ID: 929974610

View in Genome Browser
Species Human (GRCh38)
Location 2:46620274-46620296
Sequence TTTTCTGTCCTTTGTAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929974610_929974614 -8 Left 929974610 2:46620274-46620296 CCTGTCCTACAAAGGACAGAAAA 0: 1
1: 0
2: 3
3: 30
4: 341
Right 929974614 2:46620289-46620311 ACAGAAAAATTAACTGGGTGTGG 0: 4
1: 157
2: 4085
3: 32909
4: 77705
929974610_929974617 26 Left 929974610 2:46620274-46620296 CCTGTCCTACAAAGGACAGAAAA 0: 1
1: 0
2: 3
3: 30
4: 341
Right 929974617 2:46620323-46620345 TGTAGTCCCAGCTACTCAGGAGG 0: 40849
1: 157871
2: 218647
3: 208196
4: 128589
929974610_929974615 23 Left 929974610 2:46620274-46620296 CCTGTCCTACAAAGGACAGAAAA 0: 1
1: 0
2: 3
3: 30
4: 341
Right 929974615 2:46620320-46620342 GCCTGTAGTCCCAGCTACTCAGG 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929974610 Original CRISPR TTTTCTGTCCTTTGTAGGAC AGG (reversed) Intronic