ID: 929979267

View in Genome Browser
Species Human (GRCh38)
Location 2:46663710-46663732
Sequence GGTGGAGAAAGCACCAGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929979267_929979276 10 Left 929979267 2:46663710-46663732 CCTAATCTGGTGCTTTCTCCACC No data
Right 929979276 2:46663743-46663765 GGTACCTGGCCAGGATGCCAGGG No data
929979267_929979273 1 Left 929979267 2:46663710-46663732 CCTAATCTGGTGCTTTCTCCACC No data
Right 929979273 2:46663734-46663756 CATCCGGCTGGTACCTGGCCAGG No data
929979267_929979275 9 Left 929979267 2:46663710-46663732 CCTAATCTGGTGCTTTCTCCACC No data
Right 929979275 2:46663742-46663764 TGGTACCTGGCCAGGATGCCAGG No data
929979267_929979271 -4 Left 929979267 2:46663710-46663732 CCTAATCTGGTGCTTTCTCCACC No data
Right 929979271 2:46663729-46663751 CACCACATCCGGCTGGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929979267 Original CRISPR GGTGGAGAAAGCACCAGATT AGG (reversed) Intergenic
No off target data available for this crispr