ID: 929969701

View in Genome Browser
Species Human (GRCh38)
Location 2:46563505-46563527
Sequence TATCTTCTTCCCACCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 185}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929969701_929969711 13 Left 929969701 2:46563505-46563527 CCAGAGCTGGTGGGAAGAAGATA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 929969711 2:46563541-46563563 CAGAATAGGCAGGGGAGGGGAGG 0: 1
1: 1
2: 5
3: 104
4: 858
929969701_929969704 -1 Left 929969701 2:46563505-46563527 CCAGAGCTGGTGGGAAGAAGATA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 929969704 2:46563527-46563549 AAAGGGAAGTAATACAGAATAGG 0: 1
1: 0
2: 2
3: 42
4: 556
929969701_929969710 10 Left 929969701 2:46563505-46563527 CCAGAGCTGGTGGGAAGAAGATA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 929969710 2:46563538-46563560 ATACAGAATAGGCAGGGGAGGGG 0: 1
1: 0
2: 3
3: 27
4: 342
929969701_929969707 5 Left 929969701 2:46563505-46563527 CCAGAGCTGGTGGGAAGAAGATA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 929969707 2:46563533-46563555 AAGTAATACAGAATAGGCAGGGG 0: 1
1: 0
2: 6
3: 32
4: 257
929969701_929969706 4 Left 929969701 2:46563505-46563527 CCAGAGCTGGTGGGAAGAAGATA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 929969706 2:46563532-46563554 GAAGTAATACAGAATAGGCAGGG 0: 1
1: 0
2: 4
3: 18
4: 259
929969701_929969705 3 Left 929969701 2:46563505-46563527 CCAGAGCTGGTGGGAAGAAGATA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 929969705 2:46563531-46563553 GGAAGTAATACAGAATAGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 194
929969701_929969709 9 Left 929969701 2:46563505-46563527 CCAGAGCTGGTGGGAAGAAGATA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 929969709 2:46563537-46563559 AATACAGAATAGGCAGGGGAGGG 0: 1
1: 0
2: 5
3: 74
4: 1023
929969701_929969712 14 Left 929969701 2:46563505-46563527 CCAGAGCTGGTGGGAAGAAGATA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 929969712 2:46563542-46563564 AGAATAGGCAGGGGAGGGGAGGG 0: 1
1: 0
2: 23
3: 283
4: 2227
929969701_929969708 8 Left 929969701 2:46563505-46563527 CCAGAGCTGGTGGGAAGAAGATA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 929969708 2:46563536-46563558 TAATACAGAATAGGCAGGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929969701 Original CRISPR TATCTTCTTCCCACCAGCTC TGG (reversed) Intronic
902783894 1:18720894-18720916 CACCTTCGTCCCTCCAGCTCTGG - Intronic
903460703 1:23518766-23518788 TTTCTGCATCCCACCAGCCCTGG - Intronic
908455243 1:64297046-64297068 GATCGTGTTCCTACCAGCTCAGG + Intergenic
908476540 1:64494116-64494138 TCTCTTCTTACCCCCAGCTGGGG + Intronic
909218779 1:72927451-72927473 TATCTTCTTCCTTCCAGCCTAGG - Intergenic
911066913 1:93797916-93797938 TATCCACTTACCTCCAGCTCAGG - Intronic
912053194 1:105558541-105558563 TATCTTCTTCTCACAATCCCAGG + Intergenic
912426597 1:109598341-109598363 TCTCTGCTTCCAACCAGCTATGG + Exonic
914417372 1:147496319-147496341 TTTCTTCTTCCCACCTCCCCAGG - Intergenic
915476208 1:156154274-156154296 TGTCTTCTCACCAACAGCTCTGG - Intronic
916443248 1:164847888-164847910 ACTCTTGTTCCCACCACCTCTGG + Exonic
916533983 1:165685835-165685857 TATCTTCTTGCCTCCAGCCCTGG - Intronic
917075483 1:171200231-171200253 TGTCTTCTTTGCACCTGCTCAGG + Intronic
920590965 1:207218278-207218300 TATCTTTTGCCCACCAGCCGTGG - Intergenic
921195648 1:212754849-212754871 TATCTGCTTCCCATCATTTCTGG - Intronic
923313058 1:232754853-232754875 TATGTTATTCCAACCATCTCTGG + Intergenic
1062928793 10:1338898-1338920 TGTCTCATTCCCAGCAGCTCCGG + Intronic
1065225590 10:23540583-23540605 TCTCTGCTTCCCTCTAGCTCTGG - Intergenic
1066429974 10:35342306-35342328 TATGTTCTGCCCACCAGGGCTGG - Intronic
1067450562 10:46379679-46379701 TGGCTTCTCCCCACAAGCTCTGG + Intronic
1067586681 10:47480072-47480094 TGGCTTCTCCCCACAAGCTCTGG - Intronic
1068381126 10:56255023-56255045 TCTTTTCTGCCTACCAGCTCTGG - Intergenic
1069861600 10:71475177-71475199 TCTCTTCTCACCACCAGCACAGG + Intronic
1070179941 10:74003641-74003663 TATGTTCTTGGGACCAGCTCTGG + Intronic
1070836859 10:79452976-79452998 CTTCTTCTTCCCCCCAGCCCAGG + Intergenic
1071365561 10:84896914-84896936 TATCTTCTGACCAGCAGCCCTGG - Intergenic
1071797725 10:89024149-89024171 TGTCTTCTTCCCTCCAGCTTTGG + Intergenic
1074863019 10:117527300-117527322 TATATTCTTTCTACCTGCTCAGG + Intergenic
1075514949 10:123101175-123101197 TCTCTACTTCCCACCAGGCCAGG + Intergenic
1075954656 10:126512178-126512200 TACCTTCTGACCACCTGCTCTGG - Intronic
1082800335 11:57409766-57409788 TCTATCCTTCCCACCACCTCTGG + Intronic
1083434718 11:62634470-62634492 TTTCTTTTTCCCCCCATCTCTGG - Intronic
1088029555 11:105229797-105229819 TATTTCCTTCCTACCAGCCCAGG + Intergenic
1089969935 11:122685080-122685102 TATCTTTTTTCCACCAATTCTGG + Intronic
1091316048 11:134614801-134614823 CATCTTCTTTCCACCATGTCAGG + Intergenic
1092926116 12:13274123-13274145 ACTCCTCTTCCCTCCAGCTCCGG + Intergenic
1094285790 12:28792066-28792088 TATCTTGGTCCCATGAGCTCTGG + Intergenic
1094583148 12:31752835-31752857 TATATGCTTCTCACCAGTTCTGG - Intergenic
1095739456 12:45591311-45591333 TATCATATTACCACCAGCTCAGG + Intergenic
1096560568 12:52433247-52433269 TCTCTTCTTCCCTCCAGGTGAGG - Exonic
1097226144 12:57477774-57477796 TGTCTTCTCACCGCCAGCTCTGG + Intronic
1098517006 12:71388753-71388775 TGTCTTTTTACCCCCAGCTCAGG + Intronic
1099675242 12:85752462-85752484 TATTTGCTTCTCAGCAGCTCTGG - Intergenic
1100141545 12:91625054-91625076 AATTTTCTTCCCATTAGCTCGGG + Intergenic
1100446190 12:94662196-94662218 TATGTTCTTCCAACCAAATCAGG - Intergenic
1101409648 12:104457733-104457755 CCTCTTCTTCCTACCGGCTCCGG + Intronic
1101719399 12:107338153-107338175 TATCTTCTTTCCACTTCCTCAGG + Intronic
1102028296 12:109725958-109725980 TTTCTCTCTCCCACCAGCTCAGG - Intronic
1102475554 12:113185950-113185972 CACCTTCTTCCCACCAGGTCTGG - Exonic
1104478004 12:129085803-129085825 TTGCTTCTTCCCATCAGCGCTGG - Intronic
1104492652 12:129208340-129208362 AATCTTCTTCACATCAGCACAGG - Intronic
1107280863 13:38733252-38733274 TATCTACTTCCCACAAGATGAGG - Intronic
1107995188 13:45852149-45852171 TATTTTCTCCCAAGCAGCTCTGG - Intergenic
1110385435 13:74905481-74905503 TTCCTCCTTCCCTCCAGCTCTGG - Intergenic
1110933839 13:81257938-81257960 GATTTTCCTCCCACCATCTCAGG - Intergenic
1111078953 13:83277188-83277210 TTTCTTTTCCCCACCAGGTCAGG + Intergenic
1112720628 13:102240501-102240523 TTTCTGCTTCCCACCATATCTGG + Intronic
1113013933 13:105805985-105806007 TATATTTTCCCCACAAGCTCTGG + Intergenic
1115931251 14:38497907-38497929 TTTCTAAGTCCCACCAGCTCAGG - Intergenic
1117232089 14:53730351-53730373 CATCATCTTTCCACCAGTTCTGG + Intergenic
1118688929 14:68319559-68319581 TATCTTCTTGTAGCCAGCTCTGG + Intronic
1119897474 14:78232244-78232266 TCTGTTCTCCTCACCAGCTCTGG + Intergenic
1120655606 14:87186373-87186395 TGCATTCTTCCCAGCAGCTCAGG - Intergenic
1121159808 14:91726979-91727001 TATAGGCTTCCCACCAGCACAGG + Intronic
1202832895 14_GL000009v2_random:56862-56884 TATTTTCTCTGCACCAGCTCTGG + Intergenic
1126057938 15:44749392-44749414 TATCTCCTTCTCTCCAGCCCTGG + Intronic
1131094159 15:89645512-89645534 TCTCTTCTTCCCTCCAGGCCTGG - Intronic
1131582568 15:93659338-93659360 TCTCTGTTCCCCACCAGCTCAGG - Intergenic
1133458099 16:5960820-5960842 TCTCTTCTTCCCAACAGCACAGG + Intergenic
1134139321 16:11703745-11703767 TACTTTCTTCACCCCAGCTCTGG - Intronic
1135629131 16:24022230-24022252 TACCTTCTTCCCAACAGTGCTGG - Intronic
1138563509 16:57816138-57816160 TTTCCTCTCCCCAGCAGCTCAGG - Intronic
1138704004 16:58895504-58895526 CTTTTTCTTCCCTCCAGCTCAGG - Intergenic
1141184579 16:81778558-81778580 TAGCTTCTTCCCATGAGATCAGG + Intronic
1143146330 17:4778685-4778707 TATCTTCGTTGCACCAGGTCAGG - Intronic
1144819180 17:18059455-18059477 CCTCTACTTCCCTCCAGCTCAGG + Intronic
1147424502 17:40339557-40339579 TAGCTTCTCCTCTCCAGCTCCGG + Intronic
1150472316 17:65447517-65447539 AATCCTCTTCCCACCTGCTGAGG - Intergenic
1154497080 18:14969751-14969773 CAGCTTCTTCCCCCGAGCTCAGG + Intergenic
1156259174 18:35428713-35428735 TATCTTTCTCCCAACATCTCAGG + Intergenic
1157586722 18:48805707-48805729 TATTTTCTTCCCACCTTCTCTGG - Intronic
1162830443 19:13281400-13281422 TCTCTTTTTCCCACCTGCACAGG - Intronic
1167067579 19:47198416-47198438 CATCTCCTTCCAAGCAGCTCTGG + Intronic
926426840 2:12745976-12745998 TCTCTTCTTCCCACCCATTCTGG + Intergenic
927960209 2:27236557-27236579 TTTCTTCTTCCCATCAACACTGG - Intronic
929969701 2:46563505-46563527 TATCTTCTTCCCACCAGCTCTGG - Intronic
930091469 2:47534385-47534407 AGTCATCTTCCCGCCAGCTCAGG - Intronic
931897104 2:66744528-66744550 AATCATCTTTCCACCAACTCTGG + Intergenic
932400981 2:71481162-71481184 TTTCTGTTTCCCCCCAGCTCTGG + Intronic
932594897 2:73087748-73087770 TTCCTGCTTCCCTCCAGCTCAGG + Intronic
935986504 2:108678745-108678767 TGTCTTCTTATCATCAGCTCTGG + Intronic
936151790 2:110025799-110025821 TGGCTTCCTCCCACCTGCTCAGG + Intergenic
936192884 2:110345570-110345592 TGGCTTCCTCCCACCTGCTCAGG - Intergenic
939482976 2:142772040-142772062 TCTCTTTTTCCCTCCTGCTCTGG + Intergenic
939649693 2:144745583-144745605 GCTCTTCCTCCCACAAGCTCTGG - Intergenic
940885359 2:158985135-158985157 TCTCTTCCTCCCACTAACTCAGG - Intronic
941742535 2:169050573-169050595 TCTCTTCTCCCCTCCATCTCTGG - Intergenic
942763620 2:179428625-179428647 TATTTTCTTCCAAACATCTCTGG + Intergenic
948780292 2:240317295-240317317 TTTCTTCCTCCCTCCAACTCCGG - Intergenic
948827435 2:240579449-240579471 TACCTTCTTCACATCAGGTCTGG + Exonic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1170482818 20:16784641-16784663 TAATTTCTTACCACCAGATCTGG - Intergenic
1171946002 20:31378136-31378158 TGCCTTCTTCCCACCAGATAGGG - Intronic
1173031326 20:39363565-39363587 TATATTCTTACCTCCAGGTCTGG + Intergenic
1173106154 20:40136421-40136443 AATCCACTTCCCACCAACTCAGG + Intergenic
1175964553 20:62654052-62654074 TAGTTTATTCCCACCAGCTCCGG + Intronic
1175975857 20:62710099-62710121 TATCTTCTTCCCTCCTGTTGAGG + Intronic
1176512956 21:7762337-7762359 TCTCTGCCTCCCACCAGCTGGGG - Intronic
1176864452 21:14037240-14037262 TACCTTCTTCCCTACAGGTCTGG - Intergenic
1178083137 21:29086382-29086404 TGTTTGCTGCCCACCAGCTCTGG + Intronic
1178243709 21:30931980-30932002 TTTCTTCTGCCCACTTGCTCTGG - Intergenic
1178374896 21:32058622-32058644 TATTGTCTTCCCACTAGCTTTGG - Intergenic
1178647069 21:34392861-34392883 TCTCTGCCTCCCACCAGCTGGGG - Intronic
1181629263 22:24141983-24142005 TCTCTCCTTCCCCCCAACTCTGG - Intronic
1182901731 22:33904123-33904145 TGACTTCCTCCTACCAGCTCCGG + Intronic
1183302258 22:37064145-37064167 TGTGTTCTGCCCACCTGCTCTGG + Intergenic
1184128335 22:42502666-42502688 AAGCTTCTTCCCACCAGTTGGGG - Intergenic
1184137127 22:42555981-42556003 AAGCTTCTTCCCACCAGTTGGGG - Intronic
949869411 3:8575069-8575091 CATGTTCTTCCCTCCAGCTTTGG - Intergenic
951843341 3:27058652-27058674 TCTCTTCATCTTACCAGCTCTGG + Intergenic
951913363 3:27774209-27774231 TTCCTCCTTCCCACCAGCTGAGG - Intergenic
952271815 3:31840359-31840381 TATCTCCTTCCCAAATGCTCAGG + Intronic
952600053 3:35069304-35069326 TATCTTATTCCCACCCACCCTGG + Intergenic
954385610 3:50242327-50242349 TCTCATCTTCCCAGCATCTCAGG + Intronic
955393061 3:58535235-58535257 TTTCTTCTACCAACCAGCCCTGG - Intronic
955969068 3:64419067-64419089 AATCCACTTCCCACCAGCACAGG + Intronic
958866615 3:99508313-99508335 TAACTTCTTCACTCCTGCTCTGG - Intergenic
960964884 3:123097806-123097828 TCTCTTCCTCCCACCAGCCCTGG - Intronic
962350019 3:134649887-134649909 TCTCTCCTCCCCTCCAGCTCTGG - Intronic
962889009 3:139654903-139654925 TTTCTACCTCCCACCAGCACAGG - Intronic
964446447 3:156764242-156764264 TTTCTTCTCCCCACCAAATCTGG - Intergenic
966849165 3:184154321-184154343 TATGTGCTTCCCTCCAGCTGAGG + Intronic
967328067 3:188262097-188262119 TGTCCTCTTCCCACCAGCCTGGG - Intronic
969087415 4:4666821-4666843 TATCTTCCTCACTCCAGCTGAGG - Intergenic
969997384 4:11326761-11326783 TTTCTACTTCCCACATGCTCTGG + Intergenic
971410093 4:26361228-26361250 TAGTTTCTTCCCACCTACTCTGG + Intronic
972576941 4:40360481-40360503 TTTCTTATTCCCACCATCTTGGG - Intergenic
975612987 4:76219679-76219701 TATCTTCTCCCCACCACTCCAGG - Intronic
976077760 4:81319236-81319258 AATCTCCCTCACACCAGCTCAGG + Intergenic
976103679 4:81593423-81593445 TATCTTCTACCCAGCAATTCAGG - Intronic
976388602 4:84486300-84486322 TATCTTCTCCCCACAAGATGCGG - Intergenic
981099999 4:140819311-140819333 TATTTTCTTCTCACAAGCTATGG + Intergenic
983092668 4:163523172-163523194 TATCTCCTTCCCAGAAGATCAGG - Intergenic
995054109 5:107740353-107740375 TAACTTCTTGCCTCCAGATCTGG - Intergenic
995688342 5:114796068-114796090 TATCTTCTTCCTAACAGAGCAGG - Intergenic
1001113760 5:168921700-168921722 TACTTTCCTCCCACCCGCTCAGG + Intronic
1001308523 5:170593889-170593911 TACGTTCTTCCCACCACCTCAGG - Intronic
1003366931 6:5483825-5483847 TACCTTCTATCCACAAGCTCTGG - Intronic
1003831827 6:10020461-10020483 TATGTTCTTCTCTCCAGCACAGG + Intronic
1005324622 6:24687210-24687232 TTTCTCCTTGCCCCCAGCTCTGG + Intronic
1006918550 6:37612730-37612752 TTTCTTCTTCCTTGCAGCTCAGG + Intergenic
1011621798 6:89250382-89250404 AAGCTTCTTCCAAGCAGCTCAGG + Intergenic
1013073032 6:106746209-106746231 CATCCTCTTCCCATCAGCTTGGG + Intergenic
1014388471 6:120830653-120830675 TATTTTCTTCCCAGAAGATCTGG - Intergenic
1016324203 6:142880867-142880889 TGTCTTCTCCCCAGCAGTTCTGG + Intronic
1016752719 6:147649111-147649133 TTTATTCTTCTCACCAGCTGTGG + Intronic
1017589611 6:155964621-155964643 TATCTTCTTTCCTCATGCTCAGG + Intergenic
1017950341 6:159130525-159130547 TCACTTCTTCCCACCAGCTGAGG - Intergenic
1019125501 6:169837966-169837988 TGTGTTCTGCCCACCGGCTCTGG + Intergenic
1023813760 7:43932314-43932336 TATCCTCTTCTCACAAGATCTGG - Intronic
1024024043 7:45396366-45396388 TGTCTTCTTCCCATCAGTCCTGG + Intergenic
1028358700 7:89940813-89940835 TCTCTTCTTACCCCCAGCCCTGG - Intergenic
1028496664 7:91468750-91468772 CAACTTCTTCCCACCACTTCTGG + Intergenic
1029078040 7:97951206-97951228 TATCCTCTCCCCACCTCCTCCGG - Intergenic
1031439017 7:121770081-121770103 CATCTCCTACCCACCAGCTATGG - Intergenic
1032276496 7:130460918-130460940 GATCCTCTTCCCACCTGCTCTGG + Intergenic
1032670608 7:134079191-134079213 CATCCTCTTCCAACCTGCTCAGG + Intergenic
1032943388 7:136822309-136822331 TATCATCTTCCCCACAACTCTGG + Intergenic
1034017966 7:147608017-147608039 TATCTTCTTCCCACTAGCTTTGG + Intronic
1034929911 7:155153482-155153504 TCCATTCTTCCCACCAGCCCTGG + Intergenic
1036621577 8:10427636-10427658 TCGCATCTGCCCACCAGCTCAGG - Intronic
1037684228 8:21124802-21124824 TATCTTGGGCCCTCCAGCTCTGG - Intergenic
1037872405 8:22510634-22510656 TCCCATCTTCTCACCAGCTCAGG + Intronic
1037928911 8:22865734-22865756 CATCTTCCGCCCACCAGATCCGG - Intronic
1038625681 8:29190682-29190704 TCCCTCCTTCCCACCAGCGCAGG - Intronic
1039687599 8:39822265-39822287 TATCTTCTTCCTTCCAGATGTGG + Intronic
1040011483 8:42664728-42664750 TCTCTTCATCCCCCCATCTCTGG + Intergenic
1041562710 8:59238226-59238248 TATCTTCTACCCACCTTCTTGGG - Intergenic
1042599165 8:70481044-70481066 TGGCTTCTTCCCACCAGCTGTGG + Intergenic
1043473530 8:80584110-80584132 TGTCTCCTTGACACCAGCTCCGG - Intergenic
1044466560 8:92513434-92513456 TATCTTTTTCCCCCCGCCTCTGG - Intergenic
1045303092 8:100931461-100931483 TAAAGTCTTGCCACCAGCTCAGG - Intronic
1045372984 8:101543484-101543506 TTCCTTCTTCCCACCAGCAAAGG - Intronic
1045626260 8:104055161-104055183 TATCTTTTACCCACCATGTCAGG - Intronic
1047857172 8:128923811-128923833 TATCTTCTTCTTACCTCCTCAGG + Intergenic
1048579468 8:135719288-135719310 TATATATTTCCCACAAGCTCCGG + Intergenic
1048690812 8:136961084-136961106 TTTCTTCTTCCCACAAGCACAGG - Intergenic
1053286428 9:36852252-36852274 TTTCCTCTTCCCACCTGCCCAGG - Intronic
1054929446 9:70620437-70620459 TATCTTCTCCCAGCTAGCTCTGG + Intronic
1055349026 9:75366129-75366151 TATTACCTTCCCTCCAGCTCAGG - Intergenic
1056248671 9:84725501-84725523 TACCTTCCTCCCACCAGCCCAGG - Intronic
1057290102 9:93801012-93801034 AATCTTCTTCCCACTTGCGCAGG + Intergenic
1059325942 9:113504048-113504070 GCTCTGCTTCCCACCAGCCCCGG - Intronic
1060011699 9:120049123-120049145 TATATTTTTGCCACCACCTCTGG - Intergenic
1061098113 9:128471864-128471886 TATCCTCTGCCCACCCACTCTGG - Intronic
1186590373 X:10924434-10924456 TTTTTGCTCCCCACCAGCTCAGG - Intergenic
1186923797 X:14310034-14310056 TAGCTACTACCCTCCAGCTCAGG - Intergenic
1195441432 X:104903313-104903335 TCTCTTCTTCCCAACAATTCTGG + Intronic
1196897705 X:120353903-120353925 CATTTTCTTTCCACCACCTCTGG - Intergenic
1197718070 X:129724539-129724561 TTTAATCTTCGCACCAGCTCAGG + Intergenic
1198704276 X:139430756-139430778 TATTTTTTTCCCAAGAGCTCTGG + Intergenic