ID: 929968072

View in Genome Browser
Species Human (GRCh38)
Location 2:46550457-46550479
Sequence GGGCCTTAGTGATCACCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929968064_929968072 6 Left 929968064 2:46550428-46550450 CCATCAGTTTTGTCTTTACACAG 0: 1
1: 0
2: 2
3: 25
4: 283
Right 929968072 2:46550457-46550479 GGGCCTTAGTGATCACCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929968072 Original CRISPR GGGCCTTAGTGATCACCAGT GGG Intronic
901359749 1:8686937-8686959 AGGCCTTAGTGATCATCACAAGG + Intronic
901559269 1:10057204-10057226 GGTCCTTAGTTCTCACCAGCTGG + Intronic
904286930 1:29458966-29458988 GGCCCTGAGTGATCAGCAGAGGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
904886311 1:33741290-33741312 CAGCCTCAGTGATCATCAGTTGG + Intronic
906196133 1:43931870-43931892 CAGCCTTAGGGCTCACCAGTGGG - Intergenic
906203358 1:43974051-43974073 GGTACTTACTGATCACCATTTGG - Intergenic
913224603 1:116687759-116687781 GGGCCTTTGAGATCACTGGTGGG + Intergenic
913446820 1:118958993-118959015 AGGCCTTAGTGGTCATCAGAAGG + Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920710131 1:208287131-208287153 AGGCTTTAGTGATCTGCAGTGGG - Intergenic
922610396 1:226922726-226922748 GGGTCTTAGTGATTAACATTGGG - Intronic
1068693899 10:59945486-59945508 GGGGCTTGTTGGTCACCAGTTGG + Intergenic
1070282787 10:75062010-75062032 GGGCCTGAATGACCACCCGTGGG - Intergenic
1070573147 10:77656744-77656766 GGGCCTTAGAGGTCACAGGTGGG + Intergenic
1077435175 11:2535488-2535510 GGTCCTCAGTGATCAACACTGGG - Intronic
1082997300 11:59264237-59264259 GTGCCCTAGTGAACACCATTTGG + Intergenic
1088848160 11:113684683-113684705 GGGCCTTAATGAGGACCAGCTGG - Intergenic
1089196086 11:116694755-116694777 CTGCCTTAGTGATCACCCATGGG + Intergenic
1089604697 11:119635161-119635183 CGGCCTTAGTGAGCACCCTTGGG + Intronic
1091748691 12:3009583-3009605 GGGTCTAAGTCATCACCGGTGGG - Intronic
1098948801 12:76617650-76617672 GGGATTTAGTGGTAACCAGTTGG - Intergenic
1102484503 12:113246820-113246842 GGTCCGTAATGAGCACCAGTTGG + Intronic
1102570719 12:113825520-113825542 GGGCGTCAGTGATCGCCTGTGGG - Intronic
1104164977 12:126219276-126219298 GGGATTTATTGCTCACCAGTGGG - Intergenic
1105933073 13:25070467-25070489 TGGCCTTAGTTATCAACAATGGG - Intergenic
1106550784 13:30769147-30769169 GGGCCTGAGTGACCACCAATGGG - Intergenic
1109533148 13:63679838-63679860 TTGCCTTAGTCATCACCACTTGG + Intergenic
1114349041 14:21829678-21829700 GGGTCTCAGTGCTCACCTGTGGG + Intergenic
1114353283 14:21878365-21878387 AGGCCTCAGTGCTCACCTGTGGG + Intergenic
1114359106 14:21950258-21950280 GGGCCTCTGTGCTCACCTGTGGG + Intergenic
1120428048 14:84375829-84375851 GGGCCTTTGTGATGAGTAGTGGG - Intergenic
1121742255 14:96262413-96262435 GGGCCATTGTCATCTCCAGTTGG - Intronic
1134071615 16:11263659-11263681 GGGCCTGAGGGATCACCAAGGGG - Intronic
1135667550 16:24348742-24348764 TGGCATTAGTCATCACCAGTGGG + Intronic
1137468670 16:48734680-48734702 GGGCTATAGTGATGACTAGTAGG - Intergenic
1161627147 19:5333977-5333999 GGGCCCGAGTGATCACCAAAGGG - Intronic
929968072 2:46550457-46550479 GGGCCTTAGTGATCACCAGTGGG + Intronic
936113267 2:109682523-109682545 GGCCCTTAGGGATCAGCAGATGG + Intergenic
939695171 2:145314433-145314455 TGCCTTTAGTGATCACCAGTAGG - Intergenic
944430857 2:199631939-199631961 GGGCCTTAGGCATCACAAGTTGG - Intergenic
946101208 2:217325779-217325801 GGCACTCAGTGATCACCTGTGGG - Intronic
948158984 2:235808681-235808703 GGGCCTTGGTGATGACCTGCAGG - Intronic
1169760517 20:9087587-9087609 CAGGCTTAGTGATCAGCAGTAGG + Intronic
1172025482 20:31945547-31945569 GGGCCTTGGTAGCCACCAGTGGG - Exonic
1173300089 20:41794642-41794664 GGGCTTTTGTGATCACCTGGAGG + Intergenic
1175309837 20:58004042-58004064 GGGCCTTACTGCACAACAGTAGG - Intergenic
1179181698 21:39050899-39050921 GGGCCTCTGTGAGCATCAGTGGG + Intergenic
1180223556 21:46375677-46375699 GGGCCTGAGGGATCACATGTGGG + Intronic
1180733227 22:17997591-17997613 GGGCCTTAGGGATGACTAATGGG - Intronic
1183723882 22:39577925-39577947 GGGCCACAGTGACCCCCAGTTGG + Intronic
950482693 3:13254421-13254443 TAGCCTTCCTGATCACCAGTTGG - Intergenic
952867828 3:37867133-37867155 GTGGATTAGTGGTCACCAGTGGG - Intronic
953963124 3:47282157-47282179 GGGGCTTTGGGATCACCAGTCGG - Intronic
956865343 3:73363660-73363682 GAGCATTGGTGATCACCAGAAGG + Intergenic
960596833 3:119414725-119414747 GGGCCTTCAGGGTCACCAGTTGG + Exonic
963137400 3:141919593-141919615 GGAACTTAGTGACCATCAGTAGG + Intronic
967557536 3:190876661-190876683 GGCCCTGAGTGATCACGAGGTGG - Intronic
967665142 3:192162744-192162766 TGGCATTAGTGTCCACCAGTTGG + Intronic
968089324 3:195890269-195890291 GGGCCTTAGTGACATTCAGTGGG + Intronic
969496139 4:7527355-7527377 GGGCCTTTGTAATCACAAGGAGG + Intronic
971348899 4:25838733-25838755 GGGCCTCGGTGAACTCCAGTGGG - Intronic
977163575 4:93667421-93667443 TGGCCTTAGTGATAACCAGGAGG + Intronic
980156637 4:129115549-129115571 GTTCCTTAGTGGTCTCCAGTAGG + Exonic
981214090 4:142142918-142142940 GGCCCTTAGAGATCAACAGATGG + Intronic
986702125 5:10420603-10420625 AGGCCTTAGTGTTCTCCTGTTGG + Intronic
989203983 5:38793422-38793444 GGGCCTGTGTGATCACCACTGGG - Intergenic
992867716 5:80974414-80974436 GCGCCCTAGTGAACACCACTGGG + Intronic
1001750923 5:174130782-174130804 GGTCCATAGTGATCAGGAGTGGG - Intronic
1006639095 6:35479859-35479881 GGGCCTTAGTGGCCCCCAGATGG + Intronic
1007735854 6:43981778-43981800 GGGCCTGAGTGACCACCCATGGG + Intergenic
1009428231 6:63538170-63538192 GAGCCTTGGTGTTTACCAGTAGG + Intronic
1012745445 6:103081344-103081366 GTGCATTAGGGGTCACCAGTAGG - Intergenic
1023136423 7:37057356-37057378 CTCCCTTAGTGATCACCAGAAGG + Intronic
1023734812 7:43225329-43225351 GGGCCTTCGTGCTCACCAAAGGG - Intronic
1026893242 7:73995288-73995310 GGGCCGTAGTGAGCACAGGTTGG + Intergenic
1043203455 8:77404768-77404790 TGGCTTTAGTGAACTCCAGTGGG + Intergenic
1044196751 8:89386042-89386064 GGGCATTTGTGATCAGCTGTGGG - Intergenic
1048334117 8:133490492-133490514 GGGCCTTAGTGATCCACAAGTGG + Intronic
1050940155 9:11448517-11448539 GGGCCTTAGTTATGACAAATAGG + Intergenic
1052913386 9:33904692-33904714 AGCCTTTAGTGAACACCAGTTGG - Intronic
1192216136 X:69159878-69159900 GAACCTAAGTGTTCACCAGTAGG + Intergenic
1197391258 X:125868329-125868351 GGCCCTAAGTGTTCTCCAGTGGG - Intergenic
1199205101 X:145139570-145139592 GGGCCTAAGGGATCACCCATTGG - Intergenic
1200248847 X:154541631-154541653 GGTCCTTAGTGAAAAGCAGTTGG + Intronic