ID: 929974604

View in Genome Browser
Species Human (GRCh38)
Location 2:46620237-46620259
Sequence CCAGGCTGCTCTCAAACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175333
Summary {0: 421, 1: 21888, 2: 42516, 3: 59213, 4: 51295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929974604_929974614 29 Left 929974604 2:46620237-46620259 CCAGGAGTTTGAGAGCAGCCTGG 0: 421
1: 21888
2: 42516
3: 59213
4: 51295
Right 929974614 2:46620289-46620311 ACAGAAAAATTAACTGGGTGTGG 0: 4
1: 157
2: 4085
3: 32909
4: 77705
929974604_929974612 23 Left 929974604 2:46620237-46620259 CCAGGAGTTTGAGAGCAGCCTGG 0: 421
1: 21888
2: 42516
3: 59213
4: 51295
Right 929974612 2:46620283-46620305 CAAAGGACAGAAAAATTAACTGG 0: 1
1: 0
2: 5
3: 196
4: 3742
929974604_929974608 6 Left 929974604 2:46620237-46620259 CCAGGAGTTTGAGAGCAGCCTGG 0: 421
1: 21888
2: 42516
3: 59213
4: 51295
Right 929974608 2:46620266-46620288 TGTGAAACCCTGTCCTACAAAGG 0: 1
1: 0
2: 2
3: 9
4: 119
929974604_929974613 24 Left 929974604 2:46620237-46620259 CCAGGAGTTTGAGAGCAGCCTGG 0: 421
1: 21888
2: 42516
3: 59213
4: 51295
Right 929974613 2:46620284-46620306 AAAGGACAGAAAAATTAACTGGG 0: 1
1: 0
2: 28
3: 876
4: 12890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929974604 Original CRISPR CCAGGCTGCTCTCAAACTCC TGG (reversed) Intronic