ID: 929974603

View in Genome Browser
Species Human (GRCh38)
Location 2:46620236-46620258
Sequence CAGGCTGCTCTCAAACTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91081
Summary {0: 227, 1: 11638, 2: 21598, 3: 30735, 4: 26883}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929974603_929974613 25 Left 929974603 2:46620236-46620258 CCCAGGAGTTTGAGAGCAGCCTG 0: 227
1: 11638
2: 21598
3: 30735
4: 26883
Right 929974613 2:46620284-46620306 AAAGGACAGAAAAATTAACTGGG 0: 1
1: 0
2: 28
3: 876
4: 12890
929974603_929974608 7 Left 929974603 2:46620236-46620258 CCCAGGAGTTTGAGAGCAGCCTG 0: 227
1: 11638
2: 21598
3: 30735
4: 26883
Right 929974608 2:46620266-46620288 TGTGAAACCCTGTCCTACAAAGG 0: 1
1: 0
2: 2
3: 9
4: 119
929974603_929974614 30 Left 929974603 2:46620236-46620258 CCCAGGAGTTTGAGAGCAGCCTG 0: 227
1: 11638
2: 21598
3: 30735
4: 26883
Right 929974614 2:46620289-46620311 ACAGAAAAATTAACTGGGTGTGG 0: 4
1: 157
2: 4085
3: 32909
4: 77705
929974603_929974612 24 Left 929974603 2:46620236-46620258 CCCAGGAGTTTGAGAGCAGCCTG 0: 227
1: 11638
2: 21598
3: 30735
4: 26883
Right 929974612 2:46620283-46620305 CAAAGGACAGAAAAATTAACTGG 0: 1
1: 0
2: 5
3: 196
4: 3742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929974603 Original CRISPR CAGGCTGCTCTCAAACTCCT GGG (reversed) Intronic