ID: 929966912

View in Genome Browser
Species Human (GRCh38)
Location 2:46542992-46543014
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2251
Summary {0: 3, 1: 2, 2: 40, 3: 292, 4: 1914}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929966894_929966912 4 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966912 2:46542992-46543014 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914
929966896_929966912 2 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966912 2:46542992-46543014 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914
929966895_929966912 3 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966912 2:46542992-46543014 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914
929966897_929966912 1 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966912 2:46542992-46543014 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914
929966898_929966912 0 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966912 2:46542992-46543014 GGGGCCGGGGCGGGGGCTCCGGG 0: 3
1: 2
2: 40
3: 292
4: 1914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr