ID: 929974614

View in Genome Browser
Species Human (GRCh38)
Location 2:46620289-46620311
Sequence ACAGAAAAATTAACTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114860
Summary {0: 4, 1: 157, 2: 4085, 3: 32909, 4: 77705}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929974609_929974614 -7 Left 929974609 2:46620273-46620295 CCCTGTCCTACAAAGGACAGAAA 0: 1
1: 1
2: 32
3: 89
4: 602
Right 929974614 2:46620289-46620311 ACAGAAAAATTAACTGGGTGTGG 0: 4
1: 157
2: 4085
3: 32909
4: 77705
929974604_929974614 29 Left 929974604 2:46620237-46620259 CCAGGAGTTTGAGAGCAGCCTGG 0: 421
1: 21888
2: 42516
3: 59213
4: 51295
Right 929974614 2:46620289-46620311 ACAGAAAAATTAACTGGGTGTGG 0: 4
1: 157
2: 4085
3: 32909
4: 77705
929974603_929974614 30 Left 929974603 2:46620236-46620258 CCCAGGAGTTTGAGAGCAGCCTG 0: 227
1: 11638
2: 21598
3: 30735
4: 26883
Right 929974614 2:46620289-46620311 ACAGAAAAATTAACTGGGTGTGG 0: 4
1: 157
2: 4085
3: 32909
4: 77705
929974610_929974614 -8 Left 929974610 2:46620274-46620296 CCTGTCCTACAAAGGACAGAAAA 0: 1
1: 0
2: 3
3: 30
4: 341
Right 929974614 2:46620289-46620311 ACAGAAAAATTAACTGGGTGTGG 0: 4
1: 157
2: 4085
3: 32909
4: 77705
929974607_929974614 11 Left 929974607 2:46620255-46620277 CCTGGGCAACATGTGAAACCCTG 0: 12
1: 131
2: 393
3: 1208
4: 4211
Right 929974614 2:46620289-46620311 ACAGAAAAATTAACTGGGTGTGG 0: 4
1: 157
2: 4085
3: 32909
4: 77705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929974614 Original CRISPR ACAGAAAAATTAACTGGGTG TGG Intronic