ID: 929974607

View in Genome Browser
Species Human (GRCh38)
Location 2:46620255-46620277
Sequence CAGGGTTTCACATGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5955
Summary {0: 12, 1: 131, 2: 393, 3: 1208, 4: 4211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929974607_929974612 5 Left 929974607 2:46620255-46620277 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 929974612 2:46620283-46620305 CAAAGGACAGAAAAATTAACTGG 0: 1
1: 0
2: 5
3: 196
4: 3742
929974607_929974614 11 Left 929974607 2:46620255-46620277 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 929974614 2:46620289-46620311 ACAGAAAAATTAACTGGGTGTGG 0: 4
1: 157
2: 4085
3: 32909
4: 77705
929974607_929974613 6 Left 929974607 2:46620255-46620277 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 929974613 2:46620284-46620306 AAAGGACAGAAAAATTAACTGGG 0: 1
1: 0
2: 28
3: 876
4: 12890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929974607 Original CRISPR CAGGGTTTCACATGTTGCCC AGG (reversed) Intronic