ID: 929974065

View in Genome Browser
Species Human (GRCh38)
Location 2:46615064-46615086
Sequence AAGTTCTCCAAGAAGAGTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 2, 2: 2, 3: 31, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929974062_929974065 22 Left 929974062 2:46615019-46615041 CCAGAACAGATGCACAACCATGT 0: 1
1: 2
2: 4
3: 15
4: 123
Right 929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG 0: 1
1: 2
2: 2
3: 31
4: 257
929974063_929974065 5 Left 929974063 2:46615036-46615058 CCATGTCAAGTGTGTTTCCAATA 0: 2
1: 1
2: 0
3: 16
4: 263
Right 929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG 0: 1
1: 2
2: 2
3: 31
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929974065 Original CRISPR AAGTTCTCCAAGAAGAGTGA TGG Exonic
901059325 1:6464913-6464935 AAGGTCACCAGGAAGAGAGAAGG + Intronic
902959742 1:19954712-19954734 AAGTTCTGGAAGGAGATTGAAGG - Intergenic
904408065 1:30306663-30306685 AAGTTCTGCAAAGAGAGGGAGGG - Intergenic
907773812 1:57492882-57492904 AATTTCTCCAAGCAAAGTCAAGG - Intronic
908508997 1:64836024-64836046 AAGTTAACCAAGCAGAGGGATGG + Intronic
908843567 1:68302291-68302313 GAGCTCTCCAAGAAGAGTCATGG + Intergenic
909409331 1:75330938-75330960 AAGTTTTACAAGAAGAGTTTGGG - Intronic
909713636 1:78680472-78680494 GGATTCTCTAAGAAGAGTGAAGG - Intergenic
911199402 1:95029328-95029350 AAGTGCTCCAAGAAGAGGCAAGG + Intronic
913155090 1:116088772-116088794 AGATTAACCAAGAAGAGTGAAGG - Intergenic
916375320 1:164147485-164147507 AAGTGATCCATGAAGTGTGAGGG - Intergenic
917373557 1:174322717-174322739 AAGACTTCCAAGAACAGTGATGG + Intronic
917389237 1:174515657-174515679 AAGTTCCTTAAGAACAGTGATGG + Intronic
917717405 1:177752368-177752390 AAGTTCTCAAGAAAGAGGGAGGG + Intergenic
918079330 1:181193623-181193645 AAGTTCTTCAAGAAGTTTTAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918796991 1:188912798-188912820 AACTTCTACAAGAAAAATGAAGG - Intergenic
919658078 1:200216627-200216649 AAGTTTTGCAAGAAGAGTTGAGG - Intergenic
923231365 1:231989562-231989584 AGCTTTTCCAAGAGGAGTGAGGG + Intronic
923334216 1:232952879-232952901 AAGCCCTCCAAGATGAGTCATGG - Intronic
1064131247 10:12712151-12712173 AACTTCACCAAGAAGCTTGAGGG + Intronic
1065141187 10:22719734-22719756 AAGTTCACTAAGAAGAAAGAAGG + Intergenic
1065639730 10:27769362-27769384 GTGTTCTCCATGAAGTGTGATGG - Intergenic
1066003577 10:31127335-31127357 AAGGTCACCAGGAAGAGGGAAGG - Intergenic
1070473639 10:76810802-76810824 AAGATCACCTAGTAGAGTGAGGG - Intergenic
1070951481 10:80434910-80434932 ATGTCCTCTAAGAAGAGGGAGGG + Exonic
1071276697 10:84062010-84062032 AACTTCTCCCAGAGGTGTGAGGG + Intergenic
1073134300 10:101211597-101211619 CAGTTCTCCCAGAAGAGTCTGGG + Intergenic
1073345317 10:102778469-102778491 AAACTCTTCAAGGAGAGTGAAGG + Intronic
1074001693 10:109379937-109379959 AAGTTCTGCAAGAACAGAGATGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080031065 11:27661707-27661729 AAGTTAGCTAAGAAGGGTGAGGG - Intronic
1080864188 11:36178846-36178868 AAGTTCTCCACCATAAGTGATGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083320783 11:61845204-61845226 AAGTTGGCCAGGCAGAGTGAGGG - Intronic
1084063930 11:66692736-66692758 GAGTGCTGCAAGAAGAGTGAGGG + Exonic
1084300300 11:68245847-68245869 AAATTATCCTTGAAGAGTGAAGG + Intergenic
1084395907 11:68909948-68909970 ACGTTCTCCAAGAACAGCAAAGG - Intronic
1084684401 11:70685314-70685336 GAGGCCTCCAAGATGAGTGAAGG - Intronic
1084752966 11:71215948-71215970 AAGATAACCAAGAAGAGAGATGG + Intronic
1085124741 11:73992190-73992212 AAATTCTCAAATCAGAGTGAAGG + Intergenic
1085837386 11:79971620-79971642 AAGTTTTCTAAAAAGAGTAAAGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087721519 11:101671254-101671276 AAGGTCTCCAACAACAGTGGTGG + Intronic
1087897500 11:103602982-103603004 AAGTAATCTTAGAAGAGTGAAGG - Intergenic
1088522843 11:110717921-110717943 AAGGGCACCAGGAAGAGTGAGGG - Intergenic
1088657483 11:112014452-112014474 GAGTATTCCAAGAAGAGGGAAGG - Intronic
1089793011 11:120958015-120958037 CAGGTCTCCAGGAAGAGGGATGG + Intronic
1090104580 11:123838786-123838808 AAGCTCTCTAAAAAGAGTGTAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1097043373 12:56169787-56169809 AAGGAGTCCGAGAAGAGTGATGG - Exonic
1097196301 12:57244019-57244041 AAGCTCTCCAAGGAGTGTGGTGG + Intronic
1097221394 12:57453257-57453279 AATTTCTCCAAGAAGCTTGATGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098895491 12:76055681-76055703 AATTTCTCCTGGAAGAGTTAAGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101978403 12:109383283-109383305 AAGTTCTGGAGGAAGAGTAAGGG - Intronic
1102082010 12:110105969-110105991 AAATTCTCCAAGAACCATGATGG - Intergenic
1102538432 12:113600107-113600129 AAGTTAACCAAGAAGAGCAAAGG + Intergenic
1102937308 12:116908525-116908547 AAGTTCATCAAGAAGAGAGCGGG + Intergenic
1105969165 13:25412588-25412610 AAGTCTTCCAAGAAGCCTGAAGG - Intronic
1106233470 13:27840918-27840940 AGCTTACCCAAGAAGAGTGAAGG - Intergenic
1106624560 13:31407133-31407155 AGCTTCTCCCTGAAGAGTGAAGG - Intergenic
1107110627 13:36693704-36693726 AAGTTCTCCAGGTAAAATGAAGG + Intronic
1108444199 13:50490646-50490668 AAATTCTACAAGAAGAGAGAGGG - Intronic
1109157788 13:58932654-58932676 AAGTTCTTCTAGAAAAGTTAAGG - Intergenic
1110237961 13:73235993-73236015 ATGTTCTCCATTCAGAGTGAAGG - Intergenic
1110697353 13:78506648-78506670 AATTTCCCCAAGAAGATTTACGG + Intergenic
1111044954 13:82802923-82802945 AAGTGCTCTAAGAACAGGGAGGG + Intergenic
1112431663 13:99355669-99355691 AAGTTCCCCATGAGGAGTGATGG + Intronic
1113697738 13:112358994-112359016 CTGTTCCCCAGGAAGAGTGATGG + Intergenic
1113704393 13:112416845-112416867 AACTTCAACAAGAACAGTGATGG - Intronic
1114648578 14:24269230-24269252 AAGTACTCCAAGGAGAGGGTAGG - Intronic
1118367398 14:65107733-65107755 AAGATCTCTAAGCACAGTGAGGG + Intergenic
1118842706 14:69525006-69525028 AAGTTCTCCAAGCAGAGAAAAGG - Intronic
1118857873 14:69637987-69638009 GAGTTCTCCTAGCAGAGTGGTGG - Intronic
1124371260 15:29106170-29106192 GACTTTTCCAACAAGAGTGAAGG + Intronic
1124828095 15:33119582-33119604 AAGCTCTTCAAGAATAGTGCTGG - Intronic
1126934724 15:53694158-53694180 CAGTTCTCCAACAGGAGTCACGG + Intronic
1127780133 15:62305620-62305642 AAGTTCTCAAAGAGGTGGGAGGG - Intergenic
1128266322 15:66269764-66269786 CAGCTCTGCAAGATGAGTGAAGG + Intergenic
1128692643 15:69736892-69736914 AAGATCTCCAAGCAAAGTAAGGG + Intergenic
1130437839 15:83919775-83919797 AAGTTTTCTAAGAAGATTGAAGG + Intronic
1130730996 15:86492070-86492092 AAGTGCTCCTAGAATAGTGAGGG + Intronic
1131298668 15:91174968-91174990 AAGTTCTCCAAGAGCATGGATGG + Intronic
1131740658 15:95387274-95387296 AAAGTCTCCAAGAACAGTTATGG - Intergenic
1132633585 16:931661-931683 ATGTTCTCCAAGATCAGGGAAGG + Intronic
1135845931 16:25918604-25918626 CAGGTCTCCAGGAAGAGAGAAGG + Intronic
1136081430 16:27854779-27854801 AAGTTCCCCAAGATGAGCGTGGG + Intronic
1137879578 16:52032155-52032177 AAAATCTCCCAGATGAGTGATGG + Intronic
1138543085 16:57700127-57700149 AACTTCTGCAAGGAGAGAGATGG - Exonic
1142969331 17:3600871-3600893 AAGGTCTCCAAGGACAGTGGTGG - Intergenic
1143471786 17:7179824-7179846 AAGTCCTCCAAGCAGCATGAGGG + Intergenic
1144194651 17:12878690-12878712 AAGTGCTTCAGGAATAGTGAAGG + Intronic
1144739090 17:17571321-17571343 CCGGTCTCCAGGAAGAGTGAGGG + Intronic
1146478801 17:33185693-33185715 CAGTACTCCATGAAGAATGAAGG - Intronic
1147472104 17:40672103-40672125 AAATTCACCAAGATGAATGATGG - Intergenic
1147620024 17:41860068-41860090 ATGTTCTCTTAAAAGAGTGAAGG - Intronic
1148256595 17:46138546-46138568 AAGTCATCCAAGAATACTGAAGG + Intronic
1148979631 17:51561116-51561138 AAGTTCTCCCAGAAAATTCAGGG - Intergenic
1149869992 17:60172375-60172397 AAATGCCCCAAGAAGACTGAAGG - Intergenic
1151355879 17:73558177-73558199 AAGTTCTGCCAGTAGATTGATGG + Intronic
1151728775 17:75898982-75899004 CATGTCTGCAAGAAGAGTGAGGG + Exonic
1152029054 17:77830551-77830573 TGGTTCTCCAAGGAGAGGGAGGG - Intergenic
1152963526 18:95606-95628 AAGTTAAATAAGAAGAGTGATGG + Intergenic
1153598265 18:6751422-6751444 AATACCTCCAAGAAGAGCGATGG - Intronic
1153732807 18:8031853-8031875 GAGTTAGCCAAGAAGAGAGAAGG + Intronic
1155736389 18:29227739-29227761 AAGTTTTCCCAGGAAAGTGAGGG - Intergenic
1155749314 18:29400154-29400176 AACCCGTCCAAGAAGAGTGAAGG + Intergenic
1157576032 18:48744091-48744113 AAGTTCCCCAAGATGTGGGAGGG + Intronic
1157743608 18:50115405-50115427 AAGTTCTGCAGGAAGGGAGAGGG - Intronic
1159674661 18:71266651-71266673 AAGTACTCCAAGAAAAGTTTTGG + Intergenic
1160353432 18:78205383-78205405 ATGTTCTCTAAGAAGATGGAAGG + Intergenic
1161266854 19:3368100-3368122 AAGTTCTCCAAGAACAACTAGGG + Intronic
1162329457 19:10018674-10018696 AAGTAATGCTAGAAGAGTGAGGG + Intronic
1163270668 19:16251569-16251591 AGGAGCTCCAAGAAGAGAGATGG - Intergenic
1163326976 19:16610905-16610927 AGGTTCTCCCACAAGAATGAGGG + Intronic
1164028768 19:21380995-21381017 AAATGATCCAAGGAGAGTGATGG + Intergenic
1165576939 19:36828042-36828064 CACTTTTCCAAGAAGAGTGAAGG + Intronic
1166561246 19:43733718-43733740 TTGTTCTGCAAGAAGACTGAGGG + Exonic
1166578792 19:43872936-43872958 AAGGTCTCCAACACGACTGAAGG + Exonic
925827845 2:7867534-7867556 AAGTTTTCTTTGAAGAGTGAAGG - Intergenic
926002446 2:9344613-9344635 AGCCTCTACAAGAAGAGTGACGG + Exonic
928100221 2:28432466-28432488 GAGTTCTCCAGGTAGAGGGAAGG - Intergenic
929197822 2:39204734-39204756 AAGTTCTTTTAGAAAAGTGAAGG - Intronic
929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG + Exonic
931726970 2:65120863-65120885 ATGTTTTCCAAGAACAATGATGG - Intronic
932080233 2:68707545-68707567 ATGTGCTCCAGGAAGAGAGAAGG - Intronic
933213280 2:79596395-79596417 AAGTTCCCCACGAAGAGAAAAGG + Intronic
933633081 2:84678353-84678375 AAGTTCTCAAAAAAGTGTGCAGG - Intronic
935926672 2:108077356-108077378 AAGTCCTCAATGAAGAATGAAGG + Intergenic
936388617 2:112053541-112053563 AAGTTCTACAAGAAGAGTTAAGG - Intergenic
942014254 2:171795114-171795136 AAGCTGTCCATGAAGAGGGAAGG - Intronic
942100921 2:172582689-172582711 AAGTTCTTCAGGAAAAGGGAGGG - Intronic
943751695 2:191515879-191515901 AGGTTCTCCAAGCAGAAGGAGGG - Intergenic
943985781 2:194616364-194616386 AAGTTCTCAAAGGAAAGTAAAGG - Intergenic
944518971 2:200544429-200544451 AAATTAGCCAAGAAGAGTGGTGG - Intronic
946071423 2:217037376-217037398 AAGTTCTCCATGGAGGGGGATGG + Intergenic
1170165183 20:13354654-13354676 AAGTGCGCCAAGAAAAGTGAAGG + Intergenic
1171143918 20:22765432-22765454 AAGTTCAACGAGAACAGTGATGG + Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1172387172 20:34542195-34542217 AATTTCTCCAAGAAGGATAATGG + Intergenic
1174937443 20:54886492-54886514 AAACTCTACAAGAAGAGTGTGGG - Intergenic
1177218442 21:18159449-18159471 AAGTTCTCCTATAAAACTGAGGG - Intronic
1178905306 21:36631542-36631564 ATCTTCTCCAAGAACTGTGATGG - Intergenic
1179068254 21:38046793-38046815 AGGTTCTATAAGAAGTGTGATGG + Intronic
1179113209 21:38465231-38465253 AAGTTCCCCATGAAAAGAGATGG + Intronic
1179477482 21:41657014-41657036 TAGTGCTCCCAGAAGAGAGATGG - Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181273618 22:21675094-21675116 AACTTTTCCAAGAACAGTGAGGG + Exonic
1181840164 22:25650608-25650630 AAGTTTTACAAGAAGAGGGATGG + Intronic
1183253241 22:36744715-36744737 AAGTCCCCCAAGAAGGGTGGAGG - Intergenic
1183903745 22:41024374-41024396 AAGTTCTCAGAGAAGAGAGCAGG + Intergenic
1184894157 22:47397418-47397440 AAGTTCTACAAAAACAGAGAGGG + Intergenic
951060848 3:18205358-18205380 TAGTGCTTAAAGAAGAGTGAGGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952539479 3:34352493-34352515 AAGTCCTCTAATAAGGGTGAAGG - Intergenic
954317392 3:49808512-49808534 CAGGGCTCCAAGAAGAGTGCAGG - Intronic
954596490 3:51829825-51829847 CAGTTCACCAAGGAGAGGGAGGG - Intronic
955773472 3:62409337-62409359 AAGTTCTCAAAGAAGTGTGTGGG + Intronic
956312220 3:67893918-67893940 AAATACTTCAAGAAGATTGATGG - Intergenic
956849656 3:73217417-73217439 GAAACCTCCAAGAAGAGTGAGGG - Intergenic
956931082 3:74043635-74043657 AAGTGCTCCTAGAAGACTGCTGG - Intergenic
957231593 3:77524358-77524380 AAGTTATCCATGTAGAGTGTGGG - Intronic
957251549 3:77777717-77777739 AAGTTCTCCAGGAATAGAAAAGG + Intergenic
957594795 3:82249132-82249154 AAGTTCTGCCAGAAAACTGAAGG - Intergenic
957782812 3:84841706-84841728 AAATGCTCTAAGAAGAGTCAGGG - Intergenic
958841733 3:99213344-99213366 GGTTTCTCCTAGAAGAGTGAGGG + Intergenic
959708823 3:109364116-109364138 AAGTTCACCAAGAAAAGGGTGGG - Intergenic
960007139 3:112791689-112791711 AATTTCTCTTAGAAGAGTGTTGG - Intronic
961507058 3:127377058-127377080 AAGTTGGCCAAGGAGAGAGAAGG + Intergenic
962490563 3:135889819-135889841 CATTTCTCTTAGAAGAGTGAGGG - Intergenic
962972554 3:140417483-140417505 AAATTCTACTAGAAGAGTGTTGG + Intronic
964740925 3:159965173-159965195 AAGAGCTAAAAGAAGAGTGAGGG - Intergenic
964796235 3:160500215-160500237 AATTTATCCAAGTAGAGTGCAGG - Exonic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967031506 3:185611648-185611670 AAGTTCTCAAAGAAGTCAGATGG + Exonic
967415398 3:189211869-189211891 AGGTTATCCAAGCAGACTGATGG - Intronic
968054433 3:195680711-195680733 AAGGTCTTCAAGGAGAGGGAGGG - Intergenic
968101457 3:195968447-195968469 AAGGTCTTCAAGGAGAGGGAGGG + Intergenic
969190728 4:5516632-5516654 AAGTGCAGCAAGAATAGTGATGG + Intergenic
969793840 4:9510530-9510552 ACTTTCTCCAAGTAGAGGGAAGG + Intergenic
970050265 4:11906244-11906266 AAGTATTCCAGAAAGAGTGAAGG + Intergenic
971193950 4:24454025-24454047 AAGATTACCAAGAAGAGTAAGGG - Intergenic
971682872 4:29723853-29723875 ACTTTCTCCAAGTAGAGTAAAGG - Intergenic
972560142 4:40219746-40219768 AAGTTCACCAGGAAGAGCCAGGG + Intronic
972574919 4:40342912-40342934 AAGTTAGCCAGGAAGAGAGAGGG + Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973658491 4:53076818-53076840 TTGTTCTCAAAGAAGAGGGAAGG - Intronic
974150766 4:58006024-58006046 GATTTCTACAAGAACAGTGATGG - Intergenic
974576107 4:63724935-63724957 GAGTTCTCCAAGAAAATTGAAGG + Intergenic
974904491 4:68038314-68038336 ATGTTTTCCAACAAAAGTGAAGG + Intergenic
977600262 4:98928359-98928381 AAGCTCTCCAAGTAGAATGAGGG - Intronic
978211486 4:106142772-106142794 ATTTTCTTCATGAAGAGTGATGG - Intronic
978735544 4:112080190-112080212 AAGCTCTCGAAGGAGAGGGAAGG - Intergenic
980696997 4:136370766-136370788 AAATTATCCAAGAATACTGAAGG + Intergenic
981292989 4:143098000-143098022 ATGTGCTCCAGGAAGAGGGAAGG - Intergenic
981934610 4:150225839-150225861 AAATTTTCCAAGAAGAGGCAGGG - Intronic
985434110 4:189912248-189912270 AAGTTCACTCCGAAGAGTGAGGG + Intergenic
986961783 5:13221599-13221621 ACGTTTTCCACAAAGAGTGAAGG + Intergenic
987363429 5:17127163-17127185 TATTTCTCCAAAAAAAGTGATGG + Intronic
987703496 5:21431913-21431935 AAGAGCACAAAGAAGAGTGATGG + Intergenic
988785796 5:34564543-34564565 ATTTTCTCTAAGCAGAGTGATGG - Intergenic
989232422 5:39101605-39101627 AAATTATTCAAGAAGACTGAGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989439057 5:41448553-41448575 AACTTTTCCAAAAAGAGTTAAGG - Intronic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
990021936 5:51138361-51138383 AAGTTCTTCAAGTTAAGTGATGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991626715 5:68610343-68610365 AATTTCTGAAAGAAGAGTGTTGG - Intergenic
995566177 5:113434673-113434695 AATTTCTCCAAGAAGTCTGCGGG + Exonic
995742865 5:115373470-115373492 AAGTTCTCAAAGAGGAGGGCAGG - Intergenic
998183482 5:139961615-139961637 AAGTTCCCCAGGAGGAGGGAGGG - Intronic
999826403 5:155277692-155277714 AAGTTCTACAGAAAGAGTCAGGG - Intergenic
1001159886 5:169303341-169303363 CAATTCTCCAAGAGGGGTGAAGG - Intergenic
1002392085 5:178922142-178922164 GAGTTCTCCAAGAAGAGTGATGG - Intronic
1002875342 6:1204753-1204775 AGGGTCTCCAAGGGGAGTGAGGG + Intergenic
1004022676 6:11789106-11789128 AGTTTTTCCAAGAAGAGTGCTGG - Intronic
1009903441 6:69838341-69838363 AAATTATCCAAGAAGAAAGAAGG + Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012190895 6:96278233-96278255 AAGATCTGGAAGAAGAGTTAAGG + Intergenic
1014486050 6:122000550-122000572 CAGTTCTACACGAAGAGTGTTGG + Intergenic
1015418454 6:132978067-132978089 AAATTCTGAAAGATGAGTGATGG + Intergenic
1015427360 6:133087415-133087437 AAATTCCCCAAGAACAATGATGG - Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1016858199 6:148693176-148693198 TATTTTTCCAAGAAGTGTGATGG - Intergenic
1016902840 6:149118846-149118868 AAGTTCTCCCAGAAAAGTGTGGG + Intergenic
1018097397 6:160401290-160401312 AAATTCTGAAAGAAGAGTGGGGG + Intronic
1018466871 6:164055699-164055721 CAGTTATCCAAAAAGAATGAAGG + Intergenic
1019798920 7:3073341-3073363 GAGTGCTCCAGGAAGGGTGAGGG + Intergenic
1020439890 7:8206170-8206192 AAGTTCTCCTAGAACAGTGGAGG + Intronic
1022211648 7:28216183-28216205 AACTTCTCCCAGCTGAGTGAAGG + Intergenic
1027359703 7:77395333-77395355 CATTTCTCCAAGAAGAGGAAAGG - Intronic
1028641383 7:93045548-93045570 AAGTTCTTCAAGAAGCAAGATGG + Intergenic
1029348183 7:99993736-99993758 AAGTTATCCAGGGAGAGTGAGGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1032002561 7:128274884-128274906 GAGTTCTCCAGGTAGAGGGATGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1041974340 8:63779866-63779888 AAGTCCTGAAAGGAGAGTGAAGG - Intergenic
1042765252 8:72314243-72314265 AAGTTCTCGAAGAATAATGGGGG - Intergenic
1043112503 8:76204314-76204336 AAATTCTGTAAGAAAAGTGAGGG - Intergenic
1044020767 8:87103196-87103218 GAGATCTCCAAGAAGAGGTATGG + Intronic
1045181000 8:99782581-99782603 AAGATGTCCAAGCAGAGGGAAGG + Intronic
1046779830 8:118203140-118203162 AAATTCTCCAACAAGAATGGAGG + Intronic
1046976621 8:120285569-120285591 AGTTTCTCCCAGGAGAGTGATGG + Intronic
1048797971 8:138168915-138168937 AGCTGCTCCAACAAGAGTGATGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG + Intergenic
1050747450 9:8893039-8893061 AAGTTTTCTAAGAAGTTTGATGG + Intronic
1050982178 9:12034670-12034692 ATCTTCTCCAAAAACAGTGATGG + Intergenic
1050992253 9:12169511-12169533 AAGGTCTCCAGAAGGAGTGAAGG + Intergenic
1052172564 9:25419030-25419052 AAGTTTACCAATCAGAGTGAAGG + Intergenic
1052313127 9:27090172-27090194 AAGTTGTTCAAGAAGAGTGGGGG - Intergenic
1052977955 9:34425578-34425600 AACTTCTCCAAGCACAGTGGAGG - Intronic
1054457180 9:65439183-65439205 AAATTCTCCAATATGAGTGACGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056236654 9:84601254-84601276 AAGATCTCCAAGATGAGGGCGGG + Intergenic
1056405076 9:86265836-86265858 AAATGATCCAAAAAGAGTGATGG + Exonic
1056462849 9:86824933-86824955 AAATATACCAAGAAGAGTGAAGG - Intergenic
1057446930 9:95122965-95122987 AACTTCTCCAGGGAAAGTGAGGG + Intronic
1057512163 9:95689806-95689828 AAGTTCCCTAAGGAGAGTGCAGG + Intergenic
1058282667 9:103135633-103135655 GAGTTCCCAAAGAAGAGAGAAGG - Intergenic
1059947886 9:119430663-119430685 AACTCCTCCAAGAATAGAGAAGG + Intergenic
1060460017 9:123843114-123843136 AAGTTCTCCAAGAAGAATGATGG - Intronic
1061829669 9:133283367-133283389 AAGCTCTACCAGATGAGTGATGG + Intergenic
1062734568 9:138128120-138128142 AAGTTAAATAAGAAGAGTGATGG - Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1185959448 X:4532727-4532749 AAGTTCTCCACAAAGGGTGTAGG - Intergenic
1186098960 X:6134533-6134555 ATGTTCTGCAAGGAAAGTGATGG + Intronic
1186457600 X:9722255-9722277 AAGTTCTTGAAGAAGTGAGAAGG - Intergenic
1186526695 X:10255497-10255519 CAGTTCTCCAAAAGGAGAGAAGG - Intergenic
1186957116 X:14695872-14695894 CATTCCTCCAAGAAGAGTAATGG + Intronic
1187187812 X:17003882-17003904 AAGTTCTGGAAGAAGGTTGAAGG - Intronic
1188423513 X:30017781-30017803 AAGTTCTCCAAAAAGAATGATGG + Intergenic
1189047431 X:37608403-37608425 AAGTTCGCAAGGAATAGTGATGG + Intronic
1192282337 X:69699887-69699909 AAGTTTGGCAAGTAGAGTGAAGG + Intronic
1194173239 X:90615182-90615204 AAGTTTTCCAAGATGAGAAAAGG - Intergenic
1195739618 X:108050459-108050481 AAGTTCTCCAGGATGGGTCACGG - Intronic
1197199555 X:123736130-123736152 AAGTTTTCCAGGAAGGATGATGG - Intergenic
1197570573 X:128146473-128146495 AAGGTCTGCTAGAAGAGTGCTGG - Intergenic
1197900403 X:131365599-131365621 AAGTTGTCTGAGGAGAGTGAAGG - Intronic
1199024999 X:142926147-142926169 AAGTTCTACAAGAAAATTTAGGG + Intergenic
1200036776 X:153336054-153336076 CATTTCTCCAAGAAGATTCATGG - Intronic
1200175596 X:154113719-154113741 AAGTTATCCTTCAAGAGTGATGG - Intergenic
1200699240 Y:6388001-6388023 ACTTTCTCCAAGCAGAGGGAGGG + Intergenic
1201034871 Y:9776697-9776719 ACTTTCTCCAAGCAGAGGGAGGG - Intergenic
1201713125 Y:17013858-17013880 ATATCCTCCAAGAAGAGAGAAGG + Intergenic