ID: 929974613

View in Genome Browser
Species Human (GRCh38)
Location 2:46620284-46620306
Sequence AAAGGACAGAAAAATTAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13795
Summary {0: 1, 1: 0, 2: 28, 3: 876, 4: 12890}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929974607_929974613 6 Left 929974607 2:46620255-46620277 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 929974613 2:46620284-46620306 AAAGGACAGAAAAATTAACTGGG 0: 1
1: 0
2: 28
3: 876
4: 12890
929974604_929974613 24 Left 929974604 2:46620237-46620259 CCAGGAGTTTGAGAGCAGCCTGG 0: 421
1: 21888
2: 42516
3: 59213
4: 51295
Right 929974613 2:46620284-46620306 AAAGGACAGAAAAATTAACTGGG 0: 1
1: 0
2: 28
3: 876
4: 12890
929974603_929974613 25 Left 929974603 2:46620236-46620258 CCCAGGAGTTTGAGAGCAGCCTG 0: 227
1: 11638
2: 21598
3: 30735
4: 26883
Right 929974613 2:46620284-46620306 AAAGGACAGAAAAATTAACTGGG 0: 1
1: 0
2: 28
3: 876
4: 12890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929974613 Original CRISPR AAAGGACAGAAAAATTAACT GGG Intronic