004491 TGAGACCAGGGCAGGTGCGGTGG + Intergenic
903589952 1:24447182-24447204 TGGGGCCGGGGCCGGGGCATTGG + Intronic
903739727 1:25551809-25551831 TGGGCCTGGGGCCAGGGCTGGGG + Intronic
903750021 1:25616170-25616192 TGTGACCGCGGCCGGGTCGGCGG - Intergenic
903750585 1:25618054-25618076 CTCGCCCGGGGCCGGCGCGGCGG - Exonic
904091003 1:27945141-27945163 GGAGCCCTGGGCTGGGGCAGGGG - Intronic
904300185 1:29549169-29549191 TGAGCCCAGGGCCAGGCAGGTGG + Intergenic
904620451 1:31772027-31772049 TGAGCCCGTGGCGGCGGCGGCGG + Intergenic
904688310 1:32275786-32275808 TGAGCCCGAGGTGGGGGCGCGGG + Intronic
904696841 1:32335868-32335890 AGGGCCCGGGGCCGGGGCCGGGG - Intronic
904782849 1:32964027-32964049 TGAGCGCGGGGGCGTGGCGCGGG - Intronic
905202013 1:36322112-36322134 AGACCCCGGGGGCGGGGAGGGGG - Exonic
905202152 1:36322602-36322624 TGAGCCGGGCCCCGGGGCCGCGG + Exonic
905463075 1:38134010-38134032 GGAGGCGGCGGCCGGGGCGGCGG + Intergenic
905463089 1:38134042-38134064 AGGGCCCAGGGCCGGGGTGGGGG + Intergenic
905847112 1:41242217-41242239 TGAGGCGGGGGGCGGGGCGGGGG + Intergenic
905960057 1:42035808-42035830 TGCGCGCCGGGCCGGGGCGGCGG + Intronic
906047913 1:42846818-42846840 TGGGCCGGGGGCCAGGGCGAGGG - Intronic
906062538 1:42958187-42958209 CGGGGCCGGGGCCGGGCCGGGGG + Intronic
906211688 1:44015824-44015846 AGAGTCTGGGGCCGGGGTGGAGG + Intronic
906293098 1:44632407-44632429 GGAGGCCGGGGGTGGGGCGGAGG - Intronic
906525384 1:46490485-46490507 GGAGCCCTGGGCGGGGGCTGGGG + Intergenic
906805547 1:48776526-48776548 GGGGCCGGGGGCCCGGGCGGAGG - Intronic
907373496 1:54017845-54017867 TGAGCCCCGGGGCAGGACGGGGG + Intronic
908195512 1:61742783-61742805 TGACCCGGGAGGCGGGGCGGGGG + Intronic
908260746 1:62337851-62337873 AGAGCCTGGGGCAGGGGCAGAGG + Intergenic
908738930 1:67307748-67307770 TGAGGATCGGGCCGGGGCGGGGG - Exonic
910686953 1:89927207-89927229 TGTGCCTTGGGACGGGGCGGAGG + Intronic
911176158 1:94820353-94820375 CGGGGCCGGGGCCGGGGCTGGGG - Exonic
912423334 1:109563299-109563321 TGAGCCCTGGGGCGGGGCAGAGG + Intronic
912568890 1:110607470-110607492 GGGGGCCGGGGCCGGGGCCGGGG + Intronic
912800191 1:112715337-112715359 TGGGGGCGGGGCCTGGGCGGGGG - Exonic
912910977 1:113759088-113759110 TGAGGCCGGGGGCGAGGCGGCGG + Exonic
913222109 1:116667794-116667816 CGAGCGCGGGGCCAGGGCGGCGG + Intergenic
914197344 1:145454440-145454462 GGAGAGCGGGCCCGGGGCGGCGG - Intergenic
914386209 1:147172378-147172400 TGAGCGCGGGGACGCGGGGGAGG - Intronic
914758464 1:150579772-150579794 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
914758468 1:150579778-150579800 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
914831849 1:151176008-151176030 GGAGCCCGGTGCCGGGGGAGAGG + Exonic
914833653 1:151189846-151189868 GGAGCCGGGGGGCGAGGCGGGGG - Intronic
914983949 1:152440747-152440769 TGAGGCCTGGGCGGTGGCGGAGG - Intergenic
915202846 1:154245626-154245648 TGAGGCCGGGTGCGGTGCGGTGG + Intronic
915204607 1:154260922-154260944 TGTGGCCGGGGCTGGGGAGGAGG - Exonic
915552260 1:156642053-156642075 GGAGGGCGGGGCAGGGGCGGGGG + Exonic
916106995 1:161440261-161440283 GGAGCCCCGGGCCGGCGCGGCGG - Intergenic
916108556 1:161447675-161447697 GGAGCCCCGGGCCGGCGCGGCGG - Intergenic
916110144 1:161455056-161455078 GGAGCCCCGGGCCGGCGCGGCGG - Intergenic
916111729 1:161462466-161462488 GGAGCCCCGGGCCGGCGCGGCGG - Intergenic
916113316 1:161469847-161469869 GGAGCCCCGGGCCGGCGCGGCGG - Intergenic
916549863 1:165839923-165839945 TGGGGCGGGGGCCGGGGTGGGGG - Intronic
916651766 1:166839893-166839915 CGCGCCCGGGGGCGCGGCGGCGG + Intronic
917869549 1:179229448-179229470 GGAGCCCGAGGCCGGAGCCGAGG - Exonic
917905851 1:179586650-179586672 TGAGGCGGGGGCGGGGGCGGCGG + Intergenic
919463245 1:197902941-197902963 CGAGCCCGGGGCGGCCGCGGCGG - Intronic
919926419 1:202194064-202194086 TGGGCCCCGGGCCGGGCTGGGGG - Exonic
920805704 1:209231807-209231829 TGACCGCGGGGCCGGGGTCGCGG + Intergenic
921155064 1:212432948-212432970 TGGGCCCCGCGCCGCGGCGGCGG + Exonic
921217543 1:212950645-212950667 TGGGCCTGGGGCTGGGGCTGGGG - Exonic
921432791 1:215082995-215083017 TGAGCGCGTGGCGGCGGCGGCGG + Intronic
921945031 1:220880269-220880291 CCAGCCCGGGGCGGAGGCGGAGG - Exonic
922581780 1:226703552-226703574 GAAGCCCGCGGCCGGGGAGGGGG + Intronic
922718252 1:227887770-227887792 CGAGCCCTGGGCAGGGGCGGCGG + Intergenic
922753496 1:228082051-228082073 TGAGGCGGGGGCCGTGGGGGTGG - Intergenic
922775806 1:228213786-228213808 GGAGCCGGGGGCGGGGGAGGGGG + Intronic
923230664 1:231983521-231983543 TGGGCCCGGGGGTGGGGTGGGGG + Intronic
924274365 1:242370493-242370515 TGAGCCAGGGGCCAGGGGAGGGG + Intronic
924383416 1:243483193-243483215 GGAGCCCGGGGAGGAGGCGGCGG + Intronic
924494613 1:244575224-244575246 ACAGCCCGGGGCCTGGGCTGTGG - Intronic
1062874008 10:931279-931301 CGGGGCCGGGGCCGGGGCAGGGG - Intronic
1062885797 10:1015350-1015372 TGAGCCTGGGTGCGGGGCTGGGG + Intronic
1062885845 10:1015515-1015537 TGAGCCTGGGAGCGGGGCTGGGG + Intronic
1062885855 10:1015548-1015570 TGAGCCTGGGAGCGGGGCTGGGG + Intronic
1062885865 10:1015581-1015603 TGAGCCTGGGAGCGGGGCTGGGG + Intronic
1062899577 10:1132731-1132753 TGAGGCTGAGGCTGGGGCGGAGG + Intergenic
1063661556 10:8037701-8037723 TCCGGCCGGGGCCGGGGCCGCGG + Intergenic
1063663483 10:8048931-8048953 GGAGGCCGGGGCCGGGCTGGGGG + Intergenic
1063663648 10:8049713-8049735 TAATCCAGGGGCCGAGGCGGAGG + Intergenic
1064146312 10:12828902-12828924 GGGGCCCGGGGTCGGGGCTGGGG + Exonic
1064274201 10:13891776-13891798 AGGGCCCGCGGCGGGGGCGGCGG - Intronic
1064443191 10:15371326-15371348 CGGGCCCGGGGCCTGGGCGCGGG - Intergenic
1064553026 10:16521326-16521348 CGAGCCCGGGGTGGGGGCCGGGG + Exonic
1065288689 10:24209089-24209111 GGGGCCCGGGGCTGGGGAGGAGG - Intronic
1065687665 10:28302654-28302676 TGGGGGCGGGGCCGGGGCAGGGG - Intronic
1067069210 10:43119947-43119969 TGAGACCTGGGCCGGGGGTGTGG - Intronic
1067084386 10:43230120-43230142 TGAGGCCGGGGCCGGGTAAGAGG - Intronic
1067445104 10:46337044-46337066 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1067449864 10:46375670-46375692 AGAGCCCGGGGGCGAGGGGGCGG + Exonic
1067502319 10:46816336-46816358 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1067592268 10:47523684-47523706 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1067634441 10:47991860-47991882 AGAGCCCGGGGGCGAGGGGGCGG - Intergenic
1068455572 10:57250117-57250139 AGAGCCCGTGGCCGGGGGAGGGG - Intergenic
1069738398 10:70672464-70672486 GGAGCCGGGCGACGGGGCGGCGG - Intergenic
1069761809 10:70816242-70816264 TGCGGCCGGGGCGGGGGCGGGGG + Intronic
1069821127 10:71229450-71229472 GGATCCAGGGGCAGGGGCGGAGG - Intronic
1069958622 10:72066868-72066890 TGAGGCAGGGGCCTGGGAGGGGG + Intronic
1070112030 10:73495819-73495841 TCAGCCCCGGGAGGGGGCGGCGG + Exonic
1070305345 10:75235875-75235897 TGAGCCCAGGGCCAGCGCGGCGG + Exonic
1071598108 10:86942617-86942639 CGAGGCCGAGGCCGGGGCCGGGG - Exonic
1071997521 10:91162882-91162904 AGAGCCCGCGGCGGCGGCGGCGG - Intergenic
1072578423 10:96720429-96720451 CGTGCCCGGGGCCGGGACCGGGG + Exonic
1072591489 10:96832257-96832279 CGTGCGCGGGGCCGCGGCGGAGG + Intronic
1073045393 10:100634622-100634644 TGGGCACGGGGCGGGGGCGAGGG + Intergenic
1073146677 10:101285917-101285939 GGAGCCTGGGGCCTGGGGGGAGG - Intergenic
1073372576 10:103004080-103004102 TGAACCCGGGGCGGGGGTGGGGG - Intronic
1073432229 10:103494100-103494122 AGGGCCCTGGGCCGGGGCCGGGG - Exonic
1074095108 10:110304754-110304776 TGGGGCTGGGGGCGGGGCGGCGG + Exonic
1074121643 10:110497972-110497994 GGAGCCCGGCGCCCGAGCGGCGG - Exonic
1074814502 10:117134305-117134327 TGGGCCCGGGGCGGCGGCGGCGG + Exonic
1074816009 10:117140894-117140916 GGAGCTGGGGGGCGGGGCGGGGG + Intergenic
1074978041 10:118596466-118596488 TGAGCCGGGGGCCTGGGGGTCGG + Intergenic
1075144473 10:119872190-119872212 TGCGCCCGGGGCCGGGGCCCTGG + Intronic
1075520579 10:123141287-123141309 TGAGCCAGGGTGCGGGGCTGTGG + Intergenic
1075572785 10:123557637-123557659 TGAGCCCCAGGCCAGGGCAGGGG + Intergenic
1075902866 10:126057209-126057231 TGAGCCCGGGGTCGGGGGAGGGG + Intronic
1076358298 10:129868732-129868754 GGAGGCCAGGGCCGGGGCTGAGG + Intronic
1076674838 10:132142479-132142501 AGGGGCCGGGGCCGGGGCCGGGG - Intronic
1076721976 10:132396859-132396881 CGAGCCCGGGGGCGGCGGGGGGG - Intergenic
1076732307 10:132444914-132444936 TGGGGCCGGGGCCAGGGCCGGGG - Intronic
1076792813 10:132785954-132785976 GGAGCCCGGGCCGGCGGCGGCGG - Exonic
1076857586 10:133124830-133124852 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1076857590 10:133124836-133124858 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1077043718 11:535432-535454 TGCCCCCGGGGCCAGGGCCGGGG + Exonic
1077081452 11:726244-726266 TGGGCCGGGGGCGGGGGCAGGGG + Intronic
1077090701 11:777157-777179 GGAGCTCGGGGCGGGGTCGGGGG - Intronic
1077090724 11:777208-777230 GGAGCTCGGGGCGGGGACGGGGG - Intronic
1077107795 11:849560-849582 GGAGGCCGGGGCCGGGGCCTGGG - Intronic
1077121500 11:910938-910960 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1077121504 11:910944-910966 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1077204941 11:1337498-1337520 GGGGCCCGAGGCGGGGGCGGGGG + Intergenic
1077327109 11:1968664-1968686 GGAGCCGGGGGCCAGGGCGTGGG + Intronic
1077360378 11:2138086-2138108 TGAGCCCGGGGGGGAGGAGGAGG - Intronic
1077385974 11:2269683-2269705 AGGGCCGGGGGCCGGGGTGGAGG - Intronic
1077401418 11:2359857-2359879 TGAGCCCGGTGCCTGGGGGCGGG + Intergenic
1077407166 11:2387802-2387824 TCAGTCTGGGGCCTGGGCGGGGG + Intronic
1077495475 11:2884836-2884858 CGCGTCCGGGGCCGGGGCCGGGG + Exonic
1077495480 11:2884842-2884864 CGGGGCCGGGGCCGGGGCGGGGG + Exonic
1077495491 11:2884860-2884882 GGGGGCCGGGGCCGGGGCCGGGG + Exonic
1077495495 11:2884866-2884888 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
1077495499 11:2884872-2884894 CGGGGCCGGGGCCGGGGCTGGGG + Exonic
1077503386 11:2919290-2919312 AGAGCCCTGAGCCGGGGCAGGGG - Exonic
1077514197 11:2992031-2992053 GGAGCCCGGGCCTGGGGCGCTGG - Intronic
1077539348 11:3139291-3139313 TGGCCCCGGGGCTGGGGCCGTGG + Intronic
1077907226 11:6544066-6544088 TGAGGCAAGGGCCGGGGCTGGGG - Intronic
1077916056 11:6612121-6612143 GGGGCCCGGGGCCGAGGCGGCGG + Exonic
1078090769 11:8263184-8263206 GGGGGCCGGGGCTGGGGCGGGGG - Intronic
1078190858 11:9091646-9091668 TGAGGCCGGGGCTCGGGGGGCGG - Intronic
1078527286 11:12110665-12110687 TGCGCCCGCGGCCAGGGCCGAGG + Exonic
1080686955 11:34523957-34523979 TGGGGTCGGGGCCGGGGGGGTGG - Intergenic
1080749438 11:35138993-35139015 AGAGCACGGGGCGGGGGCAGAGG + Intronic
1081462316 11:43283261-43283283 AGAGGCCGGGGGCGGTGCGGGGG + Intergenic
1081636775 11:44727049-44727071 TGGGGCCGGGGCCGGGGCTGGGG - Intronic
1081636786 11:44727067-44727089 CGGGGCCGGGGCCGGGGCTGGGG - Intronic
1081636790 11:44727073-44727095 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081636794 11:44727079-44727101 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081636798 11:44727085-44727107 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081636802 11:44727091-44727113 CGGGACCGGGGCCGGGGCCGGGG - Intronic
1081851442 11:46277793-46277815 GGAGCCCGGGGTTGGGGCTGAGG - Exonic
1081990572 11:47335205-47335227 TGAGCCTGGGGGTGGGGAGGGGG + Exonic
1082006133 11:47420142-47420164 TGTGCCTGGGGCCTGGGAGGTGG + Intronic
1082022474 11:47546259-47546281 GGGGCCGGGGGCGGGGGCGGGGG + Intronic
1082045259 11:47720828-47720850 TTAGCCGGGGGCGGTGGCGGCGG + Intronic
1082851522 11:57769233-57769255 TGAACCCGGGACCCGGGAGGTGG + Intronic
1083028266 11:59569116-59569138 TTAGCCAGGGCCAGGGGCGGTGG - Intergenic
1083609776 11:63999307-63999329 TGAGTCCTGGGCCCGGGCGAGGG - Intronic
1083766457 11:64843748-64843770 TGGCGCCGGGGCCGGGGAGGGGG - Intronic
1083843120 11:65315663-65315685 GGAGCCCGGGGGAGGGGCGCTGG + Intronic
1083879296 11:65540221-65540243 TGAGGCCCGGGCCGGGGAGTGGG - Intronic
1083996559 11:66275952-66275974 TCTGCCCGGGGTCGGGGCGCTGG + Intronic
1084192483 11:67505262-67505284 GGAACCCGAGGCCGGGGCTGGGG - Exonic
1084204531 11:67584041-67584063 GGACCCCGGGGGCGGGGAGGGGG + Intronic
1084284072 11:68120701-68120723 GGGAGCCGGGGCCGGGGCGGAGG - Intronic
1084336673 11:68461483-68461505 TGAGCCGGGGGTGGGGGGGGTGG + Intronic
1084611157 11:70203747-70203769 TGGGCGCGGGGCCGGGCCGGGGG + Intronic
1084695903 11:70755545-70755567 GCAGGCCGGGGCCGGGGCTGGGG - Intronic
1084888440 11:72224894-72224916 TGAGGCTGGGGCCGGGCCCGGGG - Exonic
1084930738 11:72553710-72553732 TGAGCCCAGGGCTGGGGCTGGGG + Intergenic
1085094375 11:73747441-73747463 GGAGGCCGGGGGCGGGGCGGGGG - Intronic
1085321559 11:75577332-75577354 TGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1085392107 11:76187563-76187585 TGAGCCGGGGGCCTGGGTGGTGG - Intronic
1085411219 11:76291821-76291843 TAGGCCCTGGGCCGGGGCTGGGG - Intergenic
1085460212 11:76688999-76689021 TGAGCCTGAGGCCTGGGAGGGGG + Intergenic
1087241829 11:95789549-95789571 GGAGCCCGCGGCCCGGGCGGCGG - Exonic
1087516423 11:99168323-99168345 GGAGGCCGAGGCCGGGGGGGTGG + Intronic
1088172847 11:107017867-107017889 CGGGGTCGGGGCCGGGGCGGCGG + Exonic
1088332172 11:108665341-108665363 TGAGGCCGGCGCTGGGGAGGGGG + Intronic
1088400930 11:109422378-109422400 GGGGCCGGGGGCAGGGGCGGGGG - Intronic
1088406042 11:109480269-109480291 TGAGCGGGGGGCGGGGGCGGGGG - Intergenic
1088478282 11:110266980-110267002 TGAGCCTGGGGTGGGGGTGGAGG - Intronic
1088796999 11:113273160-113273182 TGAAGCTGGGGCCGGGGAGGGGG - Intronic
1088823505 11:113475339-113475361 GGAGCGCGGGGACGGGGCGGAGG + Exonic
1089219061 11:116855607-116855629 TCAGCCTGGGGCAGGGGTGGAGG + Intronic
1089500003 11:118926097-118926119 TTGGCCCGGGGGCGGGGAGGGGG + Intronic
1089682051 11:120124083-120124105 TGTGCCTGGGGCCGTGGGGGCGG - Intronic
1089694905 11:120211035-120211057 GGAGCCCGGGGCCGCGGAGCCGG + Exonic
1090375160 11:126283155-126283177 TGAGCCCGGGGCGGGGTCGCGGG + Intronic
1090780298 11:130001960-130001982 AGCGTCCGGGACCGGGGCGGGGG - Intronic
1091219144 11:133920186-133920208 CTAGGCCGGGGCCGGGGCTGGGG + Exonic
1202810091 11_KI270721v1_random:23844-23866 GGAGCCGGGGGCCAGGGCGTGGG + Intergenic
1091434014 12:459898-459920 TGTGCCCGGGGCGGGGGCGGGGG + Intergenic
1091434147 12:460298-460320 TGGGCGCGGGGCCCGGCCGGGGG + Intergenic
1091558585 12:1594170-1594192 TGGGCCCGAGGCGGCGGCGGCGG - Intronic
1091569842 12:1675184-1675206 TGAACCCGGGGCGGGGGCGGAGG + Intergenic
1091759371 12:3077177-3077199 GGAGCCCGGGGACGGGGCACGGG - Intergenic
1091773948 12:3172216-3172238 TGAGGCTGGGGTGGGGGCGGGGG - Intronic
1092161014 12:6315659-6315681 TGGGGCCGGGGCTGGGGCTGAGG - Intronic
1092229026 12:6766684-6766706 TGGTGCCGGGGCCGGGGCCGGGG - Exonic
1092526966 12:9315322-9315344 TGAGCCTGGTGCCAGGGCAGTGG + Intergenic
1092884972 12:12916963-12916985 TCAGACTGGGGCCGGGACGGTGG - Exonic
1093793753 12:23286204-23286226 GGAGCCCACGGCGGGGGCGGGGG - Intergenic
1094490688 12:30958765-30958787 TGATCCTGGGGCAGGGGCAGGGG + Intronic
1094494235 12:30979498-30979520 TGGGCCCGGTGCCAGGGCAGGGG + Intronic
1095440800 12:42237801-42237823 TGGGGCGGGGGGCGGGGCGGGGG - Intronic
1095476506 12:42591400-42591422 TCAACACGGGGGCGGGGCGGAGG - Intergenic
1096241333 12:49961806-49961828 CGGGCGCGGGGCCGGCGCGGGGG - Intergenic
1096389479 12:51217720-51217742 GGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096403192 12:51324122-51324144 AGGGCGCGGGGCCAGGGCGGCGG - Exonic
1096446520 12:51697930-51697952 TGAACCCGGTGCGGGGGTGGAGG - Intronic
1096550703 12:52369957-52369979 TGAGCCCAGGGCTGGGGCTGGGG + Intergenic
1096651359 12:53063487-53063509 GGGGGCCGGGGCCGGGGCTGGGG - Intronic
1096716208 12:53493045-53493067 TGGGGCGGGGGCCGCGGCGGCGG + Intronic
1096777630 12:53973820-53973842 TGAGGCGGGTGCCGAGGCGGAGG + Exonic
1096796741 12:54082569-54082591 GGGGCCGGGGGCCGGGGCCGGGG + Intergenic
1096796745 12:54082575-54082597 GGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096796749 12:54082581-54082603 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096796753 12:54082587-54082609 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096799640 12:54101604-54101626 TGTGCCTGGGGCAGGGGTGGTGG + Intergenic
1097166460 12:57088963-57088985 AGAGCCGGGGGCGGGGGTGGGGG - Exonic
1097191519 12:57221648-57221670 TCGGCGCGGGGGCGGGGCGGAGG - Intronic
1097196176 12:57243521-57243543 GGAGCCAGGGACTGGGGCGGGGG - Exonic
1097990377 12:65826021-65826043 GGAGCCCGGGGCAGGGGCTACGG + Intronic
1098105889 12:67069026-67069048 TGAGCCAGGCGGCGGGGCCGGGG - Intergenic
1098750956 12:74292881-74292903 AGAGCCTGGGGCCTGGGCAGGGG - Intergenic
1099954793 12:89343300-89343322 TCTGCCAGGGGCCGGGGCTGGGG - Intergenic
1099961989 12:89405666-89405688 TGAGTGCAGGGCCGGGGCGGTGG + Intergenic
1100260557 12:92928973-92928995 GGAGCTCGGGGCCGCGGCGCGGG - Intronic
1100594626 12:96061224-96061246 TGAGGCCGGGGCCGTCGCTGGGG + Intergenic
1100611395 12:96194345-96194367 CGCGCACGGGGCCGGGGCGGCGG + Intergenic
1101910561 12:108857645-108857667 GGAGCTGGGGGCGGGGGCGGTGG - Intergenic
1102024575 12:109706966-109706988 TGAGCCCAGGTCTGGGGCTGCGG + Intergenic
1102636219 12:114326611-114326633 TGTGGCGGGGGCGGGGGCGGGGG - Intergenic
1103092032 12:118104184-118104206 GCAGCCCGGGGCAGCGGCGGGGG - Intronic
1103309007 12:119989656-119989678 TGAGCCCGGGGGCGGGGGAGGGG + Intergenic
1103415948 12:120741556-120741578 TGAGCCCGGGGACAGTGGGGAGG + Intergenic
1103476444 12:121222273-121222295 TGAGCCAGGTGCCGAGGCTGGGG + Intronic
1103567430 12:121823489-121823511 AGAGCCGGGGGCCGTGGCGCCGG + Exonic
1103828706 12:123762135-123762157 AGATCCCGGGGCCGGGGCGTGGG + Intergenic
1104017566 12:124971073-124971095 TGAGGCTGGCACCGGGGCGGTGG + Intronic
1104448888 12:128853681-128853703 TGGGCCGGGGGCCGGGGGGCGGG + Intronic
1104692777 12:130839149-130839171 AGAGCCCGAGGCCCGGCCGGAGG - Exonic
1104857673 12:131909597-131909619 TGAGCATGGGGGCGGGGAGGGGG - Intronic
1104874113 12:132021225-132021247 GGGGCCTGGGGCTGGGGCGGGGG - Exonic
1104901131 12:132190093-132190115 TGACCCCGGGAGCTGGGCGGAGG - Intergenic
1104939857 12:132390004-132390026 TGAGCCCAGGTGGGGGGCGGGGG - Intergenic
1104990147 12:132620102-132620124 TGGGCCCCAGGCCGGGGCGCAGG - Intronic
1105004219 12:132711002-132711024 TGAGCCGCCGGCCTGGGCGGGGG + Exonic
1105015885 12:132786659-132786681 TGTGCCCGGGGGAGGTGCGGGGG - Intronic
1105018084 12:132798316-132798338 TGAGGCTGCGGCCGGGGCCGTGG - Intronic
1105031412 12:132887164-132887186 TGAGGCCGGGGCCGGGGGCCGGG - Intronic
1105512404 13:21061461-21061483 GGAGCCCCGGGCGGCGGCGGTGG + Exonic
1105682685 13:22745278-22745300 TGTGGCCGGGGCAGGGGTGGTGG + Intergenic
1105813413 13:24013085-24013107 TGAGCCCAGAGCCAGGGTGGGGG + Intronic
1105859422 13:24395610-24395632 TGAGCCTGGGCCTGGGGCAGGGG - Intergenic
1106340098 13:28819762-28819784 TGAGGCGGGAGCTGGGGCGGGGG + Intergenic
1106720076 13:32427762-32427784 TGGGGCTGGGGCCGGGGCCGCGG + Intronic
1106720426 13:32429596-32429618 TGTGCCCGGGCCCGGTGCAGTGG + Intergenic
1107097027 13:36548161-36548183 GGAACCTGGGGCCGGGGCAGGGG - Intergenic
1107250034 13:38349475-38349497 CGAGGCCGGGGGCGGGGCTGGGG - Intergenic
1107549119 13:41458279-41458301 CGAGTCCAGGGCCGGGGCTGCGG - Exonic
1107715142 13:43192420-43192442 TGACCCAGGTTCCGGGGCGGTGG - Intergenic
1108350350 13:49585659-49585681 TTCGGCCGGGGCCGGGGCCGGGG - Intergenic
1108465553 13:50711761-50711783 TGACCCAGTGGCGGGGGCGGGGG + Intronic
1109649793 13:65310532-65310554 TGAACTCGGGGACGGGGGGGCGG - Intergenic
1109789652 13:67230385-67230407 AGAGCCCGGGGGCGGGGCCTGGG - Intronic
1110198007 13:72812860-72812882 TGAGCCCGGGGTAGGGGTAGGGG + Intronic
1110860540 13:80341149-80341171 CGAGGCCGAGGCGGGGGCGGTGG + Intergenic
1111192654 13:84830739-84830761 TGAACACGGGGTCGGGGAGGGGG + Intergenic
1112196819 13:97234485-97234507 TGAGCACAGTGCGGGGGCGGGGG + Intronic
1112494782 13:99896086-99896108 TGCGCGCGGAGCCGGGGCCGAGG + Exonic
1113120244 13:106917584-106917606 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120248 13:106917590-106917612 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120252 13:106917596-106917618 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120256 13:106917602-106917624 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120260 13:106917608-106917630 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120264 13:106917614-106917636 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113204345 13:107898029-107898051 TGAGCCTGGGGCTTGGGCTGGGG + Intergenic
1113346704 13:109485322-109485344 AGAGAACGGGGCAGGGGCGGCGG - Intergenic
1113378104 13:109782880-109782902 GGCGCCCGGGCCCTGGGCGGTGG + Exonic
1113769229 13:112897977-112897999 CGGGGCCGGGGCCGGGGCTGGGG - Intronic
1113820712 13:113210090-113210112 TGAGGCGGCGGCCGGGGCTGGGG + Intronic
1113874398 13:113585151-113585173 TGGGGCCGGGGCCGGGGCCGGGG + Intronic
1113874402 13:113585157-113585179 CGGGGCCGGGGCCGGGGCTGGGG + Intronic
1114519021 14:23321519-23321541 GGGGCTCCGGGCCGGGGCGGCGG + Exonic
1114519032 14:23321550-23321572 TGTGCCCGGGGCCGGTGGGGAGG + Exonic
1114558915 14:23577559-23577581 TTAGACCGGGGCCGGGCGGGGGG + Exonic
1114597391 14:23925313-23925335 TGACAGCGGGGCGGGGGCGGGGG - Intergenic
1115399247 14:32939152-32939174 GGTGGCCGGGGCCGGGGCCGTGG - Intronic
1115528735 14:34306275-34306297 TGAACCTGGGGTGGGGGCGGGGG + Intronic
1115528764 14:34306530-34306552 TGAGCCTGGGGTGGGGGTGGCGG - Intronic
1115664755 14:35534497-35534519 TGAGCCCGGGGACGGGCGGGCGG + Exonic
1115689221 14:35826372-35826394 TGAGGCCCGGGCCGGGGGCGGGG + Exonic
1116817915 14:49599929-49599951 TGAGCCCGGGGCCGGGGCGGGGG + Intronic
1116849369 14:49893129-49893151 GGAGCCCGCGCTCGGGGCGGCGG + Exonic
1116887109 14:50231931-50231953 TGAGCGCCGGGCCGAGGGGGCGG - Intergenic
1117989061 14:61416134-61416156 TGAGCCCGGGGGCGGGGCAGAGG - Intronic
1118024083 14:61751209-61751231 GGAGCCCACGGCCGGGGCCGCGG - Intergenic
1118030462 14:61813018-61813040 TGCGCCTGGCGCCGAGGCGGAGG + Intergenic
1118220808 14:63853240-63853262 TGAGCCGGGGGCGGGGGCGGCGG + Intronic
1118797022 14:69153007-69153029 TGAGGCCGAGGGAGGGGCGGCGG - Exonic
1118808959 14:69260227-69260249 TGCTCTCGGGGCCGGGGCGGGGG - Exonic
1118894894 14:69937583-69937605 TGAGCCTGGGGCCTGGGCAGCGG + Intronic
1119003977 14:70907792-70907814 TGGGGCCGGGGCGGGGACGGCGG + Exonic
1119286387 14:73458350-73458372 CGGGGCCGGGGCCAGGGCGGAGG - Intronic
1119300828 14:73569973-73569995 ATAGCCCGGGGGCGCGGCGGGGG - Intronic
1119436812 14:74602888-74602910 TGGGCCAGGGGCCAGGGCAGAGG + Intronic
1119655326 14:76413321-76413343 TGTGGCCGGGGCCGGGGCACAGG - Intronic
1119764844 14:77181856-77181878 CGAGCCTGGGGCTGGGGCCGCGG + Exonic
1119793635 14:77376759-77376781 CGAGCCCAGGGCCCGGGTGGTGG + Intronic
1120590466 14:86368141-86368163 AGACCCTGGGGTCGGGGCGGGGG + Intergenic
1120920799 14:89753879-89753901 TGAGCACGGGGTGGGGGCGGGGG - Intergenic
1121050458 14:90816372-90816394 GGAGCCCGAGCCCGCGGCGGCGG - Exonic
1121332873 14:93059430-93059452 TGATCCCGAGGCAGGGACGGAGG + Intronic
1121645753 14:95516429-95516451 CGCGCCCGGCGCGGGGGCGGGGG - Intronic
1121648215 14:95535411-95535433 TGCTCCTGGGCCCGGGGCGGAGG - Intronic
1122230866 14:100305876-100305898 TGAGCCCGGGACCTCGGCGCGGG + Intronic
1122555172 14:102575050-102575072 ACAGCACGGGGGCGGGGCGGGGG - Intergenic
1122558354 14:102593199-102593221 GGGGCCCGGGGCCGCGGGGGCGG - Intronic
1122649900 14:103220580-103220602 TGGGCCCGGGGGCGGGGCTGGGG + Intergenic
1122690665 14:103530784-103530806 TGAGTCCAGGGCCTGGGCTGTGG + Intronic
1122778748 14:104134859-104134881 TGAGCCTGGGGCGGGGAGGGGGG - Intergenic
1122779165 14:104136399-104136421 TGAACGCGCGGGCGGGGCGGCGG + Intergenic
1122946490 14:105012934-105012956 TGTGTCCGGGGCAGGGGGGGTGG + Intronic
1122956860 14:105075188-105075210 GGAGCTCGGGGCAGGGGCTGTGG - Intergenic
1122956880 14:105075232-105075254 GGAGCTCGGGGCAGGGGCTGTGG - Intergenic
1122956900 14:105075276-105075298 GGAGCTCGGGGCAGGGGCTGTGG - Intergenic
1122956918 14:105075318-105075340 GGAGCTCGGGGCAGGGGCTGTGG - Intergenic
1123110275 14:105863938-105863960 TGAGCCCGGGGAGGGCCCGGGGG + Intergenic
1123112153 14:105877777-105877799 AGGGCCAGGGGCCGGGGTGGGGG + Intergenic
1123709935 15:22980085-22980107 GGAGCCCGGGGCCGGGACCTGGG + Intronic
1124009887 15:25829979-25830001 TGTGCTAGGGGCCGGGGTGGAGG + Intronic
1124120326 15:26883284-26883306 AGGGCACGGGGCCTGGGCGGGGG - Intronic
1124249812 15:28099363-28099385 TGTGGGCGGGGCCGGGCCGGGGG - Intergenic
1124628675 15:31325611-31325633 TGAGCCCGGTTCCGCGGCGGTGG + Intergenic
1124696762 15:31870344-31870366 CGACCGCGGGGCCGGGGCGCGGG - Intronic
1125180995 15:36880721-36880743 TCCGCCCGGGGCTGGGGCGCGGG - Intergenic
1125508782 15:40282020-40282042 GGAGCCCCGGGCCGCAGCGGCGG + Exonic
1125535952 15:40441270-40441292 TGAGTCAGGGGCCGGGGTCGAGG + Intronic
1125903641 15:43370976-43370998 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1125903645 15:43370982-43371004 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1127221738 15:56887401-56887423 CGAGCCCGAGGCAGGGGTGGCGG + Intronic
1127382191 15:58439727-58439749 TAAGCCCTGGCCGGGGGCGGTGG - Intronic
1127674833 15:61228994-61229016 GGAGCCCGGGCGCGGAGCGGGGG - Intronic
1127753423 15:62067989-62068011 TGGGCCCGGGGCCGGGGCGCGGG - Exonic
1127763637 15:62164602-62164624 TGGGCCCGGGGCCGGGGCGCGGG + Exonic
1127913034 15:63434145-63434167 TGAACCCAGGGACGGGGCGGAGG + Intergenic
1128124981 15:65185435-65185457 TAGGCCCGGGGAGGGGGCGGAGG + Intergenic
1128220447 15:65964867-65964889 CGAGCCCGGGACAAGGGCGGGGG - Intronic
1128456025 15:67831911-67831933 GGAGGTCGGGGCCGGGGCGGGGG + Intronic
1128484182 15:68068738-68068760 TTAACCCAGGGCAGGGGCGGTGG - Intronic
1128514831 15:68335663-68335685 GGAGCCTGGGGCCGGGATGGAGG - Intronic
1128582175 15:68818190-68818212 TGCGCCCCGCGCCGGGGAGGAGG + Intronic
1128739834 15:70075995-70076017 TGAGGCTGGGGCTGGGGCTGGGG + Intronic
1129273866 15:74433201-74433223 CGAGCTCCGGGCCGGGGCGGGGG + Intronic
1129287975 15:74541162-74541184 CCAGCCAGGGGCGGGGGCGGGGG - Exonic
1129299779 15:74618905-74618927 TGAGCCAGGGCCAGGGGCTGAGG - Intronic
1129329851 15:74821403-74821425 TGCGCACGGGGCTGGGGCTGAGG + Intronic
1129468493 15:75737678-75737700 TGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1129573439 15:76715286-76715308 GGATCCCTGGGCCGGGGTGGGGG - Intronic
1130059479 15:80559333-80559355 TGTGGCCGGGGCTGGGGCTGGGG - Intronic
1130074380 15:80676076-80676098 AGAGCAGGGGACCGGGGCGGGGG - Intergenic
1130929897 15:88416703-88416725 TCAGCCTGGGGTCTGGGCGGTGG - Intergenic
1130965701 15:88695962-88695984 TGAGCCAGGGGCGGTGGGGGTGG - Intergenic
1131144313 15:90001633-90001655 TGGGGCTGGGGCTGGGGCGGGGG - Intronic
1132320085 15:100919332-100919354 TGGGCCCGGCCCCGGCGCGGGGG + Exonic
1132365346 15:101252379-101252401 GGAGCGCGGGGCCGGCCCGGCGG - Intergenic
1132464744 16:72367-72389 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1132498592 16:275102-275124 TGAGCGCGGGGCCGCGGAAGCGG + Intronic
1132516929 16:370310-370332 AGAGCCGGGGGCCGGGGTAGCGG - Intronic
1132516940 16:370336-370358 AGAGCCGGGGGCCGGGGTAGCGG - Intronic
1132516951 16:370362-370384 AGAGCCGGGGGCCGGGGTAGCGG - Intronic
1132575245 16:661005-661027 TGAGGCCGGGCCGGGGGGGGGGG - Intronic
1132580863 16:684124-684146 CGGGCCGGGGGCCGTGGCGGAGG - Exonic
1132585769 16:705292-705314 CGGGCCAGGGGCCGGGGCGCGGG + Intronic
1132585851 16:705511-705533 TGAGCCAGGAGCCCGGGCCGAGG - Exonic
1132600013 16:769165-769187 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132600017 16:769171-769193 TGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132600020 16:769177-769199 TGGGGCTGGGGCCGGGGCCGGGG - Intergenic
1132600041 16:769213-769235 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132600045 16:769219-769241 TGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132600048 16:769225-769247 TGGGGCTGGGGCCGGGGCCGGGG - Intergenic
1132662038 16:1065938-1065960 TGAACCTGCGGCCGCGGCGGCGG + Intergenic
1132670055 16:1098820-1098842 TGAGTGCGCGGCCGGCGCGGAGG + Intergenic
1132683577 16:1153342-1153364 GGGGGCCGGGGCCGGGGCCGGGG + Exonic
1132692401 16:1187468-1187490 TGAGCCAGGGGCAGGGGTGTGGG - Intronic
1132727972 16:1346976-1346998 TGAGGCGGGGGCCGGCGGGGAGG - Intronic
1132728227 16:1348032-1348054 GGAGCCTGGGGCTGGGGCTGGGG - Intronic
1132736597 16:1389056-1389078 GGGGGCCGGGGCCGGGGCCGGGG - Intronic
1132746578 16:1438766-1438788 TGGGGCCGGGGCCGGGGTGCAGG - Intronic
1132779349 16:1614307-1614329 AGACCCCGGGGCCGGGGCCGGGG + Intronic
1132779355 16:1614313-1614335 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1132785833 16:1656605-1656627 GGAGCCCGGGGCCGGGCCTCGGG - Exonic
1132788318 16:1670546-1670568 TGGGGCCGGGGCCGGGGCTAGGG + Intronic
1132830867 16:1927425-1927447 TGAGCCTTGGGCTGGGGAGGTGG + Intergenic
1132831247 16:1929544-1929566 AGAGCCAGGGGCGGGGGCGGGGG - Intergenic
1132959334 16:2613310-2613332 TGAGCGCTGAGCCGGGGCGAGGG + Intergenic
1132972394 16:2695285-2695307 TGAGCGCTGAGCCGGGGCGAGGG + Intronic
1133020903 16:2966601-2966623 TGACCCCAGGGCAGGGGCTGGGG - Intronic
1133211077 16:4263816-4263838 TGCGCCAGGGGGCGGGGCTGCGG + Intronic
1133220169 16:4316282-4316304 TGGGGACCGGGCCGGGGCGGGGG + Intronic
1133286046 16:4691356-4691378 GGCGCCCGGGGCCAGGGCCGGGG - Intergenic
1133319199 16:4902590-4902612 TGAGGCCGGGGTCTGGGTGGGGG - Intronic
1133784435 16:8963606-8963628 CGGGGCCGGGGCCGGGGCTGCGG + Intronic
1134567870 16:15266666-15266688 GGTGCCCGGGGCTGGGGCTGAGG - Intergenic
1134734565 16:16489687-16489709 GGTGCCCGGGGCTGGGGCTGAGG + Intergenic
1134932901 16:18222219-18222241 GGTGCCCGGGGCTGGGGCTGAGG - Intergenic
1135037337 16:19089337-19089359 GGACCACGGGGCCGGGGGGGTGG - Intergenic
1135335802 16:21599907-21599929 TGGGGCCGGGGCCGGGGCGGGGG + Intronic
1135429904 16:22374354-22374376 AGAGCCCGGGGCAGCGGCTGAGG - Exonic
1135572281 16:23558032-23558054 TGAAGCCGCGGCGGGGGCGGCGG + Exonic
1136237828 16:28925338-28925360 CGGGGCCGGGGCCGGGGCCGGGG - Exonic
1136284722 16:29234024-29234046 TGGGGGCGGGGACGGGGCGGGGG + Intergenic
1136453895 16:30369944-30369966 TGGGGCCGGGGCTGGGGCCGGGG + Exonic
1136453898 16:30369956-30369978 TGGGGCCGGGGCCGGAGCAGAGG + Exonic
1136485938 16:30571675-30571697 TGAGGCCGGGAGCGGGGAGGCGG - Exonic
1136779017 16:32885630-32885652 CGGGCCGGGGGACGGGGCGGCGG + Intergenic
1136784279 16:32925515-32925537 GGAGCCCGGGCCGGCGGCGGCGG + Intergenic
1136885505 16:33928291-33928313 GGAGCCCGGGCCGGCGGCGGCGG - Intergenic
1136891601 16:33975888-33975910 CGGGCCGGGGGACGGGGCGGCGG - Intergenic
1137559241 16:49492464-49492486 GGAGGCCGAGGCCGGGGCCGGGG + Intronic
1137559245 16:49492470-49492492 CGAGGCCGGGGCCGGGGCCGGGG + Intronic
1137559249 16:49492476-49492498 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1137611490 16:49821255-49821277 TGGGGCGGGGGCAGGGGCGGGGG + Intronic
1137655323 16:50153839-50153861 CGGGGCCGGGGCCGGGGCCGAGG - Exonic
1137656795 16:50166689-50166711 TGAGCCTGGGGTGGGGGCAGAGG - Intronic
1137787602 16:51151367-51151389 TGCGCCCGGGGCCGGGGAGCCGG - Intronic
1137926514 16:52546732-52546754 TGGGCCCGGGGCCGGGGGCCGGG + Exonic
1138398889 16:56730013-56730035 CGGGGCCGGGGGCGGGGCGGAGG - Intronic
1139546668 16:67652963-67652985 CGAGCCCGGGGAGGTGGCGGCGG - Intronic
1139549608 16:67666334-67666356 TGAGTCCGGGGGCTTGGCGGTGG - Intronic
1140124127 16:72106165-72106187 TGAGCGTGGAGCCCGGGCGGGGG + Intronic
1140186101 16:72773797-72773819 TGAGCCAGGTGTGGGGGCGGGGG - Intergenic
1141054615 16:80804016-80804038 CGAGCCCGCGGCGGCGGCGGCGG - Intronic
1141132578 16:81445626-81445648 GGAGCCCAGGGCCTGGGGGGCGG + Intronic
1141366665 16:83450006-83450028 TGGGCCCGGGGTCGGGGCGGGGG - Intronic
1141954959 16:87364555-87364577 TGAACCAGAGGCCTGGGCGGGGG + Intronic
1142055013 16:87988550-87988572 TGAGTCCCGGCCGGGGGCGGTGG - Intronic
1142089741 16:88203492-88203514 TGGGGGCGGGGACGGGGCGGGGG + Intergenic
1142175562 16:88643456-88643478 TCGGCCGGGGGCCGCGGCGGGGG + Exonic
1142192163 16:88723067-88723089 TGGGCCCGGGGCTGGGGAGTGGG - Intronic
1142193802 16:88730171-88730193 AGAGCCCGGGGTCTGGGCGCTGG - Intronic
1142292333 16:89198866-89198888 TGAGCCTGGGGGTGGGGTGGGGG - Intronic
1142302470 16:89266630-89266652 TGAGCCAGTGGCGGGGGCAGTGG - Intergenic
1203081428 16_KI270728v1_random:1147719-1147741 CGGGCCGGGGGACGGGGCGGCGG + Intergenic
1142582591 17:951553-951575 CGAGCTGGGGGCGGGGGCGGGGG + Intronic
1142586575 17:978626-978648 TCAGCCTGGGGCGGGGGAGGCGG + Intronic
1142603617 17:1069881-1069903 CGAGTCCGGGGCGGGGGAGGGGG - Intronic
1142631331 17:1228671-1228693 CGAGCTCGGGGCCGGGGAGCGGG - Intronic
1142701218 17:1662187-1662209 TGAGCCAGGGGCGGGGAGGGTGG + Intronic
1142762798 17:2051426-2051448 CGGGCCTGGGGCCGGGGAGGCGG + Intergenic
1142836856 17:2593856-2593878 TGGGCCCGGGCCCGGGGAGGGGG - Exonic
1142848873 17:2694833-2694855 TGCGTGCGGGGCAGGGGCGGTGG - Intronic
1142988926 17:3716075-3716097 TGAACCCGGGGTCAGGGTGGGGG + Intronic
1143498629 17:7326411-7326433 CCAGCCCCGGGCAGGGGCGGGGG - Intronic
1143554369 17:7651481-7651503 CGAGTCCGGGCGCGGGGCGGGGG - Exonic
1144107286 17:11997437-11997459 TGCGCCCGGAGCCGGCGCCGCGG - Intronic
1144586677 17:16491721-16491743 TGAGCGCGGGGAGGGGGCGCGGG - Intronic
1144620036 17:16812653-16812675 TGAGCCTGGGGCAGAGGCTGTGG + Intergenic
1144782383 17:17814574-17814596 TGAGCCCGGGACCAGGCAGGAGG + Intronic
1144892652 17:18503051-18503073 TGAGCCTGGGGCAGAGGCTGTGG - Intergenic
1145077423 17:19867531-19867553 TCCGCCCGGGCCCGGGGCTGCGG - Exonic
1145139562 17:20441236-20441258 TGAGCCTGGGGCAGAGGCTGTGG + Intergenic
1146058700 17:29593544-29593566 GGAGCCGGGGCCCGGGGCCGCGG - Exonic
1146062732 17:29615615-29615637 TGGGCCCGGGGGCGGGACTGGGG - Exonic
1146398679 17:32487363-32487385 AGGGCCCGGGACTGGGGCGGCGG + Intronic
1146445294 17:32928090-32928112 GGGGCCGGGGGCCGGGGCGCGGG + Exonic
1147139720 17:38454151-38454173 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1147144570 17:38477662-38477684 GGAGCCCGGGCCGGCGGCGGCGG + Exonic
1147158594 17:38558203-38558225 TGAGGCTGGGCCCGCGGCGGAGG - Intronic
1147168558 17:38605579-38605601 TCGGCCGGGGGCGGGGGCGGCGG - Intronic
1147250846 17:39151686-39151708 TGGGGCAGGGGGCGGGGCGGGGG + Intronic
1147364855 17:39952983-39953005 TGAGGGCGGGGCTGGGGCAGAGG + Intergenic
1147364876 17:39953040-39953062 TGAGGGCGGGGCTGGTGCGGAGG + Intergenic
1147608043 17:41785453-41785475 TGAGGTAGGGGCCGGGGTGGGGG - Intronic
1147617172 17:41836292-41836314 TGGGGCCGGGGGCGGGGCGGGGG + Intronic
1147636467 17:41967224-41967246 TGAGACTGGGCCCGGGGAGGGGG - Intronic
1147722715 17:42548618-42548640 CGAGGCTGGGGCCGGGGCTGGGG + Intergenic
1147722716 17:42548624-42548646 TGGGGCCGGGGCTGGGGCCGAGG + Intergenic
1147858328 17:43500195-43500217 TTACCCTTGGGCCGGGGCGGTGG + Intronic
1147967172 17:44199621-44199643 AGGGCCCGGGGCCGGGGGGTCGG + Intronic
1147970976 17:44219083-44219105 GGAGGCCGGGGCGGGGGCGCCGG - Intronic
1148183966 17:45627881-45627903 AGAGCCGGGGGCCGGAGAGGGGG + Intergenic
1148443064 17:47721665-47721687 AGAGCCTGGGGCCAGGGCGTGGG + Intergenic
1148452626 17:47789979-47790001 CGAGCCTGGGGCCGGGGCGAGGG - Intergenic
1148553508 17:48564430-48564452 AAAGCCGGGGGCGGGGGCGGGGG - Intronic
1148664102 17:49361930-49361952 CGAGGCGGCGGCCGGGGCGGCGG - Intronic
1148786864 17:50149823-50149845 GGAGCCCGGGCCCGCGGTGGAGG + Exonic
1148838394 17:50478754-50478776 AGGGCCCGGGCCCGGGGCTGCGG - Intergenic
1148899440 17:50865657-50865679 GGAGCCCGGGGCGGGGGCCACGG - Intronic
1148899559 17:50865994-50866016 GGAGCCCCGGGCCCAGGCGGCGG - Intronic
1148929971 17:51120330-51120352 TGAGGCCGGCGGCAGGGCGGGGG - Intronic
1149806166 17:59619957-59619979 AGAGCTCGGGTCGGGGGCGGAGG - Exonic
1149994629 17:61400131-61400153 GGGGGCCGGGGCCGGGGCCGGGG - Exonic
1149997770 17:61413841-61413863 TGAGGCTGGGGGCGGGACGGGGG - Intergenic
1150250112 17:63700299-63700321 GGAGCGCGGAGCCGGGGCGGGGG - Intronic
1150277986 17:63911853-63911875 TGAGCCTTGGGGCGGGGCGGAGG + Intronic
1150326661 17:64263270-64263292 TGTGCCCGGGGGCGGGCGGGCGG - Intronic
1150388795 17:64779548-64779570 TGACCCCGGGGCCGGGGCGCAGG - Intergenic
1150790654 17:68198376-68198398 TGACCCAGGGGCCGGGGCGCAGG + Intergenic
1151152747 17:72101873-72101895 TGAGCCCCTGGCCTGGGGGGTGG - Intergenic
1151291721 17:73155551-73155573 TGACTCGGGGGCGGGGGCGGGGG + Intergenic
1151460266 17:74250083-74250105 TGGCCCTGGGGCCGGGGCAGGGG - Intronic
1151570497 17:74923263-74923285 TCACCCGGGGGCGGGGGCGGAGG + Intergenic
1151584701 17:75002046-75002068 TCAGCCTGGGGGCGGGGTGGTGG - Exonic
1151919229 17:77141140-77141162 GGAGACCGGGACCGGGGCGAGGG - Intronic
1152069071 17:78126231-78126253 TCAACTCGGGGCCGGGGCCGAGG + Intronic
1152070685 17:78132309-78132331 GGAGGCCGGGGCCGGGGCTGGGG - Intronic
1152349696 17:79777930-79777952 GGGGCCCCGGGCGGGGGCGGGGG - Intergenic
1152396359 17:80035910-80035932 CGGGCCCGGGGGCGGGCCGGGGG - Intergenic
1152398526 17:80049841-80049863 TGAGCCCTGGGTCGGGCAGGAGG + Intronic
1152571360 17:81122642-81122664 GGGGCCCGGGCCCGGTGCGGCGG - Exonic
1152636584 17:81432810-81432832 TGGGCCTGGGGATGGGGCGGAGG - Intronic
1152641618 17:81451792-81451814 TGAGCCTGGGGCCGCTGCAGGGG - Exonic
1152675292 17:81637011-81637033 GGAGGCCGGGGCCGGGGCTGAGG - Exonic
1152689739 17:81712521-81712543 TGAGGCCGGGGCCCGGGACGCGG + Intronic
1152720851 17:81923265-81923287 TGGGCCGGGGGCGGGGGGGGGGG - Intronic
1152748413 17:82051632-82051654 CGCGCGCGGGGCCGGGGCGGGGG + Exonic
1152810529 17:82379803-82379825 TGAGGACGGGGCCGGGGCTGGGG - Intergenic
1152889608 17:82873032-82873054 TGAGCCCCGGGCCAGGGCCTGGG - Intronic
1152924491 17:83080871-83080893 TCGGCCCGCGGCGGGGGCGGGGG - Intronic
1153469483 18:5427991-5428013 GGAGGCCGGGGGCGGGGTGGGGG - Intronic
1153843370 18:9026991-9027013 TGTGCCCTGGGCCGGGCTGGTGG + Intergenic
1154125609 18:11689661-11689683 TGGGGCCAGGGCCGGGGCCGGGG - Exonic
1155053863 18:22169203-22169225 GGACCCCGGGGGAGGGGCGGAGG - Intergenic
1155152785 18:23135853-23135875 TGAGGCTGGGGCTGCGGCGGCGG - Exonic
1155218272 18:23662433-23662455 TGTGCCCGGCGACGGGGCGGCGG - Intronic
1156099611 18:33578330-33578352 GGGGCCCGGGCCAGGGGCGGGGG - Intergenic
1156099624 18:33578360-33578382 CGGGCCGGGGGCGGGGGCGGCGG - Intergenic
1156249971 18:35343856-35343878 TCGGGCCGGGGCCGGGGCCGGGG - Intronic
1157176597 18:45457860-45457882 TACCCCCGGGGCTGGGGCGGTGG + Intronic
1157279082 18:46334137-46334159 GGAGCGCGGGGCGCGGGCGGCGG - Intronic
1157464121 18:47930292-47930314 TGCGTCCGCGGCCGGGGCGATGG - Intronic
1157557062 18:48619747-48619769 TGAGCGCGGGCCCGGGGTTGGGG + Intronic
1157565586 18:48677000-48677022 GGAGGCCGGGGCCGCGGCTGGGG + Intronic
1157736625 18:50055238-50055260 TGAGTCCGGGGCAGGGGGGCGGG - Intronic
1158137563 18:54224143-54224165 GGAGCGCGGGGCCGGGGCCCAGG - Exonic
1158137612 18:54224276-54224298 CGGGGCCGGGGCCGGGGCCGCGG - Exonic
1158137632 18:54224312-54224334 CGTGGCCGGGGCCGGGGCCGTGG - Exonic
1158137634 18:54224318-54224340 TGTGGCCGTGGCCGGGGCCGGGG - Exonic
1159342640 18:67155886-67155908 TGACCCCGGGCCCAGGGCTGGGG + Intergenic
1160163208 18:76491268-76491290 CGGGGCCGGGGCCGGGGAGGGGG - Intronic
1160163213 18:76491274-76491296 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160452196 18:78973648-78973670 AGAGACCTGGGCGGGGGCGGGGG + Intergenic
1160499181 18:79394118-79394140 AGGAGCCGGGGCCGGGGCGGGGG - Intergenic
1160544033 18:79641082-79641104 GGTGCCGGGGGCCGGGGCAGGGG - Intergenic
1160583952 18:79902670-79902692 TGAGCTCTGTGCCGGGGCCGTGG - Exonic
1160724846 19:613554-613576 GGGGGCCGGGGCCGGGGCCGGGG + Intronic
1160724850 19:613560-613582 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1160736066 19:662971-662993 CAAGGCCGGGGCCGGGGTGGGGG - Intronic
1160736088 19:663023-663045 TGAGGCCCGGGCCGGGGCGGCGG - Intronic
1160781139 19:878428-878450 CGGGGCCGGGGCCGGGGCTGGGG - Intronic
1160781143 19:878434-878456 TGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160781298 19:878918-878940 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160781302 19:878924-878946 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160781306 19:878930-878952 TGCGGCCGGGGCCGGGGCCGGGG - Intronic
1160783960 19:891285-891307 AGAGCCTGGGGCTGGGGCCGAGG + Intronic
1160791209 19:924678-924700 TGCAACCGGGGCCGGCGCGGTGG - Intergenic
1160830415 19:1102097-1102119 TGAGTCGGGGGCAGTGGCGGGGG + Intergenic
1160830609 19:1103222-1103244 TGAACCCGGGGGCTGGGTGGAGG + Intergenic
1160836773 19:1128289-1128311 TGTGCCGGAGGCAGGGGCGGGGG + Intronic
1160837966 19:1133338-1133360 GGAGCCCGTGGCTGGGCCGGAGG + Intronic
1160863847 19:1248846-1248868 TGCCCCGGGGGGCGGGGCGGGGG - Intronic
1160870364 19:1275148-1275170 TGAGGCCGGGGCAGGAGTGGCGG + Intergenic
1160952912 19:1676059-1676081 TGGGCCAGGGGCCTGGGAGGGGG + Intergenic
1160996691 19:1885328-1885350 TGAGTGCCGGGCAGGGGCGGGGG - Intronic
1161061428 19:2217098-2217120 TGAGCCCGGGGCAGGGGTCGCGG - Intronic
1161063598 19:2227153-2227175 TCCGGCGGGGGCCGGGGCGGGGG - Intronic
1161065612 19:2236026-2236048 GGAGGCCGGGGTCCGGGCGGGGG - Intronic
1161069382 19:2252736-2252758 TGCGCCCCGGGCCGAGGCAGAGG - Exonic
1161349985 19:3786118-3786140 AGACCCCGAGGCCGGGGTGGGGG - Intronic
1161393620 19:4033582-4033604 TGAGCCCGGGGCCCCGGGGAGGG + Intronic
1161400647 19:4065346-4065368 TGCGGCCGGGGCGGGGGAGGGGG - Intronic
1161409733 19:4110481-4110503 TGCGTCCGGGGCAGGGGCAGGGG - Intronic
1161412442 19:4123955-4123977 CGAGCCCGGGGCTGCGGCCGCGG + Exonic
1161487258 19:4543093-4543115 TGTGCAAGGGGCCGGGGAGGTGG - Exonic
1161487641 19:4544265-4544287 GGTCCCGGGGGCCGGGGCGGAGG - Exonic
1161545877 19:4879497-4879519 TGAACCCAGGGCAGGGGTGGAGG + Intergenic
1161723766 19:5917165-5917187 GGAGCCCTGGGCAGGGGCAGAGG + Exonic
1161759026 19:6157233-6157255 TTAGCCCGGGCTCGGGGCGGTGG - Intronic
1161767134 19:6214085-6214107 TGAGCCTGGGGGTGGGGTGGGGG - Intronic
1161864149 19:6821749-6821771 TGAGCCAGGGGCCTGGGGGCTGG - Intronic
1161998885 19:7730949-7730971 TGGGAGGGGGGCCGGGGCGGAGG - Intronic
1162029835 19:7912577-7912599 TAGGCCCGGGGCGGGGGGGGTGG - Exonic
1162031851 19:7920884-7920906 CGAGCCTGGGGGCGGGGCGTGGG + Intronic
1162079360 19:8209302-8209324 GGAGCCCGGGGCGGGGCCGTGGG - Intronic
1162535829 19:11262453-11262475 GGGGCCCGGGGCGGCGGCGGCGG - Intronic
1162535832 19:11262459-11262481 GGGGCCGGGGCCCGGGGCGGCGG - Intronic
1162577160 19:11505747-11505769 AGAGCCCGAGGCGGAGGCGGAGG - Exonic
1162777680 19:12989867-12989889 GGAGCCCGGGGCCTGGGGGCTGG + Intergenic
1162809673 19:13156168-13156190 AGAGGCCCGGGCGGGGGCGGGGG - Intergenic
1162908901 19:13839266-13839288 AGAGCCCAGGGCCGGGGCCAAGG + Intergenic
1162944163 19:14032152-14032174 GGAGCCCCGGGGCGGGGTGGGGG + Intronic
1162953023 19:14083126-14083148 TGAGCCAGGGCCCGAGGCAGTGG - Intronic
1162954593 19:14091016-14091038 TTGGCCCGGGGCGGGGGCGGGGG + Intronic
1163304768 19:16471409-16471431 TGCGCCCGGTGCAGGGGTGGCGG + Intronic
1163485939 19:17586082-17586104 TGAACCCAGGGTGGGGGCGGAGG - Intergenic
1163508015 19:17719676-17719698 TGGGCCCGGGGCCGGCGGGGTGG + Intronic
1163547231 19:17947801-17947823 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1163547234 19:17947807-17947829 TGGGGGCGGGGCCGGGGCCGGGG - Intergenic
1163598271 19:18232988-18233010 TGAGCCCGCGGCCGGAGCTCAGG - Exonic
1163631427 19:18419709-18419731 TGAGTGCGGGGCCGGGGGCGGGG + Intronic
1163655745 19:18543733-18543755 TGGGGCGGGGGCTGGGGCGGGGG + Intronic
1163655752 19:18543745-18543767 TGGGGCGGGGGCTGGGGCGGGGG + Intronic
1163655759 19:18543757-18543779 TGGGGCGGGGGCTGGGGCGGGGG + Intronic
1164274225 19:23702657-23702679 TGAACCAGGGGCGGGGGCGGGGG - Intergenic
1164394389 19:27850779-27850801 TGGGCCCAGGGGCGGGGTGGGGG + Intergenic
1164517194 19:28946565-28946587 CGAGCCCTGGGCCAGGGAGGAGG - Intergenic
1164834728 19:31349771-31349793 CGAGCCCCGGGCCGCGGCGGCGG - Intergenic
1164834787 19:31349966-31349988 TGCGCACGGGGCGGAGGCGGAGG - Intergenic
1165112564 19:33510922-33510944 TGGGCCTGGGGACGGGGAGGAGG - Intronic
1165224126 19:34342170-34342192 GGTGCCCGAGGCTGGGGCGGGGG - Exonic
1165349737 19:35269189-35269211 CGGGGCCGGGGCCGGGGCGCGGG - Intronic
1165349740 19:35269195-35269217 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1165578006 19:36838276-36838298 AGGGCCCGAGGCCGGGGCTGAGG - Intronic
1165750403 19:38256115-38256137 TGAGCCCGGGGAGGGCTCGGGGG - Intronic
1165772055 19:38385774-38385796 TGGGGCCGGGGCCTGGTCGGCGG + Exonic
1165802368 19:38560934-38560956 TGAGCCCGGGGGTGGGGATGGGG + Intronic
1165833684 19:38742243-38742265 TGAACCTGGGGGCGGGGCGAAGG + Intronic
1165867830 19:38949839-38949861 GGAGCCAGGGGGCGGGGCTGAGG - Exonic
1165939169 19:39406775-39406797 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1166205193 19:41264825-41264847 GGAGCCCGGAGCCTGGGCCGAGG + Intronic
1166306853 19:41940245-41940267 GGAGCCCGGGGGCGGAGGGGCGG + Intergenic
1166511992 19:43415220-43415242 TGAGGCTGGGGCTGGGGCTGGGG + Intronic
1166834902 19:45661372-45661394 TGAGCCCGGGGAGGGGGTCGAGG - Intergenic
1166869819 19:45864410-45864432 TTCCCCCGGGGCCGGAGCGGGGG + Exonic
1167091739 19:47349087-47349109 AGAGGGCGGGGCCGGGGAGGAGG + Intergenic
1167134537 19:47609002-47609024 TGGGCGCGGGGCGGCGGCGGGGG + Intronic
1167352027 19:48981499-48981521 TGCGCCAGGGGCCGGAGCGAGGG + Intronic
1167368083 19:49065068-49065090 AGGGCCCGGGTCGGGGGCGGGGG + Intronic
1167456291 19:49597930-49597952 AAACCCCGGGGCCGGGGCCGAGG + Exonic
1167501627 19:49851544-49851566 TGAGCCCGGGATAGGGGCTGGGG - Intronic
1167516577 19:49926937-49926959 TGAACCCTGGGGTGGGGCGGAGG - Intronic
1167516996 19:49929302-49929324 TGAGCGCGGAGACGGGCCGGGGG - Exonic
1167611974 19:50512100-50512122 GGAGCCCAGGGCCGGGGGAGAGG + Intronic
1167622762 19:50568350-50568372 GGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1167622765 19:50568356-50568378 CGAGGCGGGGGCCGGGGCCGGGG - Intergenic
1167688256 19:50969594-50969616 CCAGCCCGGGGCAGGGGCGGGGG - Intronic
1167924140 19:52809906-52809928 TGTGCCCGGGGCCGGTGGGGAGG + Intronic
1168059553 19:53883304-53883326 GGAGCCCGGGGCGGGGGGTGTGG + Intronic
1168249401 19:55133220-55133242 TGAGTCAGGGGCCAGGGTGGGGG + Intronic
1168297307 19:55383746-55383768 CGAGGCCGGGCCCGGGGCGGCGG - Exonic
1168305502 19:55433136-55433158 TGAGGCCAGGGCCGGGTCTGGGG - Exonic
1168332788 19:55579566-55579588 CGAGGCCGGGGCCGTGGCCGAGG - Exonic
1168685987 19:58350016-58350038 CGGGACCGGGGCCGGGGCGGGGG + Intronic
1202713140 1_KI270714v1_random:28227-28249 TGAGCCTGGGGCTGTGGGGGTGG + Intergenic
1202714194 1_KI270714v1_random:33427-33449 TCAGCGCGGGCCCGGGGTGGGGG - Intergenic
925157495 2:1658751-1658773 TGAGCCCGATGCCGGGGGGTGGG - Intronic
925394027 2:3519415-3519437 GGCGGCCGGGGTCGGGGCGGTGG + Exonic
925923893 2:8657243-8657265 TGAGCTCAGGGTGGGGGCGGGGG - Intergenic
926035104 2:9630455-9630477 CGGGCGCGGGGCCGGGGCCGGGG + Exonic
926035106 2:9630461-9630483 CGGGGCCGGGGCCGGGGCGGAGG + Exonic
926205317 2:10831235-10831257 TGACCCCGTGGCCAGGGCTGTGG + Intronic
926422942 2:12716866-12716888 TGAGCCAGTCGCGGGGGCGGCGG + Intergenic
926446404 2:12947863-12947885 TGAGCCGGGTGCAGTGGCGGTGG - Intergenic
926926817 2:17995779-17995801 TGAGGCCTGGGCCTGGGCAGTGG - Intronic
927539141 2:23891733-23891755 TGAGGTGGGGGTCGGGGCGGGGG - Intronic
927698305 2:25252147-25252169 GGAGACCGGGGGCGGGGAGGCGG - Intronic
927698480 2:25252609-25252631 TTAGCGCGGGGCCGGGGGGCCGG + Intronic
927714013 2:25341360-25341382 GGAGCCCGCGGCCAGGGCGCCGG - Intronic
927809342 2:26173033-26173055 GGGGCCCGGGGGCGGGGCCGGGG + Intergenic
927904741 2:26848361-26848383 TGAGCCTGGGGCCCGGCCGCAGG + Intronic
927914415 2:26925673-26925695 TGACCCTGGGGCCTGGGCAGGGG - Intronic
928904323 2:36355292-36355314 GAAGCTCGGGGCCGGGGCGATGG - Intergenic
928928021 2:36598031-36598053 CGAGCCTGGGGCGGAGGCGGGGG - Exonic
929242304 2:39665751-39665773 GGAGCCCGGGGGCCGGGCCGGGG + Intronic
929452813 2:42048140-42048162 GCCGCCCGGGGCCGGGGCCGGGG + Exonic
929454853 2:42058314-42058336 TGAGCCAGGACCTGGGGCGGGGG + Exonic
929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG + Exonic
930011476 2:46941199-46941221 GGCGCCGGGGCCCGGGGCGGAGG + Exonic
931602293 2:64017052-64017074 ATGGGCCGGGGCCGGGGCGGTGG + Intronic
932568532 2:72924521-72924543 TGCGCCCGGAGCCCGGGTGGAGG + Intronic
933658113 2:84905720-84905742 TGAGTGCGGCGCCGGGGCGGGGG + Intronic
933847463 2:86337416-86337438 GCAGCCCGGGGCCGGGGGCGGGG + Intronic
933858481 2:86441576-86441598 TGGGCGCCGGGGCGGGGCGGCGG + Intronic
934079111 2:88452449-88452471 GGCGCCCGGGGCGGCGGCGGTGG + Exonic
934117652 2:88811952-88811974 TGGACCCAGGGCCGGGGTGGAGG - Intergenic
934555162 2:95283196-95283218 TGAACCAGGGGCCTGGGCAGAGG + Intronic
934733939 2:96678206-96678228 TGAACCCGGGGGGCGGGCGGAGG - Intergenic
934936968 2:98472635-98472657 TGAGCCCTGGGCTGGGGCTAGGG - Intronic
934947738 2:98554221-98554243 TGAGCCCAGGCCAGGGGCTGGGG - Intronic
935592436 2:104855281-104855303 GCAGCCGGGGGCCGCGGCGGCGG + Intergenic
936585752 2:113756444-113756466 TGAGTCCGAGGCCGCGGCCGTGG - Exonic
937779622 2:125822451-125822473 TGAACCCGGGACCCGGGAGGCGG - Intergenic
937943839 2:127312880-127312902 TGAACCCAGGGTGGGGGCGGAGG + Intronic
937996983 2:127701627-127701649 GGAGCCCGGGGACCGGCCGGCGG + Exonic
938030338 2:127986829-127986851 TGAGCCCTGGGCGGGAGCGTTGG + Exonic
938105286 2:128526000-128526022 GGATCCCGGGGCTAGGGCGGAGG - Intergenic
938291409 2:130152731-130152753 TGAGCCTGGGGCCGCGGGTGTGG + Exonic
938301056 2:130213531-130213553 TGAGCCCGGGGACCGGGGCGGGG - Intergenic
938455665 2:131460937-131460959 TGAGCCCGGGGCCGGGGCGGGGG + Intergenic
938465134 2:131520228-131520250 TGAGCCTGGGGCCGCGGGTGTGG - Intergenic
938727230 2:134119874-134119896 TGAGCGCGCGGCCGGGGGCGGGG + Intergenic
938982386 2:136539056-136539078 TGAGGCCGGGGGAGGGGAGGGGG - Intergenic
939629636 2:144516847-144516869 GGATCCCGGGGCGGGGGCGGGGG - Intronic
940322896 2:152395896-152395918 TGGGCCAGGGGGCGGGGCGGCGG + Intronic
940903441 2:159147407-159147429 TGGGCCCGGGGCAGAGGCGGAGG + Intronic
941119114 2:161507860-161507882 TGGGCCCGCGGCGGCGGCGGCGG - Intronic
941666356 2:168247283-168247305 TGCCGCCGGGGCCGGGGCCGGGG + Exonic
941666361 2:168247289-168247311 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
941666363 2:168247295-168247317 CGGGGCCGGGGCCGGGGCCGCGG + Exonic
943645939 2:190408213-190408235 TGAGGCCGGGGCCGGGGAGGAGG + Intergenic
944070111 2:195657981-195658003 TGAGGGTGGGGCCGGGTCGGTGG + Intronic
944669213 2:201981281-201981303 TGACCCAGGGGCCAGGGAGGTGG + Intergenic
945403983 2:209423729-209423751 TGAGGCCAGTGCCCGGGCGGCGG - Intergenic
946174123 2:217912285-217912307 TGAGCCCAGGGCCGAGGGGAAGG + Intronic
946219959 2:218217546-218217568 TGAGCGCGCGCCCGGGGCCGGGG + Intronic
946252934 2:218424353-218424375 TGAGTCAGGGGCAGGGGAGGGGG + Intronic
946322271 2:218960948-218960970 TGTGTCAGGGGCTGGGGCGGGGG - Exonic
946410186 2:219511746-219511768 TGGGCGCAGGGCCGGGGTGGGGG + Intergenic
946422206 2:219571292-219571314 CGAGCCGAGGCCCGGGGCGGCGG + Intronic
946440416 2:219690475-219690497 TGAGCCTGGGGCCCAGGCGGGGG + Intergenic
947118510 2:226795886-226795908 TGGACCTGGGGCCGGGCCGGAGG - Exonic
947517605 2:230821235-230821257 TGAGCACGGGGGCGGTGGGGGGG - Intergenic
947602637 2:231464080-231464102 TGAGCGCGGGGAGGGGGCGCTGG - Intronic
947705630 2:232273327-232273349 TGAGCACTGGGCAGGGGCTGGGG - Intronic
947963533 2:234259888-234259910 TGAGGCCGAGGCCGAGGCTGAGG - Intergenic
947963573 2:234260095-234260117 TGAGGCTGGGGCTGGGGCTGGGG - Intergenic
948202859 2:236142371-236142393 CGGGGCAGGGGCCGGGGCGGGGG - Intergenic
948216538 2:236237337-236237359 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948216553 2:236237362-236237384 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948216568 2:236237387-236237409 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948216583 2:236237412-236237434 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948697035 2:239737651-239737673 TGGGGACGGGGCCGGGGCTGTGG - Intergenic
948697224 2:239738041-239738063 TGGGGCCGGGGCTGGGGCTGGGG - Intergenic
948697270 2:239738137-239738159 TGGGGCCGGGGCTGGGGCTGGGG - Intergenic
948697273 2:239738143-239738165 TGGGGCTGGGGCCGGGGCTGGGG - Intergenic
948697280 2:239738155-239738177 TGGGGCCGGGGCTGGGGCTGGGG - Intergenic
948697287 2:239738167-239738189 TGGGGCCGGGGCTGGGGCCGGGG - Intergenic
948697298 2:239738185-239738207 TGGGGCCGGGGCCGGGGATGGGG - Intergenic
948697313 2:239738209-239738231 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
948697317 2:239738215-239738237 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
948697321 2:239738221-239738243 TGGGGCCGGGGCCGGGGCCGGGG - Intergenic
948816211 2:240511644-240511666 TGCGCACGGGGCCTGGGTGGCGG - Intronic
948824634 2:240568371-240568393 GGGGCGCGGGGCCGGGGCGCCGG - Intronic
948824640 2:240568384-240568406 TGTGCGCGGGGCCGGGGCGCGGG - Intronic
948824854 2:240569116-240569138 TGAGTCCGGGGCGGGCGCCGGGG + Intronic
948862110 2:240757653-240757675 AGGGGCCGGGGCCGGGGCTGGGG + Intronic
948870535 2:240795703-240795725 TGAGCCAGGGGGCAGGTCGGAGG + Intronic
948883393 2:240871451-240871473 TGAGCCTGGCCCCAGGGCGGTGG + Intronic
948926593 2:241102501-241102523 TGAGGCCGCGGCAGAGGCGGCGG - Intergenic
948942779 2:241204409-241204431 TGAGGCAGGGGCCAGGGTGGGGG + Intronic
949016444 2:241714682-241714704 TGAGCCTGGGGACAGGGAGGTGG - Intronic
1168769756 20:407955-407977 GGGGGCCGGGGCCGGGGCCGGGG - Intronic
1168769760 20:407961-407983 TGGGCCGGGGGCCGGGGCCGGGG - Intronic
1169171825 20:3471344-3471366 TGAGGCCGAGGCCGCGGCGGCGG + Exonic
1169214748 20:3786538-3786560 GGGGCCCGGGCCCGTGGCGGGGG + Exonic
1169849553 20:10034885-10034907 GGAGGCGGGGGCGGGGGCGGAGG + Intronic
1171115548 20:22522077-22522099 AGAGCCCGGGGGCGGGGAGTGGG - Intergenic
1171484344 20:25476594-25476616 GGATGCCGGGGCAGGGGCGGGGG + Exonic
1171796794 20:29572744-29572766 TGTGCCTGGGGCAGGGGTGGTGG - Intergenic
1171851453 20:30311422-30311444 TGTGCCTGGGGCAGGGGTGGTGG + Intergenic
1172028941 20:31968239-31968261 GGAGCCCGGGGCAGTGCCGGCGG + Exonic
1172055300 20:32150536-32150558 TGGGCCTGGGGCTGGGGCTGGGG + Intronic
1172095246 20:32457241-32457263 GGAGGCCGGGGCTGGGGCTGGGG - Intronic
1172100933 20:32483643-32483665 CGGGCACGGGGCGGGGGCGGGGG + Intronic
1172143919 20:32743284-32743306 TGGGCCCGGCGGCGGGGCGTGGG - Intronic
1172286614 20:33745199-33745221 TGAGACTGTGGCCAGGGCGGGGG - Exonic
1172447891 20:35002698-35002720 TGAGCCCTGGGCAGGGGTGGTGG - Exonic
1172474568 20:35226993-35227015 GGCGCGCGGGGCCGGGGCGCGGG + Intronic
1172528598 20:35616154-35616176 AGAGCCCGGGGCCCGAGCTGCGG + Exonic
1172596570 20:36154625-36154647 CGAGGCCGGGGCGGGGGCGGGGG + Intronic
1172846702 20:37933976-37933998 TGGCCCCGGGGACGGGGTGGGGG + Intronic
1173454056 20:43189657-43189679 TGAGCCCGGGCGCCGGGCAGTGG + Exonic
1173516452 20:43668036-43668058 TGAGCCCGGAGCCAGGTCTGTGG + Intronic
1173684011 20:44910119-44910141 TGGGCAGGGGGCCGGGGCTGCGG - Exonic
1173684979 20:44916881-44916903 TGGGCCCGAGGGAGGGGCGGAGG + Intronic
1174402610 20:50283990-50284012 GGAGCCAGGGGCCGGGACAGAGG - Intergenic
1175429601 20:58891945-58891967 GGAGCGCGCGCCCGGGGCGGGGG - Intronic
1175783146 20:61696291-61696313 TGAGCCAGGGGCAGGGCCTGGGG + Intronic
1175788144 20:61724599-61724621 ACAGCCCGGGGTCGGGGCGAAGG - Intronic
1175847039 20:62064854-62064876 GGCGGCCGGGGCGGGGGCGGGGG + Exonic
1175877831 20:62238737-62238759 CGAGGCCGGGGCCGGGGCCGGGG - Intronic
1175924844 20:62466576-62466598 TGAGCCCCGGGCCGGGTGCGCGG + Intronic
1175950856 20:62582376-62582398 GGGGCGCGGGGGCGGGGCGGGGG - Intergenic
1176005576 20:62860951-62860973 CGGGGCCGGGGCCGGGGCGGAGG - Intronic
1176005579 20:62860957-62860979 CGAGGCCGGGGCCGGGGCCGGGG - Intronic
1176005583 20:62860963-62860985 GGAGGCCGAGGCCGGGGCCGGGG - Intronic
1176016793 20:62938104-62938126 GGAGGCGGGGGCGGGGGCGGGGG - Exonic
1176062691 20:63179153-63179175 TGCGCCGCGGGGCGGGGCGGAGG + Intergenic
1176135490 20:63520478-63520500 TGGGCCCGGGAGAGGGGCGGGGG + Intergenic
1176143207 20:63554087-63554109 GCGGCCCGGGGGCGGGGCGGGGG - Exonic
1176207214 20:63895488-63895510 CGCGGCCTGGGCCGGGGCGGGGG + Intronic
1177835141 21:26179446-26179468 TGAACCCGGGGCAGCGGGGGAGG - Intergenic
1177885592 21:26742001-26742023 TGAGCCTGGGCCAGGTGCGGTGG + Intergenic
1178568733 21:33714115-33714137 TGAGGCTGGGCCAGGGGCGGTGG - Intronic
1178673911 21:34614966-34614988 CCAGCTCGGGGCCGCGGCGGAGG - Exonic
1179213739 21:39349122-39349144 GGAGCCCGCGGCCGGGGACGCGG - Exonic
1179675077 21:42975239-42975261 CGAGGCCGGGGCCGGGGTCGCGG - Intronic
1179775601 21:43659830-43659852 CGGGCCGGGGGCCGGGGCTGGGG + Intronic
1179996305 21:44975994-44976016 TGAGCCTGGTGGCGGGGAGGTGG - Intronic
1180005520 21:45018907-45018929 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1180032984 21:45224666-45224688 GGAGCCCTGGGCCGGGGCAGGGG + Exonic
1180086473 21:45509997-45510019 TGCGCCCGGGGCCTGGGTGCAGG + Intronic
1180101823 21:45590982-45591004 GGAGGCGGGGGCGGGGGCGGGGG + Intergenic
1180180375 21:46116213-46116235 TGAGCCCTGGGTCGGGCTGGAGG - Intronic
1180648792 22:17361657-17361679 TGAACCCGGGGGCTGGGGGGAGG + Intronic
1180891485 22:19291870-19291892 AGAGGCGGGGGCAGGGGCGGGGG - Intergenic
1180981741 22:19881441-19881463 AGAGCCTGTGGGCGGGGCGGGGG - Intronic
1181017677 22:20080478-20080500 CGAGGCCGCGGGCGGGGCGGGGG + Intronic
1181031482 22:20150432-20150454 TGGGGCTGGGGCTGGGGCGGTGG + Intronic
1181280588 22:21717125-21717147 GGAGGCCGGGGCTGGGGGGGCGG + Intronic
1181408901 22:22704382-22704404 TGAGCCTGGGGCAGGGTCTGGGG - Intergenic
1181592657 22:23894666-23894688 GGAGCTGGGGGGCGGGGCGGGGG + Exonic
1181637592 22:24181567-24181589 TGGGTCCGGGGCCCGGGCCGAGG - Exonic
1182246770 22:28964432-28964454 TGAGCCTGGGCCAGGGGCAGAGG + Intronic
1182249930 22:28992172-28992194 GGTGTGCGGGGCCGGGGCGGGGG - Intronic
1182358776 22:29734823-29734845 TGGGGCTGGGGCTGGGGCGGGGG - Intronic
1182518168 22:30870697-30870719 GGAGCCCCGTGCCAGGGCGGTGG - Intronic
1182621471 22:31620972-31620994 TCAGCCCGGGGCCAGCGTGGGGG - Intronic
1183187494 22:36300378-36300400 TGAGCCCAGGGCCATGGCTGAGG + Intronic
1183197666 22:36364588-36364610 TGAGGCAGGGGGTGGGGCGGAGG - Intronic
1183293993 22:37019376-37019398 TGAGTGCGGGGCGGGGGCAGCGG - Exonic
1183306111 22:37084092-37084114 GGAAGCCGGGGCCAGGGCGGAGG + Intronic
1183404454 22:37623635-37623657 TGAGCCCAGGGCAGGTGCTGAGG + Intronic
1183465838 22:37980048-37980070 TGGGCTCAGGGCCGGGGTGGGGG - Intronic
1183577980 22:38704383-38704405 TGAACCCGGGGGGGGGGGGGGGG - Intergenic
1183585895 22:38752769-38752791 GGGGCCGGGGGCCGGGGGGGTGG - Intronic
1183622488 22:38982557-38982579 GGAGCCCAGGGCTGGGGCAGGGG - Intronic
1183630152 22:39027727-39027749 GGAGCCCAGGGCTGGGGCAGGGG - Intronic
1183632369 22:39041066-39041088 GGAGCCCAGGGCTGGGGCTGGGG - Intronic
1183638187 22:39077467-39077489 GGAGCCCAGGGCTGGGGCTGGGG - Intronic
1183641822 22:39097431-39097453 GGAGCCCAGGGCTGGGGCTGGGG - Intronic
1183665572 22:39244129-39244151 GGAGCCGGGGCCGGGGGCGGCGG - Exonic
1183667558 22:39254317-39254339 TGAGCCCGGAGCCGAGGACGTGG - Intergenic
1183720134 22:39557777-39557799 GGCGCTCCGGGCCGGGGCGGGGG - Intergenic
1184115159 22:42417866-42417888 CAAGCCCGGGGACGGGGCGGGGG - Intronic
1184411874 22:44330813-44330835 TGATCCCGCGCCCGGGGCTGGGG - Intergenic
1184412176 22:44331717-44331739 TGGGGCCGGGGCCGGGGCTGGGG + Intergenic
1184431073 22:44441818-44441840 TGAGCCTGGGGCCAGGGCGGGGG + Intergenic
1184439192 22:44498230-44498252 CCAGGCCGGGGCCGGGGCAGGGG + Exonic
1184439217 22:44498298-44498320 TGCGGGCGGGGCCGGCGCGGTGG + Exonic
1184465875 22:44668722-44668744 GGAGCCCGGGGCCGGGGGAGGGG - Intronic
1184545464 22:45164355-45164377 AGAGCCCAGGGCCGGGAGGGCGG + Intronic
1184562111 22:45269264-45269286 GGAGGCGGGGGCGGGGGCGGGGG + Intergenic
1184674901 22:46036263-46036285 TGTCCCCGGGGCCGGGCCGCTGG - Intergenic
1185138904 22:49089426-49089448 GGAGTCCGGGGCCTGGGCAGAGG - Intergenic
1185241273 22:49748941-49748963 TGGGGCTGGGGCCGGGGCTGGGG - Intergenic
1185272697 22:49936097-49936119 GGAGCGCGGGGCCGGGGCGGCGG - Intergenic
1185342835 22:50299307-50299329 GGGGCCCGGTGCGGGGGCGGGGG + Intronic
1185409455 22:50674479-50674501 CGGGGCCGGGGCCGGCGCGGGGG - Intergenic
1185418311 22:50721581-50721603 TGGGCCCGGGGGCTGGGCAGGGG - Intergenic
949244523 3:1910450-1910472 TGGACCCAGGGCTGGGGCGGAGG - Intergenic
950065462 3:10108220-10108242 TGAGCCCCGGGCCCGGATGGTGG - Exonic
950464599 3:13145792-13145814 GGCGCCCGGGGGCGGGGGGGGGG + Intergenic
950510008 3:13420325-13420347 TGAGCGCGGGGGCGGGGCGAGGG + Intergenic
950510851 3:13425676-13425698 AGAGCCCAGGGTCGGGGTGGGGG - Intergenic
950539938 3:13606012-13606034 TGAGCCCAGGGATGGGGAGGGGG - Intronic
950652125 3:14413692-14413714 TGTGCCTGGGGCCGGGGGTGGGG + Intronic
951543670 3:23806196-23806218 AGGGCACGGGGCCGGCGCGGGGG + Intronic
951551515 3:23879664-23879686 GGAGGCCTGGGCCGCGGCGGAGG + Intronic
952377799 3:32781569-32781591 TGACCCAGCGGCCGGCGCGGCGG + Intergenic
952816633 3:37452599-37452621 TGGCCTGGGGGCCGGGGCGGTGG - Intronic
952886019 3:38011332-38011354 TGAGCCCGCGGCCTCGGCGAAGG + Exonic
952942262 3:38453990-38454012 TGGGCCCGGGCCCCGGGCGCAGG - Exonic
954278001 3:49554788-49554810 CGGGACCGGGGCCGGGGCCGGGG - Exonic
954290740 3:49648692-49648714 TGAGCCCAGGGCCTGGCCAGTGG + Intronic
954361327 3:50124309-50124331 TGGGGCCGGGGCCGGGGCCGGGG - Intergenic
954415042 3:50389150-50389172 TGGGCCTGGGGCGGGGGCGGAGG + Intronic
954437497 3:50503747-50503769 TGGGCGCGTGGCCGCGGCGGGGG - Intronic
954610355 3:51941801-51941823 TGGGGCCGGGGCTGGCGCGGGGG - Exonic
954698450 3:52439767-52439789 TGAGTCTGGGGCCAGGGAGGAGG + Exonic
954757318 3:52848292-52848314 TGACCCAGGGGCAGGGGCTGAGG + Intronic
954778951 3:53045609-53045631 TGGGGGCGGGGGCGGGGCGGGGG - Intronic
954812364 3:53256019-53256041 CGAGGCCGGGCGCGGGGCGGGGG + Exonic
954864691 3:53718580-53718602 TGGGCCGGGGGGCGGGGGGGCGG - Intronic
955507016 3:59642302-59642324 CGAGGCCGGGGGCGGGGAGGCGG + Intergenic
956188223 3:66582818-66582840 TGAGGCCGCGGCCTGGGCGCTGG - Intergenic
956345603 3:68274699-68274721 TGTGGGCGGGGGCGGGGCGGGGG - Intronic
956821002 3:72954185-72954207 TGAACCCGGGGAGGGGGCGGAGG - Intronic
956825855 3:72996645-72996667 TGGGCCTGGGGCTGGGGCTGGGG + Intronic
957600211 3:82324236-82324258 TGGGCCCGGGGCAAGGGTGGGGG - Intergenic
960047612 3:113212425-113212447 GGAGCATGGGGCCGGGGCGCTGG - Intronic
960094026 3:113670836-113670858 TGAGCCCAGGGAAGGGGCTGAGG - Intronic
960537505 3:118829454-118829476 TGAGCCCTGGGCAAGGGCAGTGG + Intergenic
960914364 3:122681188-122681210 GGTGGCCGGGGCGGGGGCGGGGG + Intronic
961013475 3:123450037-123450059 GGAGCCCTGGCCGGGGGCGGGGG - Intergenic
961081668 3:124033440-124033462 GGGGCCCGGGGCCGGGGTGCGGG - Intergenic
961186246 3:124917743-124917765 TGGGGCGGGGGCGGGGGCGGGGG + Intronic
961446222 3:126983011-126983033 AGAGCCCGGGGGCGGGGCGGGGG - Intergenic
961508227 3:127385638-127385660 CGAGGCCGAGGCCGGGGCTGAGG + Intergenic
961666838 3:128497941-128497963 CGGGGCCGGGGCCGGGGCAGGGG - Intergenic
961666842 3:128497947-128497969 TGGGGCCGGGGCCGGGGCCGGGG - Intergenic
961827558 3:129606810-129606832 GCAGCCCGGGGGCGGGGCGGGGG + Exonic
961929369 3:130517094-130517116 TGGGCCCGGGGCCGCCGGGGCGG + Intergenic
962507419 3:136061838-136061860 TGAACCCGGGACCTGGGAGGTGG + Intronic
962809115 3:138946683-138946705 CGAGCCCGAGGACGCGGCGGGGG - Exonic
964320108 3:155486809-155486831 TGAGCCAGGGCCAGGCGCGGTGG - Intronic
964614499 3:158648389-158648411 TGAGCCTGGGCCGGGCGCGGTGG + Intronic
964771290 3:160226122-160226144 GGCGGCCGGGGCCGGGGAGGCGG + Exonic
964876324 3:161372260-161372282 TGAGCCCAGGGCTCGGGCTGGGG + Exonic
965520078 3:169662572-169662594 TGATCGCGGGGTGGGGGCGGGGG - Intronic
965991104 3:174819142-174819164 TGAGCCCTGAGCCTGGGAGGTGG - Intronic
966350142 3:179024842-179024864 GGGGCCCGGGGGCGGGGCGGGGG - Exonic
966886445 3:184380177-184380199 CGGGGCCGGGGCCGGGGCCGGGG - Exonic
966886449 3:184380183-184380205 GGGGGCCGGGGCCGGGGCCGGGG - Exonic
967858461 3:194134886-194134908 TGAGCCCGGGCCAGGCGCAGGGG + Intergenic
968051580 3:195658303-195658325 AGAGCCCTGGGCCGGTGCGAGGG + Intergenic
968104236 3:195990030-195990052 AGAGCCCTGGGCCGGTGCGAGGG - Intergenic
968302537 3:197627620-197627642 AGAGCCCTGGGCCGGTGCGAGGG - Intergenic
968433903 4:575496-575518 CGAGCCCGGCGCCGAGCCGGGGG + Intergenic
968433915 4:575520-575542 CGAGCCCGGGGCCGAGCCGGGGG + Intergenic
968462656 4:733067-733089 GCAGCACGGGGCAGGGGCGGAGG - Intronic
968462664 4:733089-733111 GCAGCACGGGGCAGGGGCGGAGG - Intronic
968479185 4:826258-826280 GGACCCGGGGGCGGGGGCGGAGG + Intergenic
968479216 4:826307-826329 TGGACCCGGGGCGGGGGCGGGGG + Intergenic
968479232 4:826332-826354 GGACCCGGGGGCGGGGGCGGGGG + Intergenic
968479256 4:826369-826391 CGGACCCGGGGCGGGGGCGGGGG + Intergenic
968479271 4:826393-826415 TGGACCCGGGGCGGGGGCGGGGG + Intergenic
968479286 4:826417-826439 GGACCCGGGGGCGGGGGCGGGGG + Intergenic
968479314 4:826460-826482 TGGACCCGGGGCGGGGGCGGGGG + Intergenic
968479329 4:826484-826506 GGACCCGGGGGCGGGGGCGGGGG + Intergenic
968485508 4:859123-859145 AGCGCCCGGGGCCGGGCCTGAGG + Intronic
968506444 4:973357-973379 CGCGCCCGGGGCCGGGGCCGGGG - Exonic
968511364 4:997318-997340 GGAGTGCGGGGCAGGGGCGGAGG - Intronic
968512282 4:1001008-1001030 TGGGGCCCTGGCCGGGGCGGGGG + Intronic
968517987 4:1022868-1022890 TGCGCCTGGGGCCCGGGCGCTGG + Intronic
968568304 4:1326619-1326641 TGAGGCAGGGGCGGGGGTGGGGG - Intronic
968651993 4:1763819-1763841 TGGCCGCGGGGCCGGGCCGGGGG + Intergenic
968659638 4:1793706-1793728 GGAGCCCTGGGCGGCGGCGGCGG + Intronic
968750601 4:2387052-2387074 AGACTCCGGGGCCGGGGCCGGGG + Intronic
968750605 4:2387058-2387080 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
968879822 4:3293109-3293131 CGGGGCCGGGGCCGGGGCGGGGG + Intronic
968930635 4:3576800-3576822 TGAGACCAGGGCTGGGGAGGAGG + Intergenic
968965003 4:3765400-3765422 TGAGGCCGGGGTGGGTGCGGAGG + Intergenic
969052801 4:4385377-4385399 TGAGACGGGGGGCGGGGCGGGGG + Intronic
969285708 4:6200673-6200695 TCTGCCCGGGGCGGGGGCGGGGG - Intergenic
969344743 4:6563681-6563703 TGAGCGCGGGCCCGGGGCGGGGG + Intergenic
969413092 4:7042584-7042606 GGAGCCCGGAGCCGGGCCCGAGG - Exonic
969517546 4:7656008-7656030 AGATCCCAGGGCCGGGGCCGTGG - Intronic
969717616 4:8875634-8875656 AAAGCCGGGGGCCGGGGTGGTGG + Intergenic
971635144 4:29047804-29047826 GGAGCCCACGGCGGGGGCGGCGG - Intergenic
973246742 4:48017373-48017395 GGCGCCCGGGGCCGCGGGGGTGG + Intronic
973279792 4:48347323-48347345 TGAGCCAGGGGTGGGGGAGGGGG - Intronic
974226583 4:59052901-59052923 TGAACCCGGGGGCGGGGGCGGGG + Intergenic
975329590 4:73099222-73099244 TGAGCCTGGGAAAGGGGCGGGGG - Intronic
976146231 4:82044555-82044577 AGAGCGGGCGGCCGGGGCGGGGG + Intergenic
976199015 4:82561547-82561569 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
976742924 4:88375880-88375902 TGAGCCCGGAGCCTGGGAGGTGG - Intergenic
977693774 4:99946249-99946271 CCAGCCCGGAGCCGGGGCTGGGG + Intronic
977809714 4:101346099-101346121 TCCGCGCGGGGCGGGGGCGGGGG - Intronic
979624138 4:122827091-122827113 GGAGGCCGGGGCCGGGGCCGGGG + Exonic
980405037 4:132344816-132344838 TGCGGCTGGGGCCGGGGCCGGGG + Intergenic
980405040 4:132344822-132344844 TGGGGCCGGGGCCGGGGCTGGGG + Intergenic
980405062 4:132344895-132344917 TGCGGCTGGGGCCGGGGCTGGGG + Intergenic
980405065 4:132344901-132344923 TGGGGCCGGGGCTGGGGCCGGGG + Intergenic
980405072 4:132344913-132344935 TGGGGCCGGGGCTGGGGCCGGGG + Intergenic
981128407 4:141132628-141132650 GGACCCCGGGGCCGGGGCGGCGG - Exonic
981508367 4:145527958-145527980 TGAACCCAGGGCCGGGGCCGGGG - Intronic
981621147 4:146700107-146700129 GGCGGCCGGGGGCGGGGCGGAGG - Intergenic
981761893 4:148203654-148203676 TAAGAACGGGGGCGGGGCGGGGG - Intronic
982245212 4:153344509-153344531 CGGGCCTGGGGCCGGGGCTGTGG - Intergenic
983787338 4:171749905-171749927 TGAGCCCGGGGACGGGGTGGAGG - Intergenic
983940201 4:173529343-173529365 TGAGGCAGGGGCCCGGGCCGAGG - Exonic
984888630 4:184473198-184473220 GGCGCCCGGAGCCGGGTCGGAGG + Intronic
984889042 4:184474901-184474923 CGAGTCGGGGTCCGGGGCGGGGG + Intergenic
984908126 4:184648970-184648992 CGAGCCCGGGGCCGGGAGGTCGG - Intronic
985068349 4:186144717-186144739 TCGGCGCGGGGCCGGGGCCGGGG + Intronic
985068352 4:186144723-186144745 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
985129093 4:186723874-186723896 GGCGGGCGGGGCCGGGGCGGAGG - Intronic
985298189 4:188457747-188457769 AGAACTGGGGGCCGGGGCGGTGG + Intergenic
985497643 5:218556-218578 AGAGCCCTGGGCCGGTGCGAGGG + Intronic
985593616 5:777899-777921 GGAGCCCGGGGCGGGGGAGGGGG + Intergenic
985660560 5:1155077-1155099 GGAGGGCGGGGCGGGGGCGGGGG - Intergenic
986721609 5:10564429-10564451 CGGGCCGGGGGCCGGGGCGCGGG - Intronic
986733278 5:10650133-10650155 TGGGGCCGGGGCTGGGGCCGGGG + Exonic
986912510 5:12574597-12574619 GGAGCCCACGGCGGGGGCGGGGG + Intergenic
987091359 5:14510646-14510668 TGGGCCCAGGGCCGAGGCCGAGG - Intronic
987830538 5:23089501-23089523 TGAGGCCGGGGCGTGGGTGGTGG - Intergenic
988530761 5:32025236-32025258 TGAGCCCTGGCCGGGTGCGGTGG + Intronic
989592218 5:43121844-43121866 TGAGACCGGAGCCGCGGCCGCGG - Exonic
990218476 5:53560945-53560967 TGAGTGCGAGGCCGGGGAGGAGG + Intronic
991346232 5:65671633-65671655 TGAACCGGGGGCGGGGGTGGGGG + Intronic
991587527 5:68215689-68215711 GGCGCGCGGGGCCGGGCCGGAGG + Intergenic
992080430 5:73231008-73231030 TGAGAAGGGGGCTGGGGCGGGGG - Intergenic
992320923 5:75612330-75612352 GGAGGGCGGGGGCGGGGCGGAGG - Intronic
992939566 5:81750240-81750262 TGGGGCTGGGGCGGGGGCGGGGG - Intronic
992939570 5:81750246-81750268 TGGGGCTGGGGCTGGGGCGGGGG - Intronic
996299819 5:121967753-121967775 TGAGCCCGGGAGGGGGACGGAGG + Intronic
996978496 5:129461473-129461495 TGGGCCGGGGGCGGGGACGGGGG - Exonic
998039798 5:138944922-138944944 TGAGCCCGAGGCCTGGGAGGTGG - Intergenic
998366870 5:141637598-141637620 ACAGCCCGGGGCCGGTGAGGCGG + Exonic
998957633 5:147453724-147453746 GGAGCCCGGGAGGGGGGCGGAGG - Intronic
999256123 5:150210813-150210835 TGGGCCCGGGCCCGGTGTGGGGG + Exonic
999321612 5:150618727-150618749 TGGGCCCAGGGCCAGGGCTGGGG - Exonic
1000282333 5:159792987-159793009 AGAAGGCGGGGCCGGGGCGGGGG + Intergenic
1001065069 5:168529571-168529593 TGGGGCGGGGGCCGAGGCGGCGG + Exonic
1001597647 5:172908295-172908317 TGAGGCGGGGGCGGGGGGGGGGG + Intronic
1001686193 5:173596688-173596710 TGAGCCCACGGCAGGGGCGAAGG - Intergenic
1002046319 5:176543452-176543474 TTCGCGCGGGGCCGGGGCGGGGG - Intronic
1002061333 5:176627649-176627671 TGAGCCCGGCGGGGGGGTGGGGG + Intronic
1002170336 5:177371074-177371096 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170340 5:177371080-177371102 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170344 5:177371086-177371108 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170348 5:177371092-177371114 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170352 5:177371098-177371120 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002190092 5:177473407-177473429 GGGGCCGGGGGCGGGGGCGGGGG + Intronic
1002281129 5:178130768-178130790 GAGGCCCGGGGCCGGGCCGGAGG + Intergenic
1002281206 5:178131026-178131048 GGAAGCCGGGGCCGGGGCTGCGG + Exonic
1002512752 5:179733366-179733388 CAGGCGCGGGGCCGGGGCGGCGG - Exonic
1002524224 5:179806633-179806655 GGGGACCGGGGCCGGGGCGCAGG + Intronic
1002541317 5:179908005-179908027 CGCGCCCGAGGCCGGGGCTGAGG - Intergenic
1002719078 5:181246970-181246992 TGCGCTCTGGGCCGGGGCCGGGG + Intronic
1003058028 6:2840861-2840883 TGAGTCTGGGGGTGGGGCGGGGG + Intronic
1003075853 6:2983151-2983173 TGAGACGGGGGTTGGGGCGGGGG - Intergenic
1003567005 6:7230425-7230447 TGCGGCCGCGGCCTGGGCGGGGG + Exonic
1003624067 6:7726954-7726976 GGATGCCGGGGCTGGGGCGGAGG + Exonic
1003967211 6:11264198-11264220 TGAGCCCAGGGGCTGGGCAGTGG + Intronic
1005040688 6:21596738-21596760 GGAGCTAGGGGCGGGGGCGGAGG + Exonic
1005959828 6:30686930-30686952 TGAGAGCGGGGACGGGGCGCAGG - Exonic
1005963157 6:30707656-30707678 AGAGCCTGGGGTGGGGGCGGGGG - Exonic
1006052702 6:31356441-31356463 TGACCGCGGGGCCGGGGCCAGGG - Exonic
1006106544 6:31720262-31720284 TGAGCTGGGGGCAGGGGTGGAGG + Intronic
1006300735 6:33192511-33192533 GGAGGCGGGGGCCGGGCCGGGGG - Intergenic
1006558470 6:34889201-34889223 TGAGCTAGGGGGCGGGGCGCGGG + Intergenic
1006628940 6:35417609-35417631 TGAACCCGGGGGCAGGGGGGCGG - Intronic
1006776239 6:36594599-36594621 TCAGCACGGGGCGGTGGCGGGGG + Intronic
1006983601 6:38163822-38163844 TGAGCCTGGGGCAGGGGTTGGGG - Intergenic
1007209942 6:40185309-40185331 TGAGGCAGGGGCCGGGGTTGGGG + Intergenic
1007406642 6:41639367-41639389 TGTGCACAGGGCAGGGGCGGCGG - Intronic
1007421670 6:41723536-41723558 TGAGCCCGGCCCTGGGGCTGGGG - Intronic
1007444515 6:41895024-41895046 GGCGCCCGGGGCGGGGGCGGCGG - Intronic
1007479017 6:42137799-42137821 GGAGGCCGAGGCAGGGGCGGGGG + Intronic
1007581171 6:42960975-42960997 TGAGCCCAGGCCGGGGCCGGGGG + Intronic
1007591158 6:43021678-43021700 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
1007797624 6:44363223-44363245 TGAGCCTGGGGCTGGGGGGCTGG - Intronic
1009015139 6:57891264-57891286 CAACCCCGGGCCCGGGGCGGTGG - Intergenic
1009818162 6:68763777-68763799 TGAGGCCGGTGCGGTGGCGGTGG + Intronic
1010569573 6:77461981-77462003 TGAGCCCGGGGCTTGAGGGGAGG + Intergenic
1011226610 6:85114973-85114995 TGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1011416257 6:87122784-87122806 CGGGCCTGGGGCCGGCGCGGAGG + Intergenic
1012111803 6:95244450-95244472 TGAGCCCTGGGGAGGGGTGGGGG - Intergenic
1013117806 6:107115538-107115560 GCTGCCCGGGGCGGGGGCGGCGG + Intergenic
1013372667 6:109483543-109483565 TGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1013372671 6:109483549-109483571 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1013432056 6:110064158-110064180 TGAGCCCGGGGCCAGGTCTCAGG - Intergenic
1013792725 6:113855257-113855279 GGAGCACTGGGCCGGGGAGGGGG - Intergenic
1015402137 6:132798650-132798672 GGAGGCCGGGGGCGGGGCAGGGG + Intergenic
1016596994 6:145814503-145814525 TGAGGCCGCGGCCGGGACCGAGG - Intronic
1017497566 6:154995297-154995319 TGCGCGCGGGGCTGGGGCAGCGG + Intronic
1017671836 6:156777206-156777228 TGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1017671839 6:156777212-156777234 TAAGGCTGGGGCCGGGGCCGGGG - Intergenic
1017810706 6:157981731-157981753 GGAGCGCGGGGCCGGGCGGGAGG + Intergenic
1018046242 6:159969012-159969034 TGAGCGGGGGGCGGGGGTGGGGG + Intergenic
1018150285 6:160931182-160931204 GGGGCCCGGGGCGGGGGCGCGGG + Intergenic
1018849719 6:167578245-167578267 GGAGGCCAGGGCCGTGGCGGTGG + Intergenic
1018915344 6:168129425-168129447 GGCGGCCGGGGCCGGGGCTGGGG + Intergenic
1019111937 6:169724034-169724056 AGGGGGCGGGGCCGGGGCGGCGG - Exonic
1019151306 6:170007767-170007789 TGAGCCCGGGGGCGGCGCAGGGG + Intergenic
1019164296 6:170088034-170088056 TGAGCTCGGGGCCGGGGCAGCGG + Intergenic
1019279277 7:192182-192204 GGAGCGCGGGGCCGGGGCCCAGG - Intergenic
1019292137 7:256031-256053 TGAGTGCGGGGCCGGGGGGCTGG + Intronic
1019308230 7:346557-346579 TGAGCCCCGGGCGGCTGCGGTGG - Intergenic
1019308240 7:346591-346613 TGAGCCCCGGGCGGCGGCGGTGG - Intergenic
1019308260 7:346659-346681 TGAGCCCCGGGCGGCGGCGGTGG - Intergenic
1019308279 7:346726-346748 TGAGCCCCGGGCGGCGGCGGTGG - Intergenic
1019308290 7:346760-346782 TGAGCCCCGGGCGGCGGCAGTGG - Intergenic
1019308309 7:346828-346850 TGAGCCCCGGGTGGCGGCGGTGG - Intergenic
1019379120 7:712226-712248 TGAGGCCGGGTTTGGGGCGGGGG - Intronic
1019472599 7:1229573-1229595 GGAGTCCGGGTCCGGGTCGGGGG - Intergenic
1019472644 7:1229679-1229701 AGAGGCCGCGGCCCGGGCGGGGG + Intergenic
1019488600 7:1300759-1300781 TGAGCCCGGCAGCTGGGCGGGGG + Intergenic
1019562566 7:1665875-1665897 CGAGCGCGGGGCGGCGGCGGCGG - Intergenic
1019594939 7:1854154-1854176 AGAGCCTGGGGCGGGGGTGGAGG - Intronic
1019660730 7:2222682-2222704 GGAGCGGGAGGCCGGGGCGGAGG - Exonic
1019702334 7:2480067-2480089 TGTGGCCGGGGGCGGGGAGGGGG - Intergenic
1019828222 7:3301263-3301285 TCAGCGCCGGGCGGGGGCGGCGG + Intergenic
1020059750 7:5143577-5143599 TGAGGCTGGGGGCGGGGTGGGGG - Intergenic
1020123101 7:5516653-5516675 TGAGCCCTGGCCGGGTGCGGTGG - Intergenic
1020137377 7:5594577-5594599 TGGGCCCGGGGGCGGCGCGGGGG - Intronic
1020168221 7:5824170-5824192 TGAGGCTGGGGGCGGGGTGGGGG + Intergenic
1020254753 7:6496962-6496984 TGAGACCGGGGCAGGTGTGGGGG - Intergenic
1021221071 7:17975805-17975827 TGAACCCGGGGTGGGGGTGGGGG + Intergenic
1021719297 7:23490573-23490595 TGGGGCCGGGGCCGGGGTCGCGG + Intergenic
1022031115 7:26492600-26492622 TGAGCTCGGGGCAGGGGTGAGGG - Intergenic
1022715155 7:32891897-32891919 AGAGCGCGCGGCGGGGGCGGGGG - Exonic
1022830356 7:34059554-34059576 TGAGGCCGGGGCCTTGGCAGGGG - Intronic
1023714531 7:43029705-43029727 GGAGCCCAGGGCCGGTGCTGAGG + Intergenic
1023842276 7:44104322-44104344 GGGGCCCGGGGCGGGGGCGCCGG - Intergenic
1023873687 7:44275897-44275919 TGACCCTGGGGCAGGGGAGGGGG + Intronic
1023875516 7:44284330-44284352 TCTGCCCGAGGCCGGGCCGGTGG - Intronic
1024607404 7:51033914-51033936 GGAGCCCGGAGCCTGGGAGGAGG - Intronic
1025788381 7:64665509-64665531 TTAGCCCGGCGCGGTGGCGGGGG - Intergenic
1026415060 7:70170891-70170913 TGTGCCCCGGCCGGGGGCGGTGG - Intronic
1026846951 7:73703900-73703922 GGAGCCCGGGCCTGGGACGGAGG - Intronic
1026899173 7:74027705-74027727 TGGGCCCGGGGCCCAGCCGGAGG + Intergenic
1026968585 7:74454700-74454722 CCTCCCCGGGGCCGGGGCGGGGG - Intronic
1027233633 7:76285705-76285727 TGTGGCCGGGGCTGGGGCTGCGG - Exonic
1027774155 7:82443830-82443852 GGAGGCGGGGGCGGGGGCGGAGG + Intergenic
1029080697 7:97971998-97972020 TGAGCCCGGGCCGGGGGCTGCGG - Intergenic
1029270573 7:99374757-99374779 AGAGTCCGCGGCCGGGGCGCGGG + Exonic
1029438936 7:100576930-100576952 GGAGGCAGGGGCAGGGGCGGGGG + Exonic
1029460532 7:100691699-100691721 TGAGGGCAGGGCCAGGGCGGGGG - Intergenic
1029896458 7:103989562-103989584 GGAGCGCGGGACCGGGGCTGCGG + Intergenic
1030014035 7:105200495-105200517 TCAGCCCGGGGTGGCGGCGGGGG + Intronic
1030033217 7:105388202-105388224 TGAGCCGCGGGCCGAGGAGGCGG - Intronic
1030049108 7:105522304-105522326 TGGGCCGGGGGCGGGGCCGGCGG - Intergenic
1031604083 7:123748477-123748499 AGGGGCCGGGGCCGGGGCCGGGG + Intronic
1031833922 7:126659036-126659058 TGAACCTGGGGGCGGGGCGGGGG - Intronic
1032014533 7:128369594-128369616 GGAGGCCGAGGCCGGAGCGGGGG + Intergenic
1032020721 7:128405984-128406006 CGGGCCGGGGGCGGGGGCGGGGG + Intronic
1033095742 7:138429246-138429268 TGAACCTGGGGTGGGGGCGGAGG + Intergenic
1033477132 7:141702038-141702060 TGGGGCCGGGGCGGCGGCGGGGG - Exonic
1033477136 7:141702044-141702066 GGAGGCTGGGGCCGGGGCGGCGG - Exonic
1033543757 7:142381316-142381338 TGAGTCTGGGGTCGGGGAGGAGG - Intergenic
1033656737 7:143380539-143380561 GGAGGGCGGGGCCGAGGCGGCGG - Intergenic
1034162766 7:149005117-149005139 TGAGCCCGTGGCTGGGGCTGGGG - Intronic
1034347675 7:150397264-150397286 CCAGCCCGGGGCCCGGGCCGCGG + Exonic
1034494201 7:151410250-151410272 TGAGCCAAGGGCCGGGACGAGGG + Intronic
1034569546 7:151944296-151944318 TGGGCCCGGGGCTGGGGCTGTGG - Intergenic
1034979660 7:155467850-155467872 TTTGCCCGGGGCTGGGGCTGGGG - Intergenic
1035130863 7:156651909-156651931 GGAGCCCGGGGAGGGGCCGGGGG - Intronic
1035212335 7:157337340-157337362 TGGGGCCGGGGCCGGGGCTGGGG + Intronic
1035375453 7:158404432-158404454 TGACCCCGGGGCAGGCGCTGAGG + Intronic
1035747863 8:1974396-1974418 AGCGCGCGGGGCCAGGGCGGGGG + Intronic
1036184333 8:6611502-6611524 AGGGCCCGGGGCCGGGGAGCAGG + Intronic
1036404531 8:8442841-8442863 TGAGCCCAGGGCCGGTGCTTAGG + Intergenic
1036434777 8:8723320-8723342 CGAGCCCGGGGCATGGACGGCGG + Intergenic
1036803203 8:11808359-11808381 GGAGGCCGGGGGCGGGGCTGCGG + Intronic
1037620883 8:20562462-20562484 TGAGCCACGGGGCCGGGCGGGGG - Intergenic
1037803979 8:22049306-22049328 TCCCCGCGGGGCCGGGGCGGGGG + Intronic
1037901562 8:22692172-22692194 CGATCCCGGGGCCGGGGAGCTGG - Intronic
1038311687 8:26449968-26449990 GGCGCCCAGGGGCGGGGCGGCGG + Intronic
1038582755 8:28764337-28764359 TAAACCCGGGGAGGGGGCGGGGG - Intergenic
1038727677 8:30095659-30095681 CAAGCGCAGGGCCGGGGCGGGGG - Intronic
1039236419 8:35507340-35507362 AAAGCCCTGGGCCGGCGCGGTGG - Intronic
1039334893 8:36577943-36577965 TGAGCCTGGGGAGGGGGAGGGGG - Intergenic
1039887036 8:41660671-41660693 TGGGGCCGGGGCCTGGGCTGTGG - Intronic
1039903153 8:41767268-41767290 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1040386435 8:46917855-46917877 GGAGCAGGAGGCCGGGGCGGTGG + Intergenic
1040556025 8:48478174-48478196 TGAGCCGGGGGCAGAGGCTGAGG - Intergenic
1041068567 8:54104473-54104495 GGAGCCCACGGCGGGGGCGGGGG - Intergenic
1041107494 8:54457770-54457792 TGGGCGCGGGGCCGGGGGAGGGG + Intergenic
1042040031 8:64580721-64580743 TGACTCCGGGGCCGAGGCGGCGG + Exonic
1042611747 8:70608017-70608039 GGAGCCCGGGCCCGGGCTGGAGG + Intronic
1042791972 8:72617794-72617816 TGGGGCCGGGGCCGGCGGGGAGG - Intronic
1042916183 8:73878387-73878409 TGTTGCCGGGGCAGGGGCGGCGG - Intronic
1043053360 8:75407978-75408000 CCAGCCCGGGCCCCGGGCGGCGG - Intronic
1043226178 8:77733974-77733996 GGAGCCCGGGGGTGGGGCTGGGG - Intergenic
1043296129 8:78665984-78666006 TGGGGGCGGGGCCGCGGCGGAGG - Intergenic
1044591297 8:93916811-93916833 TGCGGCCGGGGGTGGGGCGGGGG - Intronic
1045432052 8:102123816-102123838 GGGGGCCGGGGCCGGGGCCGGGG - Intronic
1046713390 8:117539648-117539670 AGGGCCTGGGGCCGGGGCTGGGG + Intronic
1047124788 8:121948357-121948379 GGAGCCCATGGCGGGGGCGGGGG - Intergenic
1047274634 8:123396295-123396317 GGAGCCCGTGGCCGAGGCCGCGG + Exonic
1047277483 8:123416816-123416838 TGGGCCAGGGCCCGGGCCGGAGG - Exonic
1047393727 8:124475037-124475059 AGGGCCCGGGGCCGCGGCCGGGG - Exonic
1048736222 8:137504901-137504923 TGAGGCTGGGGCAGGCGCGGTGG - Intergenic
1049168414 8:141141444-141141466 TGAGCCGGGGGACCGGGCGCTGG + Intronic
1049194634 8:141308502-141308524 TGCGCGCGGGGGCGGGGCAGGGG - Intergenic
1049194679 8:141308605-141308627 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1049194683 8:141308611-141308633 AGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1049238597 8:141525247-141525269 CAAGGCTGGGGCCGGGGCGGCGG + Intergenic
1049419647 8:142511075-142511097 TGAGACCCCGGCCGGGCCGGCGG + Intronic
1049462787 8:142737806-142737828 TGAGCCCTGGAGCAGGGCGGGGG + Intergenic
1049519405 8:143080475-143080497 ATAGCCCGAGGCCGGGGAGGAGG - Exonic
1049531930 8:143159398-143159420 AGAGCCCAGTGCCGGGGCAGAGG + Intronic
1049532018 8:143159657-143159679 TGGGCCTGGGGGCGGCGCGGGGG + Exonic
1049645334 8:143733519-143733541 CGTGCGCGGGGCCGGGGTGGCGG - Intronic
1049693685 8:143973576-143973598 TGGGTGCGGGGGCGGGGCGGGGG - Intronic
1049717694 8:144100687-144100709 GGGGGCCGGGGCCGGGGCCGGGG - Intronic
1051629555 9:19128898-19128920 TGTGTCGGGGGCCGGGGGGGGGG - Intronic
1052362247 9:27573525-27573547 AGGGGCCGGGGCCGGGGCCGGGG - Intronic
1053163489 9:35829322-35829344 CGGGCCCGGGGCGGGGGCCGGGG - Intronic
1053163536 9:35829433-35829455 TGGGCCATGGCCCGGGGCGGGGG - Intronic
1053167299 9:35853733-35853755 GGAGCCCGGGCCCGGGGCTGTGG + Exonic
1053789229 9:41674678-41674700 TGTGCCTGGGGCAGGGGTGGTGG + Intergenic
1054155911 9:61640085-61640107 TGTGCCTGGGGCAGGGGTGGTGG - Intergenic
1054177510 9:61886031-61886053 TGTGCCTGGGGCAGGGGTGGTGG + Intergenic
1054475682 9:65571085-65571107 TGTGCCTGGGGCAGGGGTGGTGG - Intergenic
1054660021 9:67694777-67694799 TGTGCCTGGGGCAGGGGTGGTGG - Intergenic
1054835653 9:69672549-69672571 CGAGCCCGCGGCGGCGGCGGCGG + Intergenic
1055730817 9:79277869-79277891 AGGGCACGGGGCCGGGGAGGGGG + Intergenic
1055785201 9:79863729-79863751 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1055785206 9:79863735-79863757 GCAGCCCGGGGCCGGGGCCGGGG - Intergenic
1055993301 9:82130880-82130902 TGGGGCCGAGGCCGGGGCCGAGG + Intergenic
1056382589 9:86068523-86068545 TGAGACCTGGGCAGGGGCAGGGG - Intronic
1056647726 9:88429443-88429465 TGAGCCCAGGGACAGGGCTGTGG - Intronic
1056787821 9:89605356-89605378 TGTGCCGGTGGCCGGGGCTGGGG + Intronic
1057432234 9:95004949-95004971 CGGGCGCGGGGCCTGGGCGGCGG - Intronic
1057501618 9:95601100-95601122 TGAGCCCAGGGCCCGGCCTGCGG - Intergenic
1057592325 9:96383453-96383475 TGAGGCGGGGCCCGGGGCCGGGG - Intronic
1057600337 9:96451116-96451138 TGACGTCGGGGCCCGGGCGGGGG + Intronic
1057747626 9:97764404-97764426 TGAGCACGGGCCGGGGGCGGGGG - Intergenic
1057758090 9:97853124-97853146 TGCGCCCGGGCCCCGGGGGGCGG + Intergenic
1057881531 9:98796305-98796327 CGGGCCCGGGGCCGCAGCGGCGG - Exonic
1058923446 9:109640052-109640074 TTACCGCGGGGCCGGGGCCGTGG + Intergenic
1058967280 9:110049381-110049403 TGGGGCCGGGACCGGGGCCGGGG - Intronic
1059769779 9:117414618-117414640 AGAGCCCGGGGACGCGGCGGCGG + Exonic
1059769858 9:117414890-117414912 GGAGCCCCGAGCCGGGGCCGGGG + Exonic
1060283482 9:122228860-122228882 TGAGGCCGGGCCCGGGGCGGCGG - Intronic
1060283491 9:122228884-122228906 TGCGCGCGGGCCGGGGGCGGGGG - Intronic
1060514626 9:124258096-124258118 TGGGGCTGGGGCCGGGCCGGTGG + Intronic
1060584475 9:124777442-124777464 GGAGCCCGGGGCCAGGGCGGAGG + Intronic
1060596460 9:124851984-124852006 TGTGCCCAGGGCCGGGGCATGGG + Intergenic
1060929541 9:127480067-127480089 GAAGCCCGGGGCAGGGGCAGAGG - Intronic
1060931179 9:127490444-127490466 TTAGCCCTGGGCAGGGGTGGGGG - Intronic
1061000423 9:127899438-127899460 GGAGGCGGGGGCTGGGGCGGAGG - Intronic
1061208432 9:129177360-129177382 GGAGGCGGGGGCCGGGGAGGCGG + Exonic
1061275895 9:129569211-129569233 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1061275899 9:129569217-129569239 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1061293708 9:129666157-129666179 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061293712 9:129666163-129666185 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061293715 9:129666169-129666191 CGGGGCCGGGGCCGGGGCGCGGG + Intronic
1061415884 9:130446548-130446570 TGAGCGCCTGGCCGGTGCGGGGG + Intronic
1061443980 9:130627201-130627223 TGAGACCAGGGCCGAGGCTGTGG + Intronic
1061546882 9:131309596-131309618 TTAGCCAGGAGTCGGGGCGGAGG - Intergenic
1061557092 9:131377598-131377620 GGAGCCCAGGGCTGGGGTGGGGG - Intergenic
1061559649 9:131394270-131394292 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061559652 9:131394276-131394298 CGGGGCCGGGGCCGGGGCGTGGG + Intronic
1061570553 9:131475316-131475338 CAGGCCCGGGGCCGGGGCCGTGG + Exonic
1061671786 9:132192918-132192940 TGCTTCCCGGGCCGGGGCGGGGG + Intronic
1061780096 9:132990785-132990807 TGAACCCGGGGGCAGGGCAGGGG + Intronic
1061799410 9:133105814-133105836 TGGGGCGGGGGCTGGGGCGGCGG - Intronic
1061799415 9:133105826-133105848 TGGGGCGGGGGCTGGGGCGGGGG - Intronic
1061799422 9:133105838-133105860 TGGGGCGGGGGCTGGGGCGGGGG - Intronic
1061799439 9:133105868-133105890 TGGGGCGGGGGCTGGGGCGGGGG - Intronic
1061799446 9:133105880-133105902 TGGGGCGGGGGCTGGGGCGGGGG - Intronic
1061799453 9:133105892-133105914 TGGGGCGGGGGCTGGGGCGGGGG - Intronic
1061962061 9:133993290-133993312 TGGGCCCCCGGCCAGGGCGGAGG - Intergenic
1061989926 9:134153316-134153338 TGAGCCCAGGGTGGGGACGGAGG + Intronic
1062024360 9:134333431-134333453 TGTACCCGGGGCCAGGGCTGGGG + Intronic
1062044280 9:134417924-134417946 AGAGCCCGGGACCAGGGCTGCGG - Intronic
1062327472 9:136019144-136019166 TGAGCTGGGGGCCGGGGAGGTGG - Intronic
1062341207 9:136094744-136094766 CTGGCCCGGGGCCAGGGCGGAGG - Intronic
1062385307 9:136307011-136307033 TCACCCTGGGGCTGGGGCGGGGG + Intergenic
1062389344 9:136327775-136327797 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1062414279 9:136439867-136439889 TGTGGGCGGGGCCGGGGCGCGGG - Intergenic
1062444508 9:136587975-136587997 GGAGGCGGGGGCGGGGGCGGGGG + Intergenic
1062467236 9:136686780-136686802 GGAAACCGAGGCCGGGGCGGCGG - Intronic
1062467287 9:136686927-136686949 GACGCCCGGGGCCAGGGCGGGGG + Intronic
1062494889 9:136827017-136827039 TGTGCCCGGGGCTGGTGTGGAGG + Intronic
1062535093 9:137017940-137017962 GGCGCCCGGGGCTGGGGCTGGGG - Intronic
1062559604 9:137135353-137135375 GGAGGCCGGGGGCGGGGGGGGGG + Intergenic
1062575534 9:137205577-137205599 TGAGTCCCGGGTCGGGGCCGGGG - Exonic
1062591897 9:137278104-137278126 TGAGCCTGGGGACGGGGCCCGGG + Intronic
1062653187 9:137589063-137589085 TGAGGGAGGGGCCGGGGCTGAGG + Intronic
1062696338 9:137877985-137878007 GGAGAGCGGGCCCGGGGCGGCGG + Exonic
1185504182 X:619593-619615 GGAGCCTGGGGCAGGGGTGGGGG + Intergenic
1186445637 X:9625857-9625879 TGAACCCGGCGGGGGGGCGGAGG + Intronic
1186466239 X:9786354-9786376 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1186466243 X:9786360-9786382 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1187419610 X:19122709-19122731 GGAGCTCGGGGCAGGGGCAGGGG + Intergenic
1188141596 X:26558101-26558123 AGAGCCTGGGGCCTGGGCAGGGG - Intergenic
1189226254 X:39415660-39415682 TGAGCCCTGAGCCTGGGAGGTGG + Intergenic
1189294473 X:39908986-39909008 TGATCCCAGGGCGGGGGTGGGGG - Intergenic
1189310628 X:40014935-40014957 GGAGCGCGGGGCGGGGGCGGGGG - Intergenic
1189325691 X:40109506-40109528 GCCGCCCGGGGCCGGGGCCGAGG - Intronic
1190385629 X:49879954-49879976 CGGGGCCGGGGCCGGGGCGGGGG - Exonic
1190714805 X:53094240-53094262 TGCGCGCGCGGCAGGGGCGGCGG + Intergenic
1190783993 X:53625858-53625880 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1190984458 X:55488602-55488624 CGGGCCCGGGGCTGGGGCCGAGG + Exonic
1191253376 X:58269691-58269713 TGGGCCCGGGGTGGGGGCGGGGG - Intergenic
1192082718 X:68063865-68063887 TGGGCCAGGGGCCGGGGAGCTGG + Exonic
1192152007 X:68718371-68718393 TGGGGCCGGGGCCGGGGCTGGGG - Exonic
1192203666 X:69082580-69082602 TGAGGCTGGGGCTGGGGCTGGGG - Intergenic
1192473716 X:71420897-71420919 TGTGCCTGGGGCCGGTGGGGAGG - Intronic
1193420139 X:81272784-81272806 TGAGCCTGGGCCAGGAGCGGTGG - Intronic
1195095084 X:101494016-101494038 TGAGGCTGGGGCTGGGGCTGAGG + Exonic
1195095091 X:101494034-101494056 TGAGGCTGGGGCTGGGGCTGAGG + Exonic
1195095100 X:101494052-101494074 TGAGGCTGGGGCTGGGGCTGGGG + Exonic
1195095114 X:101494088-101494110 TGAGGCTGGGGCTGGGGCTGGGG + Exonic
1196031072 X:111096306-111096328 TGGGCCCGGGGCTGCGGCTGCGG + Intronic
1196151543 X:112380437-112380459 TGATCCCGGGCCAGGTGCGGTGG - Intergenic
1196707340 X:118727684-118727706 TGCGCCGGCGGCGGGGGCGGGGG + Exonic
1198184091 X:134237219-134237241 TCAGCCCGGAGCCGGCCCGGCGG + Exonic
1198398872 X:136251101-136251123 TGGGACAGGGGCGGGGGCGGGGG - Intronic
1198534498 X:137573745-137573767 CTTGGCCGGGGCCGGGGCGGAGG + Intronic
1198636886 X:138711249-138711271 CGATCCCGGGCCCGGGGCTGTGG - Exonic
1198748817 X:139918540-139918562 TGAACCCGGGGCGGGGGTGGGGG + Intronic
1200047697 X:153411456-153411478 AGCGGGCGGGGCCGGGGCGGCGG - Intergenic
1200058741 X:153474701-153474723 AGAGGCGGGGGCGGGGGCGGGGG + Intronic
1200100788 X:153688424-153688446 CGGGCCGGGGGACGGGGCGGCGG - Exonic
1200107683 X:153724133-153724155 TGGTCTCGGGGGCGGGGCGGGGG - Intronic
1200209645 X:154341585-154341607 AGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200209649 X:154341591-154341613 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200209653 X:154341597-154341619 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200209657 X:154341603-154341625 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200215526 X:154366538-154366560 TGAGCCCTTGGCCAGGGGGGAGG - Intronic
1200221195 X:154390489-154390511 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221199 X:154390495-154390517 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221203 X:154390501-154390523 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221207 X:154390507-154390529 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221211 X:154390513-154390535 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221215 X:154390519-154390541 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221219 X:154390525-154390547 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221223 X:154390531-154390553 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221227 X:154390537-154390559 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221231 X:154390543-154390565 AGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200239611 X:154486750-154486772 TGGGCCGGGGGGCGGGGCCGGGG - Intergenic