ID: 929966920

View in Genome Browser
Species Human (GRCh38)
Location 2:46543013-46543035
Sequence GGGGGACCATGCCCGGAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 4, 1: 0, 2: 1, 3: 11, 4: 175}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929966916_929966920 -6 Left 929966916 2:46542996-46543018 CCGGGGCGGGGGCTCCGGGGGGA 0: 4
1: 1
2: 2
3: 57
4: 465
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966910_929966920 0 Left 929966910 2:46542990-46543012 CCGGGGCCGGGGCGGGGGCTCCG 0: 3
1: 2
2: 21
3: 140
4: 1078
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966896_929966920 23 Left 929966896 2:46542967-46542989 CCCCAGGCGGGCTGGGGCTGAGC 0: 2
1: 1
2: 1
3: 50
4: 346
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966894_929966920 25 Left 929966894 2:46542965-46542987 CCCCCCAGGCGGGCTGGGGCTGA 0: 1
1: 1
2: 3
3: 29
4: 272
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966895_929966920 24 Left 929966895 2:46542966-46542988 CCCCCAGGCGGGCTGGGGCTGAG 0: 1
1: 2
2: 1
3: 40
4: 384
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966909_929966920 1 Left 929966909 2:46542989-46543011 CCCGGGGCCGGGGCGGGGGCTCC 0: 3
1: 2
2: 15
3: 145
4: 999
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966897_929966920 22 Left 929966897 2:46542968-46542990 CCCAGGCGGGCTGGGGCTGAGCC 0: 2
1: 1
2: 2
3: 36
4: 337
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175
929966898_929966920 21 Left 929966898 2:46542969-46542991 CCAGGCGGGCTGGGGCTGAGCCC 0: 2
1: 2
2: 6
3: 47
4: 397
Right 929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG 0: 4
1: 0
2: 1
3: 11
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929966920 Original CRISPR GGGGGACCATGCCCGGAGGC CGG Exonic
900408856 1:2503990-2504012 GGGGGACCAGGGCCTGGGGCGGG - Exonic
900438808 1:2643400-2643422 GGGTCACCGAGCCCGGAGGCGGG - Intronic
900651550 1:3732473-3732495 GGAGGGCCCTGCCCTGAGGCTGG + Intronic
901772946 1:11539947-11539969 GGGTGACCCTGGCCAGAGGCCGG - Intergenic
901798521 1:11693905-11693927 AGGGGACAATGCTGGGAGGCAGG - Intronic
902799622 1:18821158-18821180 GGGGAAACAGGCCCAGAGGCAGG + Intergenic
904038512 1:27571363-27571385 GGGAGACCAGGCACAGAGGCAGG + Intronic
905684875 1:39901253-39901275 GGGGGACCAATCCCGGGGGCCGG + Exonic
905972801 1:42154190-42154212 AGGAGACCATGCCCAGAGTCAGG - Intronic
906033011 1:42735265-42735287 TGGGGCCCATTCCCGGGGGCAGG + Intronic
906490384 1:46263698-46263720 GGGGGACTATGCCAGGAGCCAGG + Intronic
906531235 1:46525279-46525301 GCTGGCCCAGGCCCGGAGGCAGG + Intergenic
907263304 1:53238310-53238332 CGGGGACCAGGCCTGGGGGCCGG - Intronic
914137815 1:144917399-144917421 GGGGGAGATGGCCCGGAGGCAGG - Intronic
919957989 1:202438432-202438454 GTGGGACCCTGGCAGGAGGCGGG - Intronic
920487139 1:206381346-206381368 GGGGGAGATGGCCCGGAGGCAGG + Intronic
922110218 1:222548560-222548582 GAGGGGCCATGGCAGGAGGCAGG + Intergenic
922703483 1:227776013-227776035 GGGGGACCATGGCCATAAGCTGG + Intronic
923002959 1:230022828-230022850 AGGACACCATGCCCTGAGGCAGG + Intergenic
923291779 1:232552873-232552895 GGGGGAGCATGCACACAGGCAGG + Intronic
923555824 1:234999747-234999769 GGGGCACCAGGCTCGGAGTCAGG - Intergenic
1065695571 10:28376662-28376684 AGGGGACCAAGCCAGGAAGCAGG + Intergenic
1069828032 10:71266193-71266215 GGGGAACCAGGCTCAGAGGCAGG + Intronic
1069856878 10:71446132-71446154 GGGGGACAATGCCAGTAGGTCGG - Intronic
1070198054 10:74176981-74177003 GGGGGACCAGAGGCGGAGGCAGG - Intronic
1070768474 10:79069445-79069467 GGGGGCCGAGGCCCGGCGGCCGG + Intronic
1071220975 10:83464151-83464173 GGAGGGCCATGCCCTGAGGGAGG - Intergenic
1074867459 10:117553328-117553350 GGGGGACCGCGCCCGAAAGCCGG + Intergenic
1076886669 10:133266224-133266246 GGGGGACCATGGCTGGAGAAGGG + Intronic
1077093761 11:790836-790858 GGGGCCTTATGCCCGGAGGCGGG + Exonic
1077184644 11:1230709-1230731 GGGGGACCTGGCCTGGGGGCTGG - Intronic
1077443043 11:2577673-2577695 GGGGGAACAAGCCAGCAGGCTGG - Intronic
1077445830 11:2590395-2590417 GGGGGACCACGCCCTGGGACGGG - Intronic
1077976356 11:7252179-7252201 GGGGGGCGATGCCCGGGGCCAGG + Exonic
1079295527 11:19229852-19229874 GGGGAACCATTCCCAGGGGCTGG + Exonic
1083176145 11:60951552-60951574 GGGGGGCCCAGCCCGGAGCCAGG - Exonic
1083305564 11:61760456-61760478 TGGGGCCGAGGCCCGGAGGCTGG + Intronic
1083899764 11:65638052-65638074 GCGGGGCCATGCCGGGAGGCGGG - Intronic
1083899771 11:65638070-65638092 GCGGGGCCATGCTGGGAGGCGGG - Intronic
1083988667 11:66233283-66233305 GGGGGTCCAGGCAGGGAGGCAGG - Intronic
1084710456 11:70840724-70840746 GGGGGGCCATATCGGGAGGCTGG + Intronic
1090075748 11:123579087-123579109 GGGTGCCCATGCCTGGAGGTTGG + Intronic
1091310837 11:134574179-134574201 GGGGGGCCATGGCGAGAGGCAGG - Intergenic
1091723616 12:2830782-2830804 GGGGGAGCCTCCCCGGATGCAGG - Exonic
1092472123 12:8789531-8789553 GGAGGGCCATGCCCTGAGGGAGG - Intergenic
1096495521 12:52037337-52037359 GGGCGCCCATGCCTGGAGGCCGG - Intronic
1097113831 12:56682454-56682476 GGGGGACCAAGGCAGGAGGATGG + Intronic
1101035266 12:100699478-100699500 GGTGGACAAAGCCCTGAGGCAGG + Intergenic
1101558944 12:105837666-105837688 GGAAGACCATGCCAGGATGCGGG - Intergenic
1102482304 12:113232298-113232320 GGGGGCCCCTGCCAGGGGGCAGG - Intronic
1103560037 12:121788808-121788830 GGGGGGCAGTGCCGGGAGGCAGG + Intronic
1110721980 13:78772250-78772272 GGGGGACCATTCCCAGAGATGGG + Intergenic
1115528590 14:34305372-34305394 AGGGGACACAGCCCGGAGGCTGG + Intronic
1116817927 14:49599957-49599979 GGGGGACCATGCCCGGAGGCCGG + Intronic
1117105373 14:52393002-52393024 GGTGGCTCATGCCTGGAGGCTGG - Intergenic
1118493870 14:66288626-66288648 GAGGAAGCATGCCCTGAGGCAGG + Intergenic
1123438054 15:20270109-20270131 GAGATACCGTGCCCGGAGGCTGG - Intergenic
1123739758 15:23225743-23225765 GGGGGACCCCGCCCGGATCCAGG - Intergenic
1124290983 15:28454716-28454738 GGGGGACCCCGCCCGGATCCAGG - Intergenic
1125834233 15:42736424-42736446 GGGAGAGCCTGCCCGGAGCCGGG - Exonic
1128761709 15:70220688-70220710 GGGGGACCATGGCAGGAGGCAGG - Intergenic
1129466287 15:75725974-75725996 GGGAGATCTTGCCTGGAGGCAGG + Intronic
1132556263 16:574062-574084 TGAGCACCATGCCGGGAGGCTGG - Exonic
1133424305 16:5674411-5674433 GGGGTAACATGCCCGGGCGCAGG + Intergenic
1137583936 16:49652526-49652548 GGAGGTCCACGCCAGGAGGCTGG - Intronic
1141166014 16:81661604-81661626 GGGTGACCGTGGCAGGAGGCAGG - Intronic
1141452805 16:84116957-84116979 GCGGGACCACGCCGGGAGGATGG + Intergenic
1141891337 16:86928692-86928714 GGGGAATCCTGCCTGGAGGCAGG + Intergenic
1142156427 16:88534622-88534644 GGGGGTCGAGGCCCGGACGCCGG + Exonic
1142638194 17:1270633-1270655 GGGGGCCCCTGCCCCGAGCCCGG + Exonic
1142685729 17:1575948-1575970 GGGGGCCCAGGCCCTGAGGGTGG - Intronic
1143031871 17:3972527-3972549 GGGGGCTCAGGCCCAGAGGCGGG - Intergenic
1144675452 17:17158702-17158724 GCGGGAGCGTGCACGGAGGCGGG + Exonic
1147260244 17:39205928-39205950 GGGGGGCCAGGCACAGAGGCGGG - Intergenic
1150134612 17:62689018-62689040 CTGGGACCATGCCAGGAGGAAGG + Intronic
1150234425 17:63581442-63581464 GAGGGACCATGGGAGGAGGCAGG + Intronic
1151879971 17:76888954-76888976 TTGGGACAGTGCCCGGAGGCTGG + Intronic
1157616606 18:48991145-48991167 GGGCCACCCTGCCCTGAGGCTGG + Intergenic
1159505304 18:69328183-69328205 GGGGGAGAATGCCAGGGGGCTGG - Intergenic
1159619907 18:70625108-70625130 GGGGGAACATGCTCAGAGACTGG + Intergenic
1160720877 19:596443-596465 GGGAGACCAGCTCCGGAGGCCGG - Intronic
1161059929 19:2209817-2209839 GGGGTACCAGGCTCTGAGGCCGG - Intronic
1161282895 19:3455230-3455252 GTGGGATCATGCCCAGAGCCTGG + Intronic
1161388228 19:4008018-4008040 GGGGGACCCTGCCTGAAGCCGGG - Intronic
1161473402 19:4472472-4472494 GGGGGCCCCGGGCCGGAGGCGGG + Intronic
1161511998 19:4677150-4677172 GGGGGATCAAGCCAAGAGGCAGG + Intronic
1161678576 19:5667362-5667384 GGGGGACCATGGCCGAAGAGAGG + Exonic
1161894345 19:7069317-7069339 GCGGTACCAGGCCTGGAGGCAGG - Intergenic
1161894372 19:7069400-7069422 GCGGTACCAGGCCTGGAGGCGGG - Intergenic
1162257032 19:9498819-9498841 CGGGGCCCATGCCCGGGGGCGGG + Intergenic
1163159170 19:15454610-15454632 GGGGGACCATGCTGGGAGTGTGG - Intronic
1163372346 19:16908427-16908449 AGGTGACCAGGCCTGGAGGCTGG - Intronic
1165034027 19:33020010-33020032 GAGAGACCATGCCCCGATGCTGG - Intronic
1165447812 19:35866294-35866316 GGGGGACCATGCCCAGGTGTGGG - Exonic
1166694469 19:44844852-44844874 GAGTGACCAGGTCCGGAGGCCGG + Intergenic
1167539001 19:50073542-50073564 GGAGGGCTATGCCTGGAGGCAGG + Intergenic
1167911941 19:52710919-52710941 GGGGGATTATGTCCTGAGGCAGG + Intronic
1168039664 19:53747989-53748011 GGGGGTGCATGCCTGGAGACAGG - Intergenic
926116495 2:10217108-10217130 GGGAGGCCCTGCCGGGAGGCAGG - Intergenic
926415626 2:12646814-12646836 GGGTGACCATGGCAGGAGGTGGG - Intergenic
927990221 2:27442328-27442350 GGGGGACCCGGGACGGAGGCGGG + Intergenic
929966920 2:46543013-46543035 GGGGGACCATGCCCGGAGGCCGG + Exonic
930030686 2:47056483-47056505 GGAGGGCCTTGCCCGCAGGCTGG - Intronic
932201232 2:69829967-69829989 GGGGGGCTCGGCCCGGAGGCCGG + Exonic
932703886 2:74008918-74008940 GGGGAAAAATGCCTGGAGGCGGG - Intronic
932770713 2:74499459-74499481 GGGGGACCATGCGCGGGGCTAGG + Exonic
934863154 2:97781128-97781150 GGGGGTCCATGCCGGGAGCCTGG - Intronic
936732113 2:115395239-115395261 GGGTGCACATGCACGGAGGCAGG - Intronic
938221102 2:129568679-129568701 GGAGAACCATTCCCAGAGGCAGG + Intergenic
938301043 2:130213502-130213524 GGGGGACCATGCCCGGAGGCCGG - Intergenic
938455677 2:131460965-131460987 GGGGGACCATGCCCGGAGGCCGG + Intergenic
938817520 2:134919057-134919079 GGGGCACCAGGCCCGGCGACCGG - Intronic
940861103 2:158771548-158771570 GGAGAACCATGCTCGGAGGCTGG + Intergenic
941243237 2:163068002-163068024 GGAGGGCCATGCCCTGAGGGAGG - Intergenic
942047389 2:172107824-172107846 GGAGGACAGTGCCTGGAGGCAGG - Intergenic
947912250 2:233809125-233809147 GAAGGACCATCCCTGGAGGCGGG + Exonic
948284288 2:236771912-236771934 GGGGCACCATGCCTGGAGGTGGG + Intergenic
948383248 2:237565235-237565257 GGGGGACCATGCAGAGAGCCAGG + Intergenic
948822730 2:240558080-240558102 GGGCGGGCACGCCCGGAGGCGGG - Intronic
1169065040 20:2690363-2690385 TAGGGACCCTCCCCGGAGGCAGG + Intergenic
1175764157 20:61581521-61581543 GAGGGACCATCCCAGGAGGAGGG - Intronic
1175985964 20:62764326-62764348 GGGGGACCATGCCCTTAGGGTGG - Intergenic
1180034352 21:45236104-45236126 GGGAGAGCCTGCCCTGAGGCAGG - Intergenic
1181333703 22:22114723-22114745 AGGGGACCCTGCCCCGAGCCGGG - Intergenic
1181746066 22:24955683-24955705 GGAGGGTCATGCCAGGAGGCTGG + Intronic
1181850091 22:25743699-25743721 AGGTGACCAGGCCTGGAGGCAGG - Intronic
1184315925 22:43689210-43689232 GGGGGCGCAGGGCCGGAGGCAGG + Intronic
1184386921 22:44181797-44181819 CGGGGACCAGGCCGGGAGGCAGG - Exonic
1184746045 22:46456877-46456899 TGGGGACCATGACCTGGGGCGGG + Intronic
1184782003 22:46654274-46654296 GCGGGTCCATGCCCCAAGGCAGG - Intronic
1184790244 22:46695708-46695730 TGGGGGCCAAGCCCTGAGGCAGG - Intronic
950147855 3:10664564-10664586 GTGGGGCCATGCCAGGAGGAGGG - Intronic
950448992 3:13055090-13055112 GGGGCCCCAAGCCCGCAGGCAGG - Intronic
950614086 3:14145800-14145822 GAGGCAGCATGCACGGAGGCGGG - Exonic
953033309 3:39191715-39191737 GGGGGACCATCCTGAGAGGCTGG - Intronic
953626899 3:44579267-44579289 GCGGGAGCGTGCACGGAGGCGGG - Intronic
964402802 3:156316702-156316724 GAGGGCCCCTGCCAGGAGGCAGG + Intronic
968134983 3:196214799-196214821 GGGAGGCCCTGCCTGGAGGCCGG - Intronic
968663792 4:1810014-1810036 GGGGGACCAGGCCAACAGGCAGG + Intergenic
969113913 4:4859842-4859864 CGGAGCCCATGCCCGGCGGCTGG + Exonic
969487488 4:7480469-7480491 GGGAGACCATGCTCTGAAGCTGG + Intronic
969967832 4:11014930-11014952 GGGGCACCATGCCCCAAGGTGGG + Intergenic
976402579 4:84623938-84623960 TGGGGAGCATGCCAGGAGCCAGG + Intronic
977518826 4:98055910-98055932 GGTGGACCATGCCCGAACACTGG + Intronic
978496121 4:109360865-109360887 GAGCCACCATGCCCGGAGGCTGG + Intergenic
981952226 4:150423149-150423171 GAGGGACCCTGCCCCGAGGTTGG - Intronic
982097430 4:151935600-151935622 GGGGGCCCTTGCAGGGAGGCAGG + Intergenic
984908170 4:184649075-184649097 GGGAGACCTGGCCCGGGGGCGGG - Intronic
986173400 5:5331981-5332003 TGAGAACCATGCCCAGAGGCTGG - Intergenic
988809744 5:34772689-34772711 TAGGGAGCATGCCAGGAGGCTGG - Intronic
991771215 5:70042641-70042663 TGGGGGCCTTGCCCGGAAGCTGG + Exonic
991850507 5:70918058-70918080 TGGGGGCCTTGCCCGGAAGCTGG + Exonic
997243699 5:132328163-132328185 GGTGGCCCATGGCTGGAGGCAGG + Intronic
1000085031 5:157881282-157881304 GGAGGGCCATGCCCTGAGGGAGG - Intergenic
1002447121 5:179296455-179296477 TGGGGCCCCTGCTCGGAGGCAGG + Intronic
1007425241 6:41742245-41742267 GGGGGAGCATCCCGGGAGGTGGG + Intronic
1007808981 6:44473056-44473078 GGGGGCCAATCCCCCGAGGCCGG + Intergenic
1012249822 6:96967846-96967868 AGGGGGGCATGCCCTGAGGCAGG + Intronic
1018834850 6:167474960-167474982 GGAGAACCCTGCCCAGAGGCAGG + Intergenic
1018845328 6:167551782-167551804 AGGGGAGCGTGCCCGGGGGCTGG - Intergenic
1020001600 7:4759296-4759318 GGGGGAGCCTGCACGGAGGGCGG - Exonic
1020023549 7:4883374-4883396 GGGGGGCGGTACCCGGAGGCCGG - Intronic
1029626399 7:101722692-101722714 GGGCAACCCTGCCCAGAGGCAGG + Intergenic
1032174416 7:129611933-129611955 GGGGGCCCAGGCCCAGAGCCGGG - Intronic
1034089399 7:148350044-148350066 GGGAGACCATGAGTGGAGGCAGG + Intronic
1035205445 7:157291468-157291490 GGGGGGCCTTGGCCGGAAGCTGG + Intergenic
1036771719 8:11583061-11583083 AGGGGACCACTCCTGGAGGCAGG + Intergenic
1037614692 8:20508142-20508164 TGGGGAGCATGCCAGGAGTCAGG + Intergenic
1041460689 8:58108571-58108593 AGGAGACCAGGCCAGGAGGCTGG - Intronic
1042940216 8:74099786-74099808 GGGTGGCCATTCCCAGAGGCTGG - Intergenic
1045405964 8:101867110-101867132 GGGAGACCATGCCAGGACGAGGG - Intronic
1049697910 8:143992618-143992640 GGGTGACCTTGGCCGGGGGCGGG + Intronic
1051896326 9:21993685-21993707 GGGTGACCCCGCCGGGAGGCTGG + Intronic
1055981009 9:82000569-82000591 AGGGGACCATGACCTAAGGCAGG + Intergenic
1056725317 9:89109295-89109317 TGGGCACCATGACCGGAGGAGGG - Intronic
1057042477 9:91857639-91857661 GGGGTGGCAAGCCCGGAGGCAGG + Intronic
1057889371 9:98856993-98857015 GTGGAACCATGCCCAGAGGAAGG - Intergenic
1060528421 9:124333436-124333458 TGGGGAACCTGCCGGGAGGCAGG + Intronic
1061275699 9:129568663-129568685 GAGGGACCAGGGCCGGGGGCGGG - Intergenic
1061391466 9:130319456-130319478 AGTCAACCATGCCCGGAGGCTGG - Intronic
1061843766 9:133375728-133375750 GGGAGACTGGGCCCGGAGGCCGG + Intronic
1062283304 9:135761625-135761647 GGCGGACCAGGGACGGAGGCTGG - Intronic
1062562106 9:137146273-137146295 GGGAGACCTTGCCCAGAGGGAGG - Intronic
1062640245 9:137515056-137515078 GAGGGACCATGCAGGGAGGGCGG + Intronic
1189299112 X:39939656-39939678 GAGGGACCATGCCTGCAGCCTGG + Intergenic
1195552600 X:106185750-106185772 GGAGGGCCATGCCCTGAGGGAGG + Intronic
1195713027 X:107790325-107790347 GGGGGAGCAGGCCAAGAGGCAGG - Intronic
1199832619 X:151560872-151560894 GGAGGGCCATGCCCTGAGGGAGG + Intergenic
1200118788 X:153780874-153780896 GGGGGCCTCTGCCCGGGGGCCGG + Intronic
1201416480 Y:13752903-13752925 GGGGGTCCATGCCACGGGGCAGG - Intergenic
1201892909 Y:18962222-18962244 GGTGGCCCATGCCTGTAGGCAGG + Intergenic