ID: 929974126

View in Genome Browser
Species Human (GRCh38)
Location 2:46616051-46616073
Sequence GCGCGCGCGCGCGTGGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 705
Summary {0: 1, 1: 1, 2: 25, 3: 104, 4: 574}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929974122_929974126 30 Left 929974122 2:46615998-46616020 CCAGAAAATAGAAATATCTCAGA 0: 1
1: 0
2: 1
3: 71
4: 623
Right 929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG 0: 1
1: 1
2: 25
3: 104
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929974126 Original CRISPR GCGCGCGCGCGCGTGGGCGG AGG Intronic
900100686 1:960851-960873 GCGAGCGGACGCGAGGGCGGGGG - Intronic
900113733 1:1020065-1020087 GAGCGCGGGCGGGCGGGCGGGGG - Intergenic
900162827 1:1232420-1232442 GCGCGCGCGGGCGCGGGGGGAGG - Exonic
901242854 1:7704928-7704950 GCGCGTGCGGTCGAGGGCGGCGG + Intronic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
901875904 1:12167046-12167068 GCGCGAGGGCGCGAGGGCAGGGG + Exonic
902286118 1:15409804-15409826 CCGCGCGGGCCCGGGGGCGGGGG + Intergenic
902431600 1:16367520-16367542 ACGCGCGCGTTAGTGGGCGGAGG - Intronic
902451435 1:16499170-16499192 GGGGGTGCGCGCGTGCGCGGGGG - Intergenic
902501446 1:16914148-16914170 GGGGGCGCGCGCGTGCGCGGGGG + Intronic
902501448 1:16914152-16914174 GCGCGCGCGTGCGCGGGGGCGGG + Intronic
903043948 1:20552434-20552456 GCGCGAGCCTGCGTGGGGGGAGG + Exonic
903155610 1:21440445-21440467 GCGCGGGGGCGGGTGGGAGGTGG + Intronic
903193478 1:21669144-21669166 GCGCGGGCGGGCGGGGACGGAGG - Intronic
903389480 1:22953857-22953879 GTGCGCGCGCGCCTGGCCGCGGG - Exonic
903476021 1:23619660-23619682 GGGTGCGCCCGCGTGGGCGTGGG + Intronic
903476023 1:23619666-23619688 GCCCGCGTGGGCGTGGGCGAGGG + Intronic
903596989 1:24502743-24502765 GCGGGGGCGCGCGGGGGCCGGGG - Intronic
903750189 1:25616723-25616745 GCGCGCGTGGGCGTGGCCGGCGG + Intergenic
903792607 1:25905616-25905638 GAGCCCGCGCGCGTGGGAAGGGG + Intronic
904160434 1:28518638-28518660 GCGCGCGGCCGCCCGGGCGGGGG + Intronic
904528847 1:31155131-31155153 GGGCGCGGGCGCGGGGCCGGAGG + Intergenic
904563389 1:31413316-31413338 GCGCGCGCGGGCGGGCGCCGGGG - Intronic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
907278145 1:53328139-53328161 GGGAGCGCGCGCGCTGGCGGCGG - Intergenic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
908014121 1:59814527-59814549 AAGCGAGCGCGCGTGCGCGGCGG - Intergenic
908501103 1:64744889-64744911 GCGCGGGCGCGCCTGTGCGCCGG + Intergenic
908534874 1:65067566-65067588 GCGGCCGGGCGCGGGGGCGGCGG - Intergenic
909622375 1:77683047-77683069 GTGCGCGCGCACGTGTGCGCGGG - Intronic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
910694213 1:89995016-89995038 GCGGGCCCTCGCGTGGGGGGCGG - Intergenic
910760933 1:90730439-90730461 GCGTGCGCGCGCCTGGGTGTGGG - Intergenic
912411566 1:109483929-109483951 GGGCGGGCGCGCGTCCGCGGCGG + Exonic
912416238 1:109509766-109509788 GCGCGTGCGCGCGGCGGGGGCGG + Intergenic
912717081 1:111990235-111990257 AGGGGCGCGCGCGTGAGCGGGGG + Intergenic
912717083 1:111990239-111990261 GCGCGCGCGTGAGCGGGGGGTGG + Intergenic
915722166 1:157993549-157993571 GGGCGGGCGCGGGCGGGCGGGGG + Intronic
916651666 1:166839609-166839631 GTGCGCGCGGGCGGGGGCGGCGG + Intronic
916714798 1:167439669-167439691 GCGCCCTCGCGCGTGCGCAGAGG + Intronic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
918048346 1:180954407-180954429 ACGCGTGCGCGCGTGTGCTGGGG - Intergenic
920029196 1:203026491-203026513 GCGGCCGCGCGCTTGGGCGGCGG + Intronic
920528739 1:206686154-206686176 CCCCGCGCGGGCGTGGGAGGGGG - Intronic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
920922641 1:210311135-210311157 GTGCGCGCGCACGTGGCGGGGGG - Intergenic
921432823 1:215083085-215083107 GCAGGCGCGCGCGGGGGCGGCGG + Intronic
921603981 1:217135518-217135540 GGGCGCGCGCGCGGCGGCGGCGG + Intronic
922196509 1:223364276-223364298 GCGCGCGGGCGCCTCCGCGGGGG - Intergenic
922196521 1:223364312-223364334 TCGCGAGCGCGCGGCGGCGGCGG + Intergenic
922419826 1:225452068-225452090 GTGGGCGCGGGCGTGGGCAGCGG - Intergenic
922577049 1:226667852-226667874 GTGCGCGCGCGCGTGCGAAGTGG + Intronic
922581769 1:226703536-226703558 GGGCTTCCGCGCGTGGGCGGCGG - Intronic
922648720 1:227318511-227318533 GTGTGCGCGCGCGTGTGCCGGGG - Intergenic
922958553 1:229625807-229625829 GCGCGGGCGGGCGGGGGCCGGGG - Intronic
922958556 1:229625813-229625835 GCGCGCGCGCGGGCGGGCGGGGG - Intronic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
923055900 1:230425937-230425959 GGGGGCGGGCGCGCGGGCGGCGG - Intergenic
923400762 1:233614043-233614065 GCGCGCGGGGGAGCGGGCGGCGG + Exonic
923506790 1:234611157-234611179 GCGAGGGCGCGAGTGGGGGGGGG + Intergenic
923684139 1:236142391-236142413 GGGCGCGCGGGCCGGGGCGGGGG + Intergenic
923684149 1:236142411-236142433 GGGCGCGCGGGCCGGGGCGGGGG + Intergenic
923783230 1:237043297-237043319 GTGTGCGCGCGCGCGGGTGGTGG + Intronic
923783232 1:237043301-237043323 GCGCGCGCGCGGGTGGTGGTGGG + Intronic
924289659 1:242524518-242524540 GCGGGCGGGGGCGGGGGCGGGGG + Exonic
1062843862 10:689920-689942 GCGCGCGCGCGCGGGGCGCGAGG + Intergenic
1063593147 10:7410976-7410998 GAGCGGGCGCGCGAGGGAGGCGG - Intronic
1063624804 10:7679005-7679027 GTGCGCGCGCGCGCGGAGGGAGG - Intergenic
1064384760 10:14879613-14879635 GCGCGCGTGGGTGTGGGCGTCGG + Intronic
1065099906 10:22321894-22321916 GGGCGCGCGCTCGCGGGCGCGGG - Intronic
1065100390 10:22325624-22325646 GCGGGCGGGCGGGCGGGCGGGGG - Intronic
1065520573 10:26567291-26567313 GCGGGCGCGGGCGGCGGCGGCGG - Exonic
1065520575 10:26567297-26567319 GCGGGCGCGGGCGCGGGCGGCGG - Exonic
1065712828 10:28533504-28533526 GCGGGCGGGCGCGCAGGCGGCGG - Exonic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1067572778 10:47384164-47384186 CCGCGAGCGGGCGCGGGCGGCGG - Intronic
1067650710 10:48152941-48152963 GTGCGCGCGCGTGTGGGAAGGGG - Intergenic
1069849652 10:71396791-71396813 GAGCGCGGGCGGGCGGGCGGGGG + Intergenic
1069850686 10:71402751-71402773 GCGCGCGCGCACATGCGCGTTGG + Intronic
1071997567 10:91163008-91163030 GCGAGCGCGCGCGCGTGGGGCGG - Intronic
1072169888 10:92848745-92848767 GTGCGCGCGGGGGCGGGCGGGGG + Intronic
1072994194 10:100228970-100228992 GCGCGCGCGCGCGCGCTTGGAGG - Intronic
1073147958 10:101292629-101292651 GCGCGCGTGCGTGTGCGCGGCGG - Intergenic
1073503841 10:103967036-103967058 GCGCGCGTGCGCGGGGCCAGAGG + Intergenic
1073577827 10:104640537-104640559 GCGTGCGCGTGCGTGCGCGCAGG - Intergenic
1073577833 10:104640568-104640590 GCGCCCCCGCGCGGGGGCGTGGG - Intergenic
1074088628 10:110226943-110226965 GGGAGCGCGCGCGTGAGGGGAGG + Intronic
1074533202 10:114310950-114310972 GCGGGCGGGCGGGTGGGTGGCGG - Intronic
1074618377 10:115093128-115093150 GTAGGCGCGCGCGAGGGCGGGGG + Intergenic
1074618379 10:115093132-115093154 GCGCGCGCGAGGGCGGGGGGCGG + Intergenic
1075040626 10:119104383-119104405 GGGCGGGCGGGCGAGGGCGGCGG - Intronic
1076683547 10:132186996-132187018 GCGGGCGGGCGGGCGGGCGGGGG - Exonic
1077010089 11:375786-375808 CCGCGCGGGGGCGAGGGCGGGGG + Intronic
1077076885 11:706086-706108 GGGCGGGCGCGCGGGGGAGGAGG - Intronic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077891156 11:6419071-6419093 GCCCGCGCGCTCCTGGGCGGGGG - Intronic
1078988026 11:16613594-16613616 GCGCGCGCGCGTGGAGGCAGCGG - Intronic
1079291132 11:19188654-19188676 GTGGGCGCGCGCGTTGGCAGGGG + Intronic
1081528275 11:43942074-43942096 GTGCGCGCGCGCGCCTGCGGAGG + Intronic
1081528277 11:43942076-43942098 GCGCGCGCGCGCCTGCGGAGGGG + Intronic
1081927890 11:46846008-46846030 GCGTGGGCGCTCGTGTGCGGCGG - Intronic
1082787420 11:57324632-57324654 GCGCGTGTGCGCGGAGGCGGAGG - Intronic
1082787487 11:57324825-57324847 GCGAGCGCGTGAGTGCGCGGGGG - Intronic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1083227515 11:61294425-61294447 GCGTGTGCGCGCGTGGGGGTGGG - Intronic
1083599643 11:63938939-63938961 GAGGGCGCGCGGTTGGGCGGGGG + Intronic
1083933379 11:65857923-65857945 GCGTGCGCGCCCGTGGGCGCCGG - Intronic
1084000122 11:66291686-66291708 GCGAGCGCGAGCGCGGCCGGAGG + Intergenic
1084146153 11:67266429-67266451 GGGCGCGGGCGCGCGGGCGGCGG + Exonic
1084146155 11:67266435-67266457 GGGCGCGCGGGCGGCGGCGGCGG + Exonic
1084265727 11:68004199-68004221 GCGCGCGCGCGCGTGTGTGCAGG + Intronic
1084265729 11:68004201-68004223 GCGCGCGCGCGTGTGTGCAGGGG + Intronic
1086887744 11:92224602-92224624 GGGCGCGCGGGAGGGGGCGGCGG - Intergenic
1087634508 11:100687456-100687478 GCGAGCGCAGGCGCGGGCGGCGG - Intergenic
1088566743 11:111180600-111180622 GCGCGCACGCGTGTGGTGGGGGG - Intergenic
1088606844 11:111540931-111540953 GAGTGCGCGCGCTGGGGCGGGGG + Intronic
1090155812 11:124437670-124437692 GCGCGCGCGTGCGTGCGTGCTGG + Intergenic
1090699135 11:129279118-129279140 GCGGGCGCGCGGGAGGGCCGGGG - Intronic
1090699334 11:129279694-129279716 GCGCGCGGCCGAGGGGGCGGGGG + Intergenic
1092163579 12:6329327-6329349 GGGCGCGGGCGGGAGGGCGGCGG + Exonic
1092564222 12:9648020-9648042 TCCCGCGGGCGCGTGGGAGGTGG + Intergenic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1092843342 12:12562956-12562978 GGGCGCGCGGGCGCGGGAGGAGG - Intergenic
1093547842 12:20369211-20369233 GCGCGCGCGCGCGTGGGTCGGGG + Intergenic
1094218509 12:27970347-27970369 GCGGGCGGGCGCGCGGGGGGCGG + Intronic
1096101296 12:48971832-48971854 GCGCGCGCGCGCGCGCTGGGAGG - Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096251030 12:50032864-50032886 GCGGGGGAGCGCGTGGGAGGGGG - Intronic
1096254956 12:50057347-50057369 GCGCGCGCGTGTGTGCGCGCAGG - Intergenic
1096495464 12:52037172-52037194 GGCCGCGGGCGCGGGGGCGGGGG + Intronic
1096741255 12:53695657-53695679 GCGAGGGCGCGCTGGGGCGGGGG + Intergenic
1096994614 12:55830808-55830830 GCGCGCGTGCGCGCGGTGGGGGG - Intronic
1096994618 12:55830812-55830834 GCGCGCGCGCGTGCGCGCGGTGG - Intronic
1097895863 12:64824581-64824603 GCGAGCGAGCGCGTGGGAGACGG - Exonic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1101680008 12:106955778-106955800 GCACGAGCGCGCGTGCGCGTCGG + Exonic
1101910573 12:108857667-108857689 GCGCGCGCCGGCGCGGGAGGCGG - Intergenic
1102084395 12:110124283-110124305 GCGCGCGCGCGCACGAGCTGGGG - Intergenic
1102645427 12:114400625-114400647 GCGAGCGCGCCCGGAGGCGGAGG + Intronic
1103348348 12:120265742-120265764 GCGGGCGCGGGCGCGCGCGGCGG - Exonic
1103509778 12:121466771-121466793 GCCGGCACGCGCGTGGGCCGCGG + Intronic
1103563492 12:121804315-121804337 GCGAGCGGGCGGGCGGGCGGCGG + Intronic
1103595489 12:122022379-122022401 GCGCGAGCGCACCTGGGCAGCGG - Intronic
1103764368 12:123270814-123270836 GCGCGCGGGCGTGGGGGCAGTGG - Intronic
1103764526 12:123271268-123271290 GCGGGCGAGGGCGAGGGCGGGGG - Intronic
1103800321 12:123533638-123533660 GCGGGCGCGGGCACGGGCGGCGG + Exonic
1103971744 12:124676988-124677010 GCGCGCGCGAGCATGTGTGGGGG + Intergenic
1104568420 12:129904361-129904383 GCGCGGACGCGCGGTGGCGGCGG + Intergenic
1105049689 12:133037515-133037537 GCGCGGGCGCGACTCGGCGGCGG + Intronic
1107467546 13:40664822-40664844 GCGGGCGCGGGCGGTGGCGGTGG - Intronic
1107467548 13:40664828-40664850 GCGGGGGCGGGCGCGGGCGGTGG - Intronic
1107468026 13:40666651-40666673 GCGCGCGCCGCCGCGGGCGGGGG - Intergenic
1108542073 13:51453637-51453659 GCGCGAGCGGGCGCGGGCGGGGG + Intronic
1111183990 13:84705235-84705257 GCGCGCGCGCGCGTGCGTGTTGG + Intergenic
1111672615 13:91348530-91348552 GTACGCGCGAGGGTGGGCGGAGG + Intergenic
1112504569 13:99968438-99968460 GCGCGCGTGCGTGGGGTCGGGGG - Intronic
1112507039 13:99981601-99981623 GTGCGCGCGCGGGTGCGCGCAGG + Intergenic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1113656918 13:112073114-112073136 CCGCGCGCGGGCCTCGGCGGGGG - Intergenic
1113737643 13:112689919-112689941 GCGAGCGCGGGTGTGGGCGCGGG + Intergenic
1114037864 14:18646300-18646322 GCGAGCGAGCGCCTGGGAGGGGG - Intergenic
1114120757 14:19668728-19668750 GCGAGCGAGCGCCTGGGAGGGGG + Intergenic
1115576224 14:34714610-34714632 GCGGGCGAGCGGGTGGGCAGCGG + Exonic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1118323160 14:64765046-64765068 GCGCGCGCGCGGGTGGTGGATGG + Intronic
1118776848 14:68978826-68978848 GCGCGCACGGGAGGGGGCGGGGG - Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1119325886 14:73759428-73759450 GGCCGCGCCCGGGTGGGCGGGGG + Intronic
1120168065 14:81221041-81221063 GCGCAGGCGCGCCGGGGCGGAGG + Intronic
1120881057 14:89416116-89416138 GCGCGCGCGCGCGTGCTGGGTGG - Intronic
1120881455 14:89417501-89417523 GCGGCCGCGACCGTGGGCGGTGG + Intronic
1121439333 14:93939032-93939054 ACGCGCGCGCGCATGGGAGGCGG - Intronic
1121648171 14:95535183-95535205 GCGGGCTCGGGCGCGGGCGGCGG + Exonic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122275120 14:100587200-100587222 GGGCGCGGGCGCGGGCGCGGAGG - Intronic
1122582054 14:102777314-102777336 GGGCGCGCGCGGGGGGCCGGCGG + Intergenic
1122582070 14:102777372-102777394 GCTCCCACGCGCGCGGGCGGCGG + Intergenic
1122975344 14:105168587-105168609 CGGCGCGCGGGCCTGGGCGGCGG + Exonic
1122993333 14:105249099-105249121 GCGCGCGGGCGCGGGGGCCGCGG - Intronic
1122993334 14:105249105-105249127 GTGGGCGCGCGCGGGCGCGGGGG - Intronic
1122993336 14:105249107-105249129 GCGTGGGCGCGCGCGGGCGCGGG - Intronic
1124014340 15:25863124-25863146 GCGCGGGCGGGCGTGAGCGGCGG - Exonic
1124109529 15:26773152-26773174 GCGCGCGCGGGCGCGGGGCGGGG + Intronic
1124640361 15:31392820-31392842 GCGGGCGGGGGCGGGGGCGGGGG - Intronic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1125270535 15:37934101-37934123 GCGCGCGCGCGTGTGTGTAGGGG - Intronic
1125270537 15:37934103-37934125 GCGCGCGCGCGCGTGTGTGTAGG - Intronic
1125805628 15:42491116-42491138 GTGCGCCTGCGCGTTGGCGGCGG - Intronic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1126767053 15:52019604-52019626 CCGCGCGGGCGGGCGGGCGGCGG + Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1127867253 15:63042762-63042784 GCGAGCGCGCGGTCGGGCGGAGG - Exonic
1127922626 15:63504981-63505003 GCGGGCGCGTGCGGGAGCGGCGG + Intronic
1127931642 15:63600982-63601004 GCGCGCGCGGGCGCGGGGGCTGG - Intronic
1127931643 15:63600986-63601008 GCGGGCGCGCGCGGGCGCGGGGG - Intronic
1128455633 15:67829871-67829893 CCGCGAGCGCGCGTGGCCGCCGG - Intronic
1128605385 15:69033070-69033092 GCCGGCGCGGGCGTGGGCGGGGG - Exonic
1128791136 15:70434705-70434727 GCGCGCGCGCGGGTGGAGCGGGG - Intergenic
1128791138 15:70434707-70434729 GCGCGCGCGCGCGGGTGGAGCGG - Intergenic
1129503207 15:76059798-76059820 GGGCGCGCGCGCGCGGCCGGCGG + Intergenic
1129503224 15:76059871-76059893 GCGCGCGCCCCCGAGCGCGGTGG + Exonic
1129862399 15:78872804-78872826 GCGCAGGGGCGCGTGCGCGGCGG + Exonic
1130002613 15:80060055-80060077 GCGCGGGCGCCCGCGGCCGGGGG + Intronic
1130224410 15:82046309-82046331 GCGAGCGCGGGGGTGGGGGGTGG - Intergenic
1130849322 15:87778448-87778470 GCGCGCGCGCGCGTGCACACAGG - Intergenic
1131186040 15:90275057-90275079 GAGCGCGCGGGCCCGGGCGGCGG - Exonic
1132055545 15:98648487-98648509 GCGAGCGGGCGCGTGTGCGCGGG + Intergenic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1132683270 16:1152531-1152553 GCCCGCGCGCGCGTGTGTGATGG - Intergenic
1132915210 16:2340396-2340418 GCGGGCGCGGGCGCGGCCGGAGG + Intronic
1133286671 16:4693914-4693936 GCGCGGGCGGGCCCGGGCGGGGG + Intronic
1134070054 16:11255359-11255381 CCGCGGGCGCGCGGGGGCCGCGG + Exonic
1135342928 16:21664240-21664262 GCGCGCGGGGGCCTGGGCGGAGG + Intergenic
1136365000 16:29805912-29805934 GCGAGCGCGCGCGTGGCCAGCGG - Intergenic
1136399871 16:30011441-30011463 GCGCGCGCGGGCGGGGGCGGGGG - Intronic
1136399876 16:30011447-30011469 GTGGCCGCGCGCGCGGGCGGGGG - Intronic
1136843113 16:33554972-33554994 GCGGGGGCGCGCGTGGCTGGGGG - Intergenic
1137454732 16:48609742-48609764 CCGCGGGCGCGCGGGGGCGGCGG + Intronic
1138178708 16:54928780-54928802 CCGCGCGGGCGCGCGGGCCGCGG + Intergenic
1138247904 16:55480549-55480571 GCGTGCGCGCGCCTGGCTGGAGG + Intronic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1138539852 16:57681374-57681396 GTGCGCGCGTGCGTGCGCGCAGG + Intronic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1139473740 16:67192215-67192237 GCGGGCGGGCGCGATGGCGGAGG + Exonic
1139754656 16:69132624-69132646 GCGCGCGCGCACGTGGGGCCGGG + Exonic
1140462249 16:75148966-75148988 GGGCGCGCGCGCGCGGGACGAGG + Intronic
1141665288 16:85462666-85462688 GCGCGGGCGGGGGAGGGCGGCGG + Intergenic
1203153278 16_KI270728v1_random:1855270-1855292 GCGGGGGCGCGCGTGGCTGGGGG - Intergenic
1143056420 17:4165533-4165555 GCGAGCGTCCGCGTGGTCGGGGG + Exonic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143247798 17:5500779-5500801 GCGCGCGGGCGGGAGGGCGCAGG - Intronic
1145197641 17:20908662-20908684 GCGCGCCTGCGCGTGGGGGGGGG - Intergenic
1146439045 17:32877289-32877311 GCGCACGCGCGGGTGGGCGGCGG + Intergenic
1147110454 17:38257399-38257421 GCGCGCGCACGCCGGGGCAGAGG + Intergenic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147440332 17:40443661-40443683 GCGGGCGCGCGGGCGAGCGGCGG - Exonic
1147617080 17:41836025-41836047 GCTCGGGCGCGCGTGTGAGGCGG + Intronic
1147742746 17:42678124-42678146 GCGCGCGCCCGCGGAGGCCGCGG - Intergenic
1147742747 17:42678130-42678152 ACGCGCGCGCGCGCCCGCGGAGG - Intergenic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1147990005 17:44326802-44326824 GCACGCGCGGGCGGTGGCGGAGG + Intergenic
1148271728 17:46266919-46266941 GCGCGCGCGCGGCCGGGCGGCGG - Intergenic
1148284058 17:46372676-46372698 GGGCGCGCGCGCGGGCTCGGCGG - Intergenic
1148284092 17:46372782-46372804 GGGCGCGCGCGCGGCGGGGGCGG + Intergenic
1148306279 17:46590597-46590619 GGGCGCGCGCGCGGGCTCGGCGG - Intergenic
1148306313 17:46590703-46590725 GGGCGCGCGCGCGGCGGGGGCGG + Exonic
1148419053 17:47531032-47531054 GCGCGCGCACGCCTGGGCAGAGG - Intronic
1148818258 17:50346071-50346093 GCGAGCGCGCGCACGGGCGCGGG - Exonic
1149512664 17:57256341-57256363 GTGCGCGCGCGGGCAGGCGGGGG + Intronic
1149772354 17:59331849-59331871 GGCCGGGCGCGCGTGGGCGTGGG + Intronic
1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG + Intergenic
1150802339 17:68291822-68291844 GCGCGGGCGGGACTGGGCGGTGG - Intronic
1151058703 17:71064982-71065004 GCGCGCGCGCGCCTGTGTGTAGG - Intergenic
1151296914 17:73192845-73192867 GGGCGGGCGCGAGGGGGCGGGGG - Intronic
1151708401 17:75785000-75785022 GCGTGCGCGCGCGGCGGGGGGGG - Intronic
1152034746 17:77865212-77865234 GTGCGCCCGCGCGTGTGCGTGGG - Intergenic
1152049178 17:77959066-77959088 CGGCGCGGGCGAGTGGGCGGCGG - Intergenic
1152353796 17:79797355-79797377 CCGAGCGCGCGAGTGGGAGGGGG + Intronic
1152406616 17:80101604-80101626 GCCAGGGCGCGCGTGCGCGGAGG + Intergenic
1152541916 17:80981141-80981163 CCGCGGGGGCGCGGGGGCGGGGG - Intergenic
1152689658 17:81712263-81712285 GCGCGCGCGCGCCCCGGGGGCGG - Intronic
1152697319 17:81803766-81803788 GCGCGCGGGCGTGGGGGCCGTGG - Intergenic
1152708932 17:81860584-81860606 GCGCGCGCGGGCGGGGGGGCAGG - Exonic
1152728617 17:81959579-81959601 GTGCGCGCGGGCCTGAGCGGCGG - Intronic
1152923988 17:83079423-83079445 GGGCGCGGGCGCCGGGGCGGGGG - Intergenic
1153219379 18:2847961-2847983 GCGCGCCCGGGCCGGGGCGGTGG + Intronic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1153489328 18:5630765-5630787 GCGAGCGCGCGGCTGGGAGGCGG - Intergenic
1153688346 18:7567758-7567780 GGGTGGGCGCGCGAGGGCGGAGG - Exonic
1155570348 18:27185378-27185400 GCCCGGGCGGGCGGGGGCGGGGG - Intergenic
1156000355 18:32378058-32378080 GCGCGCGGGCGCTTTGGAGGAGG + Intronic
1157354119 18:46917562-46917584 GCGGTCGCGCGGGTGGGCAGGGG - Intronic
1157464257 18:47930675-47930697 GCGGGCGCGCGCCTGAGGGGAGG - Intronic
1159952709 18:74496596-74496618 GAGCGCGCGGTCGGGGGCGGAGG + Intronic
1160164299 18:76496152-76496174 GGGCGGGCGCGCGGGGGCGGGGG + Intronic
1160204518 18:76822323-76822345 GGGCGCGGGCGCGGGCGCGGTGG - Intergenic
1160429132 18:78799603-78799625 GTGCGCGCGCGCGTGTGCAGTGG - Intergenic
1160500712 18:79400125-79400147 TCGCGCGCGCGCGAGGGGGCGGG + Intronic
1160500714 18:79400127-79400149 GCGCGCGCGCGAGGGGGCGGGGG + Intronic
1160500718 18:79400133-79400155 GCGCGAGGGGGCGGGGGCGGGGG + Intronic
1160518854 18:79493265-79493287 GCGCGCGAGCGCGTGGCACGGGG - Intronic
1160631222 18:80247446-80247468 GCCCGCGCTCGCTTGGCCGGCGG + Exonic
1160668525 19:344724-344746 GCGCGGACGCGCGGGGGCGGGGG + Intronic
1160739637 19:680006-680028 GTGCGCGCGGGCCGGGGCGGGGG - Intronic
1160858715 19:1228722-1228744 GCGCGAGCTCGCCCGGGCGGGGG - Exonic
1160873142 19:1286002-1286024 GGTCGCGCGCGCGGAGGCGGGGG + Intergenic
1160896934 19:1407540-1407562 GCGCGCCCGGGCGTGCGCAGGGG + Intergenic
1160909003 19:1466252-1466274 GCGCACGCGGGCGTCGGCGGAGG - Exonic
1160937817 19:1605482-1605504 GCGCACGCGCGCGGGGAGGGCGG + Exonic
1160991920 19:1863620-1863642 CCGAGCGCGGGCGTCGGCGGCGG - Intergenic
1161068936 19:2250998-2251020 GCCTGCGCGCACCTGGGCGGCGG - Exonic
1161150030 19:2702693-2702715 GCGCTCGCGGGCCGGGGCGGAGG - Exonic
1161203592 19:3029071-3029093 GCGCGCGCGCCCGGGGTCGTGGG + Exonic
1161203673 19:3029315-3029337 CCGCGGGCGCGTGGGGGCGGCGG - Intronic
1161401598 19:4067972-4067994 GCGACCGCGCGCCTGGGGGGGGG + Intergenic
1161461567 19:4400590-4400612 GGGGGCGCGCGCGGGGGCCGGGG - Intergenic
1161643070 19:5436362-5436384 GCGCGCGCGCGCGTGCGGGGAGG + Intergenic
1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG + Intergenic
1161707240 19:5827855-5827877 GCGCGCGCGTGCGCGGTTGGGGG + Exonic
1161752561 19:6109044-6109066 GCGAGCGCGCTGGTGGGCGGTGG + Intronic
1161802579 19:6424394-6424416 GCGCGCGCAGGCGGGGGAGGGGG - Intronic
1161802583 19:6424400-6424422 TCGCGCGCGCGCGCAGGCGGGGG - Intronic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1161857191 19:6772743-6772765 GCGTGCGGGCGGGTGGGTGGTGG + Exonic
1162033161 19:7925937-7925959 GCGCGCCGGGGCGGGGGCGGTGG - Intronic
1162461762 19:10817821-10817843 GCGCGCGCACGCGTGCGTGCCGG + Intronic
1162742688 19:12782649-12782671 GTGCGCGCGTGCGTGGGCGGTGG + Intronic
1162954504 19:14090787-14090809 GGGCGCGCGTGCGGCGGCGGCGG - Intronic
1163282751 19:16327040-16327062 GGCCGCGCGCAGGTGGGCGGGGG - Exonic
1163320552 19:16572271-16572293 GCGCGAGGGCGCGCGGGTGGCGG - Exonic
1163329682 19:16628338-16628360 GCCTGCGCGCGCTTGCGCGGAGG - Intronic
1163525914 19:17821364-17821386 GCGCTAGTGCGCGTGTGCGGGGG - Exonic
1163598192 19:18232677-18232699 GCGCGCGCGCGCGTGAGACTGGG - Intronic
1163631294 19:18419274-18419296 GCGCGTGCGCGCTCCGGCGGCGG + Intronic
1163634964 19:18433474-18433496 GGGCGGGGGCGCGTCGGCGGGGG + Intronic
1163666706 19:18606903-18606925 GCCCGCGGGCGGGCGGGCGGCGG - Intronic
1163720502 19:18896168-18896190 GCGCGCGGGCGGGAGAGCGGAGG + Intronic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164648138 19:29873750-29873772 GCGCGGGCGCGGGGGCGCGGGGG - Intergenic
1165157569 19:33797290-33797312 GCGCGCGCGCGCGCTTGTGGAGG + Intronic
1165236851 19:34428580-34428602 GGGCGCGCGCGCGTGAATGGCGG + Intronic
1165349399 19:35268138-35268160 GCGCGCACGCAGGCGGGCGGCGG - Intergenic
1165349523 19:35268525-35268547 CTGCGCGCGCGCGGCGGCGGCGG - Intergenic
1165668594 19:37655497-37655519 GCTAGCGCGCGGGGGGGCGGAGG + Intronic
1166361318 19:42254029-42254051 CCGCGCGAGCCCGGGGGCGGCGG + Intronic
1166737184 19:45093135-45093157 GCGCGCGCGGGGCTCGGCGGAGG + Exonic
1166802585 19:45467640-45467662 GCGCGCGCGCGAGCGAGCGAGGG + Intronic
1166975052 19:46601104-46601126 GCGAGCGCGCGCGCGCCCGGCGG + Intronic
1167018949 19:46860562-46860584 GGGCGAGCGCGCGTGCGCGGGGG - Intergenic
1167134529 19:47608989-47609011 GGGCGCGCGGGCCTGGGCGCGGG + Intronic
1167649271 19:50720462-50720484 GCGCGCACGTGCGTGTGTGGTGG - Intergenic
1168336526 19:55600356-55600378 GTGCGCGCGCGCGGGGGCAACGG - Intronic
1168408078 19:56121055-56121077 GGGCGAGCGCGACTGGGCGGCGG - Intronic
1168452453 19:56477128-56477150 GCGGGTGCTTGCGTGGGCGGTGG - Intronic
1168462080 19:56567682-56567704 GCGAGCGCGCGCGGGGATGGCGG + Exonic
1202710752 1_KI270714v1_random:18287-18309 GCGGGCGGGCGGGCGGGCGGGGG + Intergenic
1202710754 1_KI270714v1_random:18293-18315 GGGCGGGCGGGCGGGGGCGGCGG + Intergenic
925288864 2:2733479-2733501 GCCCGCACACGCGTGTGCGGTGG - Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
926090114 2:10043936-10043958 GGGCGCGCCCGGGTCGGCGGGGG + Intronic
927472177 2:23385098-23385120 ACGGGCGCCCGAGTGGGCGGGGG - Intergenic
927652439 2:24920453-24920475 GCGGGCGCGGGCGCGGGCGTGGG + Intergenic
927652441 2:24920459-24920481 GCGGGCGCGGGCGTGGGCGGTGG + Intergenic
927714210 2:25341907-25341929 GGGCGCGCGGGCGGCGGCGGCGG - Intronic
927751415 2:25673583-25673605 GCGCGAGGGCGCGAGGGCGGAGG + Exonic
929033714 2:37671807-37671829 CCGGGCGCGCGCGCGGGGGGGGG + Exonic
929313284 2:40450370-40450392 GCACGCGCGCGCGCTGGTGGGGG + Intronic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929511545 2:42568948-42568970 TCGCGAGCCCGCGTGGGGGGAGG - Intronic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
930136038 2:47905401-47905423 GCGGGCGGGCGGGCGGGCGGGGG - Intronic
931869059 2:66440040-66440062 GCGCGCGCGCGCGTGTGTGTTGG - Intronic
932231480 2:70087515-70087537 GCGGGCGGGCGGGTGGGCGAGGG - Exonic
932567264 2:72917805-72917827 GAGCGCGAGCGGGCGGGCGGGGG + Exonic
933791827 2:85889098-85889120 GGCCGCGCGCCCGGGGGCGGGGG - Intergenic
934566978 2:95346603-95346625 GCGCGGGGGCGCGGCGGCGGCGG - Intronic
937203895 2:120223583-120223605 GCGCGCGCGAGCAGAGGCGGTGG + Intergenic
937221746 2:120346068-120346090 GCGGGCGCGGGCGCGGGCGGGGG + Intergenic
937274134 2:120673323-120673345 GGGGACGCGCGCGTGGGAGGAGG + Intergenic
938258350 2:129877754-129877776 GGGCGGGCGCGCGTGTGGGGGGG + Intergenic
938258357 2:129877776-129877798 GCGGGCGCGCGTGTCGGGGGCGG + Intergenic
938258364 2:129877793-129877815 GGGCGGGCGCGCGTGTGGGGGGG + Intergenic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
939153803 2:138501753-138501775 GCGCGTGCGCGCGGCGGCGGCGG - Intergenic
941020934 2:160407556-160407578 GCGGGCGCGGGCGCGGGCGCGGG + Intronic
941951332 2:171160260-171160282 GCGAGCGGGCGCGGGCGCGGCGG + Intronic
945699433 2:213151796-213151818 GCGCGCGCGTGCGTGTGTGCGGG + Intronic
946219960 2:218217547-218217569 GAGCGCGCGCCCGGGGCCGGGGG + Intronic
947593078 2:231395966-231395988 GCGGGCGGGCGCGGCGGCGGCGG + Intronic
948046713 2:234951559-234951581 CCGCGAGCGGGCGTGGGCGAGGG - Intergenic
948115827 2:235493991-235494013 GCGGGCGCGGGCGCGGGCGAGGG + Intergenic
948115828 2:235493997-235494019 GCGGGCGCGGGCGAGGGCGAAGG + Intergenic
948140862 2:235670837-235670859 GCTGGAGCGCGCGCGGGCGGCGG + Intronic
948140865 2:235670843-235670865 GCGCGCGCGGGCGGCGGCCGGGG + Intronic
948645269 2:239400552-239400574 CCGCGCGCGGCCGTGGGAGGCGG - Exonic
948805703 2:240452793-240452815 GCGCGCACGGCCGAGGGCGGTGG - Intronic
948945674 2:241217921-241217943 GCGGGGGCGCGCAGGGGCGGGGG + Intronic
948945678 2:241217927-241217949 GCGCGCAGGGGCGGGGGCGGGGG + Intronic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079863 2:242088459-242088481 GCGCGGGGGGGCGGGGGCGGGGG - Intergenic
949079867 2:242088465-242088487 GCGGGGGCGCGGGGGGGCGGGGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1168750595 20:278913-278935 GAGGGCGCGCGAGTGCGCGGAGG + Intronic
1168811926 20:710128-710150 GTGCGCCCGAGCGTGGGCCGTGG + Intergenic
1168812015 20:710397-710419 GCGTGCGCGCGCGTGTCTGGGGG - Intergenic
1169262572 20:4149123-4149145 GCGCTCGGGCGCTCGGGCGGGGG + Intronic
1171237050 20:23535479-23535501 GCGCGCGCGCGGGTGAGTGTTGG - Intergenic
1172526579 20:35603358-35603380 GCGCGCGTGTGCGTGTGCAGGGG - Intergenic
1172529310 20:35619118-35619140 GCGCGGGGGCGCGGGGGCTGGGG - Intronic
1172587212 20:36093086-36093108 GCGCGCGTGCGTGTGTGCGCCGG + Intronic
1173279982 20:41618791-41618813 GCGCGCTCGGGCGCCGGCGGGGG + Intergenic
1173582934 20:44160131-44160153 GCGCGGGCGCCCAAGGGCGGCGG - Exonic
1173750061 20:45469700-45469722 GCGCGCGCGGGAGGGGGCGTGGG - Exonic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1174287690 20:49483997-49484019 GCGCCCCCGCCCGTGGGCAGCGG + Intergenic
1174467867 20:50731432-50731454 GCGCGCGCGCGGGCTCGCGGGGG + Intergenic
1174467869 20:50731438-50731460 GCGCGGGCTCGCGGGGGAGGCGG + Intergenic
1175107767 20:56626972-56626994 GCGCGCGCGTGCCTGGGTGCCGG + Intergenic
1175428799 20:58888980-58889002 GACCGCGCGGGCGTGGGCCGGGG - Intronic
1175685238 20:61023898-61023920 GCGAGTGGCCGCGTGGGCGGAGG - Intergenic
1175685287 20:61024062-61024084 GCGAGTGGCCGCGTGGGCGGGGG - Intergenic
1175685307 20:61024120-61024142 GCGAGTGGCCGCGTGGGCGGGGG - Intergenic
1175841311 20:62029463-62029485 GCGCGCGCGCACGTGGGCACTGG - Intronic
1175847476 20:62066124-62066146 GGGCGCGGGCGCCGGGGCGGTGG + Intergenic
1175911502 20:62407312-62407334 GCGCGCGGGCGCGCGGGCAGGGG - Intergenic
1176005860 20:62861917-62861939 GCGTGCGGGCGGTTGGGCGGGGG - Intergenic
1176026167 20:62986612-62986634 GCGGGGGTGCGGGTGGGCGGGGG + Intergenic
1176178539 20:63739524-63739546 GCGCGGGCGCGCGAGGTGGGCGG + Intronic
1176194569 20:63831293-63831315 GCGCGCGCGCGCGGGCGGCGGGG - Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176207177 20:63895383-63895405 GGGCGGGCGCGGGTGGGGGGCGG + Intronic
1176547891 21:8209278-8209300 GGGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176547957 21:8209468-8209490 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176548953 21:8213385-8213407 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176549955 21:8216878-8216900 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176555851 21:8253683-8253705 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176556846 21:8257597-8257619 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176566824 21:8392311-8392333 ATGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176566888 21:8392503-8392525 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176568881 21:8399912-8399934 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574788 21:8436717-8436739 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176576795 21:8444147-8444169 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176577338 21:8446219-8446241 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611402 21:8988010-8988032 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176952651 21:15064896-15064918 GGGCGCGCGCGGGTGGCGGGCGG + Exonic
1179243858 21:39613135-39613157 GCGCGCGGGGGCGTGGGTGCCGG + Intronic
1179457312 21:41508251-41508273 GCGGGCGGGGGCGGGGGCGGCGG + Intronic
1179828666 21:43982601-43982623 CCACGCGCGCCCGTGGGAGGTGG + Exonic
1180461991 22:15573342-15573364 GCGAGCGAGCGCCTGGGAGGGGG - Intergenic
1180843604 22:18970363-18970385 GGGGGCGCGGGCCTGGGCGGGGG - Intergenic
1180950655 22:19719075-19719097 GCGCCTGGGCGCGCGGGCGGGGG + Intronic
1181160739 22:20958088-20958110 GCGGGCGGGCGAGCGGGCGGAGG - Intergenic
1181514388 22:23402721-23402743 GAGCGCGGGCGCGAGGGGGGCGG + Intergenic
1181570930 22:23767557-23767579 GTGCGCGGGCGGGTGGGCAGAGG + Exonic
1182041635 22:27242811-27242833 GTGTGTGCGCGCGTGCGCGGGGG - Intergenic
1182149512 22:28018295-28018317 GTGTGCGCGCGCGGGGGGGGGGG + Intronic
1182321549 22:29481150-29481172 GCAGGCGCGCGGGTGGGGGGAGG + Intronic
1182586298 22:31346016-31346038 GCGCGCGCGCGCCTGCGCGGCGG - Exonic
1183149782 22:36028527-36028549 ACGCACGCACGCGGGGGCGGGGG - Intergenic
1183504672 22:38202442-38202464 GGGCGCGGGCGGGTAGGCGGCGG + Intronic
1183649448 22:39145658-39145680 GCGTGCGTGCGCGCGGCCGGCGG - Intronic
1184035292 22:41915111-41915133 GCGCGGGCTCGGGCGGGCGGGGG + Intergenic
1184337511 22:43862436-43862458 GCGGGCGCGGGCGCGGGCGCGGG - Exonic
1184362092 22:44024676-44024698 GCGTGCGGGCGCCTGCGCGGCGG + Intronic
1184523001 22:45007086-45007108 GGGCGCGCGGCCGGGGGCGGGGG + Intronic
1184645250 22:45891714-45891736 GCGCGGGCGCGTGTGGGCACTGG - Intergenic
1184680781 22:46071328-46071350 GCGCGCGCGGGCGGGGCGGGCGG - Intronic
1184680918 22:46071720-46071742 GCGCGCTCGGGCGGGGACGGCGG + Intronic
1184759516 22:46536843-46536865 GCGTGCGCGCCCGCAGGCGGCGG + Exonic
1185255204 22:49827760-49827782 GCGGGCGCGGGCGCGGGCGCGGG + Intergenic
1185255208 22:49827772-49827794 GCGGGCGCGGGAGCGGGCGGCGG + Intergenic
1185302540 22:50090029-50090051 GCGCGGGCGCGTGCGGGCGGCGG + Exonic
1185349403 22:50326785-50326807 GCGGGCGCGAGCGCGGGCGCGGG - Intronic
1185351750 22:50343259-50343281 GCGCGCACGCTCGCGGCCGGGGG - Intergenic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203252836 22_KI270733v1_random:125768-125790 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1203253837 22_KI270733v1_random:129692-129714 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203254845 22_KI270733v1_random:133204-133226 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260892 22_KI270733v1_random:170854-170876 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1203261893 22_KI270733v1_random:174771-174793 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203262901 22_KI270733v1_random:178283-178305 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
950509990 3:13420285-13420307 GCGCGCGCGGGCGGGAGCGGAGG - Exonic
950710559 3:14810597-14810619 GGGCGCGAGCGCGGGGGCGGCGG - Intergenic
951485207 3:23202975-23202997 GCGCGGCCGCGAGGGGGCGGGGG - Intergenic
951717386 3:25664251-25664273 GCGGGAGCCGGCGTGGGCGGCGG - Exonic
951908270 3:27724143-27724165 GCGCGCTCGCGTGTGTGTGGTGG + Intergenic
952382948 3:32818468-32818490 GCGCGCCCGTTCTTGGGCGGCGG - Exonic
953748735 3:45594168-45594190 GCGCGCGGGCCGGAGGGCGGCGG - Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
956681448 3:71785252-71785274 GCGCGTGTGCGCGTGGGGCGTGG - Intergenic
956681450 3:71785258-71785280 GCGGGCGCGCGTGTGCGCGTGGG - Intergenic
960047257 3:113210811-113210833 GCGCACGCGCGCGTGTGTGTTGG - Intergenic
960281325 3:115784286-115784308 CAGCGCGAGCGGGTGGGCGGGGG + Intergenic
960465934 3:117996885-117996907 GCGCGCGCGCGTGTGAACGGGGG - Intergenic
961540868 3:127598477-127598499 GCGCGCTGGCGCGTGGCGGGCGG + Intronic
962367362 3:134795428-134795450 GTGCGGGCGCGCGTGGGTGTGGG - Exonic
962793954 3:138834914-138834936 GCGCGCGCGCACACGGGCGCGGG - Intronic
963607240 3:147421621-147421643 GCGTGCGCGCGCGTGGCCTGAGG + Intronic
964437988 3:156674445-156674467 GCGCACGCGCGCGCAGGGGGCGG + Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
965590556 3:170357366-170357388 CCGGGCGCGCGCCTGGGGGGAGG + Intergenic
966866127 3:184260047-184260069 GCCCGCGGGCGCCTGGGCCGGGG + Exonic
967924182 3:194633372-194633394 GCGCTCCCGGGCGCGGGCGGCGG + Exonic
968514715 4:1011351-1011373 GGGCGCGCGGGCGGGGCCGGGGG + Intronic
968518368 4:1024177-1024199 GCGGGGGCGCTGGTGGGCGGGGG + Intronic
968583802 4:1406708-1406730 GCGCGCGCTAACGAGGGCGGCGG - Intergenic
968636570 4:1684108-1684130 GCGCGGGCGGTCGTGGGCGCGGG - Intronic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
968908020 4:3463458-3463480 GGGGGCGCGGGCGCGGGCGGCGG + Intronic
969115498 4:4868473-4868495 GCGCGGGGGCGGGTGGGGGGGGG - Intergenic
969379015 4:6782515-6782537 CTGCGGGCGCGCGCGGGCGGTGG - Intronic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
970593186 4:17577177-17577199 GCGCCCGCGCATGCGGGCGGGGG - Exonic
973635876 4:52861959-52861981 GCGAGTGCGCGCGTGGGCTGTGG + Intergenic
974047120 4:56907801-56907823 ACGCGCGCGGGCGTCGGAGGGGG + Intergenic
974047125 4:56907830-56907852 TCGCGGGCGCGCGCGGGCGTCGG + Intergenic
974047129 4:56907836-56907858 GCGCGCGCGGGCGTCGGAGGGGG + Intergenic
975118480 4:70704883-70704905 TCGCGCCCGGGCCTGGGCGGGGG - Intronic
977908461 4:102502365-102502387 GCGCGCGCGCGCACGGAGGGGGG - Intronic
977908465 4:102502369-102502391 GCGCGCGCGCGCGCGCACGGAGG - Intronic
978126842 4:105146191-105146213 GCGCGCGGGGGCGTGTGCGCGGG + Intronic
985068425 4:186144925-186144947 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068427 4:186144931-186144953 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068429 4:186144937-186144959 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985995619 5:3595647-3595669 GGGCGCGCGCGTCGGGGCGGCGG - Intergenic
986402807 5:7396108-7396130 GCGCGCTGACGCGCGGGCGGGGG - Intergenic
987175437 5:15303434-15303456 GTGCGCGCGTGCGTGTGCTGAGG + Intergenic
987303422 5:16617012-16617034 GCGCGGGCGCGCCTGGGTGTGGG + Exonic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
990210780 5:53480175-53480197 GCGCGCGCGCGAGTGTGAGAGGG - Intergenic
990410348 5:55535064-55535086 GCGCGCGGGTTCGCGGGCGGGGG + Intergenic
991435766 5:66596267-66596289 GCAGGCGCGCTGGTGGGCGGAGG - Intergenic
992550075 5:77851558-77851580 GCGCGCGCGCGCGTGTATGTGGG + Intronic
993519463 5:88883240-88883262 GGGAGCGCGCGCGAGGGGGGGGG + Intronic
993905737 5:93621298-93621320 CCGCGCCCGCGAGGGGGCGGGGG - Intronic
993919148 5:93779127-93779149 GCGCGCGCGCGCACGTGCAGGGG + Intronic
994367111 5:98928818-98928840 GAGCGCGCGCGCGACGGCGGCGG - Exonic
995106539 5:108382070-108382092 GCGGGTGCGCGCGCCGGCGGCGG - Exonic
995354696 5:111224333-111224355 GCGAGCGCGGGCGGCGGCGGTGG + Exonic
995512297 5:112921719-112921741 GCGGGCGGGCGCGTTGACGGAGG - Intronic
997237157 5:132279336-132279358 GCGCGCGCGCGCGTGGGTGTCGG - Intronic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
997282265 5:132656513-132656535 GCGCCCCCGCGCGTGGGAGAAGG - Intronic
997582966 5:135028714-135028736 GGGCGCGGGCGCGGGCGCGGAGG - Exonic
998083355 5:139294464-139294486 GCGCGCGCGCGCGTGTGGGCCGG - Intronic
998130288 5:139648334-139648356 GGGCGGGCGCGCGGCGGCGGCGG + Exonic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998151355 5:139759287-139759309 GAGAGAGCGCGCGCGGGCGGTGG - Intergenic
998166669 5:139848278-139848300 CCGCGCGCGCGCGGCCGCGGCGG + Exonic
998166671 5:139848284-139848306 GCGCGCGGCCGCGGCGGCGGCGG + Exonic
999328278 5:150656764-150656786 GAGCGCATGCGCGGGGGCGGGGG - Intronic
999330752 5:150672015-150672037 GCGCGCGTGCGCGTGTGTGTTGG - Intronic
1000665423 5:163989215-163989237 GTGTGCGCGCGCGTGTGGGGGGG + Intergenic
1000665425 5:163989217-163989239 GTGCGCGCGCGTGTGGGGGGGGG + Intergenic
1001065045 5:168529517-168529539 GCGAGCTCGCGCGGGGGCGGTGG + Exonic
1002488762 5:179559104-179559126 GCGCGCGCGCGCCCGGGTGAGGG + Intronic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002580879 5:180208961-180208983 GCGCGGGCTCGCGGGGGCTGGGG - Intronic
1003086262 6:3063826-3063848 GCGCGTTCGCGCGGCGGCGGAGG - Intergenic
1003561993 6:7188253-7188275 GCGCGCGCGCACGTGTGTGACGG + Intronic
1003604011 6:7542786-7542808 GCGCTCGCCCGCGGGGGCTGCGG - Intronic
1004561803 6:16759967-16759989 GCGCGCGCGCGCCGGGCGGGGGG - Intronic
1004615321 6:17282612-17282634 GCGGGCGGGGGCGTGGGGGGGGG - Intronic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1004864121 6:19837247-19837269 GCGCGCGGGCGGGGGCGCGGAGG - Intergenic
1006121168 6:31806834-31806856 GCGAGCCCGCGCGTGGGGCGAGG + Exonic
1006125373 6:31834555-31834577 GCGCGCGCCCGCGCGCGCGCGGG + Intergenic
1006137142 6:31902036-31902058 CCCCGCGCGCGCGGCGGCGGCGG + Intronic
1006204686 6:32330042-32330064 GCGCGCGCGCACGTGTGTTGGGG + Intronic
1006271987 6:32972082-32972104 GAGCGAGCGCGCGCGCGCGGAGG + Exonic
1006271991 6:32972088-32972110 GCGCGCGCGCGCGGAGGGGGTGG + Exonic
1006337526 6:33428192-33428214 GCGGGGGCGCGCGTGTGCGTGGG + Intronic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1007451311 6:41941772-41941794 GCGCGCGCGCGGGCGGCGGGCGG - Exonic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1008160390 6:48068864-48068886 GCGCGCGTGGGGGCGGGCGGCGG + Intergenic
1009437727 6:63636476-63636498 GCGCGCCCGCGCCTCAGCGGCGG - Intronic
1010249879 6:73696313-73696335 GCGCGCGGGCGCGCGGGCCTGGG + Intronic
1010703130 6:79077109-79077131 GGGCGCGCGAGAGTCGGCGGCGG - Intronic
1010781217 6:79947597-79947619 GTGGCCGCGCGCGGGGGCGGGGG + Intergenic
1012450664 6:99349854-99349876 CCGCGCGCGGGCAAGGGCGGCGG + Intronic
1012872903 6:104693061-104693083 GCGCGCGCGCGCTGGGGTGGGGG + Intergenic
1013507567 6:110815234-110815256 GCGCGCGCGCGCGCGAGAGGCGG - Exonic
1013575726 6:111482666-111482688 GCGTGTGCGCGTGTGCGCGGCGG + Intronic
1013836422 6:114341593-114341615 GCGCGCGCGCGCGTGTGTGTTGG + Intronic
1014632352 6:123803237-123803259 GCGCGCGCGCTCGGGGGAGAAGG - Intergenic
1014635958 6:123846823-123846845 GCGCGCGTGCGTGTGTGTGGCGG - Intronic
1018195755 6:161355146-161355168 GTGCGCGCGCCGGTGTGCGGAGG - Intronic
1018876528 6:167826872-167826894 GCGCGGGCGGGTGCGGGCGGCGG + Intergenic
1019703302 7:2485140-2485162 GCGCGCGCGCGCGCGTGTGAGGG - Intergenic
1020418158 7:7969273-7969295 GCGCGCGAGCGTGTGGGAGCCGG - Exonic
1021969376 7:25951404-25951426 GCGCGTGGGGGCGGGGGCGGGGG + Intergenic
1022715188 7:32891997-32892019 GCGCGCGCGCGCGAGGCGGGAGG - Intronic
1023177442 7:37448129-37448151 GCGAGCGCGCTCGTGGGAGGGGG - Intronic
1023810261 7:43906360-43906382 GGCCGCGCGGGCGTGGGGGGCGG - Intronic
1025916841 7:65873122-65873144 GCGCGCGCGGGCGCGGAGGGAGG - Intergenic
1027111308 7:75442248-75442270 CCGGGCGGGCGGGTGGGCGGCGG + Intronic
1029449595 7:100633393-100633415 GTGAGTGCGCGCGCGGGCGGGGG - Intronic
1029496324 7:100896987-100897009 GCGTGCGTGCGCGCGCGCGGCGG + Intergenic
1029536992 7:101162942-101162964 GCGCCGGCGCGCGCGCGCGGCGG + Exonic
1031043554 7:116862929-116862951 GCGGGCGCGGGGGAGGGCGGCGG + Intronic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1031531868 7:122886186-122886208 GCGCCGGGGCGCGCGGGCGGCGG - Exonic
1031982307 7:128135850-128135872 GCGCGCGAGCTCGGCGGCGGCGG + Intergenic
1032013408 7:128360964-128360986 GCGCGCGCGTGCAGGGGCAGGGG - Intronic
1032710931 7:134459283-134459305 GCGCGGGCGAGCGTTGGGGGCGG - Intronic
1033300017 7:140177050-140177072 GCGCGCGCGCGAGGCCGCGGCGG + Intergenic
1033662003 7:143408732-143408754 GCGCGCGCCCCCGGGGGCAGCGG + Exonic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1034446069 7:151114969-151114991 CCGCGGGCGCCGGTGGGCGGCGG - Intronic
1034470447 7:151251875-151251897 GCGCCCGAGCGAGCGGGCGGCGG + Intronic
1035125832 7:156607419-156607441 GCTCGGGCGCGGGTGGGCGCGGG - Intergenic
1036930600 8:12951950-12951972 GGGAGCGCGCGCGCGGGCCGGGG - Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1038727665 8:30095612-30095634 ACGCGCGCGCGCGAGCCCGGAGG - Intronic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1038767911 8:30446845-30446867 GCGCGCGCGCGCGCGGTGGAGGG + Intronic
1039460093 8:37736687-37736709 GCGCGCGCACGAAGGGGCGGGGG - Exonic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1039903265 8:41767661-41767683 GCGCGCGGGGGCGCGGGCGGGGG + Intronic
1040065339 8:43140418-43140440 GGGCGCGCGGGCGTCCGCGGCGG + Intergenic
1043388273 8:79768382-79768404 GCGCGAGGGCGCGCCGGCGGGGG + Intergenic
1043873675 8:85463269-85463291 GCTCGCCCGAGCGTGGGCTGCGG + Intergenic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1045277795 8:100722526-100722548 GCGGCCGCGCACGTGGGGGGTGG - Exonic
1045674090 8:104589057-104589079 GAGGGAGCGCGCGCGGGCGGCGG - Intergenic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1048484258 8:134832346-134832368 GTGCGCGCGCGCGTGGGGAAGGG + Intergenic
1048981101 8:139703726-139703748 CCGCGCGCCCGGGTGGGCGCTGG - Intergenic
1049090748 8:140511781-140511803 GCGCGCGCCGGCGTGGGACGGGG - Intronic
1049471752 8:142777829-142777851 CGGCGCGGGCGAGTGGGCGGAGG - Exonic
1049548537 8:143246097-143246119 GGGCGCGCACGCGGTGGCGGCGG + Intergenic
1049752522 8:144291884-144291906 GCGCGCGGGCGCGGGGCCCGTGG + Intronic
1051170265 9:14314156-14314178 GCGCGCGCGGGAGAGGGCCGGGG + Intronic
1051418810 9:16870806-16870828 GCGCGCGCGGGCGGGCGGGGAGG - Intronic
1053129073 9:35605294-35605316 GCGGGCGGGCGGGCGGGCGGCGG - Exonic
1053137120 9:35658292-35658314 GCTCGCGTGCGCGTGCGCGTTGG + Exonic
1054835642 9:69672518-69672540 GCGCGCACGCGAGTGGGCGAGGG - Intergenic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1054842663 9:69760020-69760042 GCGCGCGCGCGCGGGTGCTTCGG + Intergenic
1055030622 9:71768900-71768922 GCGGGCGGGCGGGCGGGCGGTGG + Intronic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1055501473 9:76906274-76906296 GCGCCGTGGCGCGTGGGCGGAGG + Intergenic
1057245603 9:93451878-93451900 GCGGGCGCGGGTGCGGGCGGGGG - Exonic
1057361188 9:94374894-94374916 GCGCGCGGGCGCGCAGGCCGCGG + Exonic
1057662175 9:97013270-97013292 GCGCGCGGGCGCGCAGGCCGCGG - Exonic
1057758366 9:97854108-97854130 GCGCTCGGGCGCGTGCGCGATGG - Exonic
1057869818 9:98709063-98709085 GCGCGCACGGGGGCGGGCGGAGG - Exonic
1058058549 9:100473238-100473260 GCGGGCGCGCGCGCGGCGGGCGG - Exonic
1058058551 9:100473242-100473264 GCGGGCGGGCGCGCGCGCGGCGG - Exonic
1058687231 9:107489607-107489629 GCGCGCGCGGCCATGGGCGCGGG + Exonic
1059191839 9:112333847-112333869 GCGCGCGCGCGCCGGGCCGAGGG - Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059790036 9:117632133-117632155 GCGCGCGCGCGCGTGTATTGGGG - Intergenic
1060283371 9:122228488-122228510 GCGCGCGCGAGCGGGGGGGGGGG - Intronic
1060283373 9:122228490-122228512 GCGCGCGCGCGAGCGGGGGGGGG - Intronic
1060283375 9:122228492-122228514 GAGCGCGCGCGCGAGCGGGGGGG - Intronic
1060283377 9:122228494-122228516 GGGAGCGCGCGCGCGAGCGGGGG - Intronic
1060477948 9:123999685-123999707 GCGCGTGCGGCCGGGGGCGGGGG - Intergenic
1060514579 9:124257933-124257955 GCGCGGGCCCGCGCAGGCGGTGG + Intronic
1060700761 9:125747423-125747445 GCGCGGGCGGGAGCGGGCGGCGG - Exonic
1060713058 9:125889864-125889886 GCGCGAGCGCGGGCGGGCGTCGG - Intronic
1060952325 9:127612204-127612226 GCCCCCGCGCGCGCCGGCGGCGG + Intergenic
1061028957 9:128068272-128068294 GCGGGCGGGAGCGGGGGCGGCGG - Exonic
1061084920 9:128393117-128393139 GCGTGCGCGGGGCTGGGCGGGGG - Intergenic
1061128108 9:128689416-128689438 GCGCGCGCGAGCGAGCGAGGGGG + Intronic
1061453490 9:130681578-130681600 GGGCGCGTGCGCGTGCGGGGCGG - Exonic
1061976103 9:134068539-134068561 GAGCGCGCGCGCGGGGCGGGGGG + Intergenic
1062022578 9:134326391-134326413 GCGCGGGCGCGCGGCGGCGGGGG + Intronic
1062230524 9:135479599-135479621 GGGCGCGCTCTCGCGGGCGGGGG + Intronic
1062316145 9:135967812-135967834 GCGCGCGCGCGCCTGTGTGTGGG + Intergenic
1062579231 9:137222159-137222181 GCGGGCGCGGGCGTGGGGCGCGG + Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203469239 Un_GL000220v1:108919-108941 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1203471246 Un_GL000220v1:116349-116371 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203477060 Un_GL000220v1:152891-152913 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1203479067 Un_GL000220v1:160321-160343 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1186768145 X:12791758-12791780 GCGCGGGCGCGGGGGCGCGGAGG - Intronic
1187067416 X:15854599-15854621 GGGCGCGCGCGGGGTGGCGGGGG + Intronic
1187154621 X:16712017-16712039 GCGGGCGCTGGCGCGGGCGGAGG + Exonic
1187648324 X:21374143-21374165 GTGCGCGTGCGCGGCGGCGGAGG - Intergenic
1187675774 X:21715316-21715338 GCGCGCTCGCGCGCTGGTGGGGG + Intronic
1189137107 X:38561485-38561507 GCGGGCGGGCGCGCGGGAGGGGG - Exonic
1189310602 X:40014816-40014838 GCGCGCGCGCTCGTGGAGCGGGG - Intergenic
1189325190 X:40107412-40107434 GAGCGCGCGCGCTTGGGTGGGGG - Intronic
1195316845 X:103687501-103687523 GGGCGCGCGCGCGTGCGTGATGG + Intronic
1195625178 X:106999816-106999838 GCGCGCGGGCCCCTGGGCTGCGG - Intronic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic
1197655143 X:129108652-129108674 GCGCGCGCGCGGCGGGGCGGTGG + Intergenic
1197735083 X:129844189-129844211 GCGCGCGCGCGCGTGTGTGTAGG - Intergenic
1198683285 X:139203992-139204014 GCGCGCACGCGAGGGGGCGAGGG + Intronic
1198767159 X:140091569-140091591 GCGGGCGGGCGCGCGGGCGGCGG - Intergenic
1199086454 X:143634724-143634746 GCGCGCGCGCACGCGAGCCGAGG - Intronic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic
1200100760 X:153688308-153688330 GCCCGGGGGCGCGCGGGCGGCGG - Exonic
1200138514 X:153886187-153886209 GGGCGTGCGCGCAGGGGCGGGGG + Intronic