ID: 929979270

View in Genome Browser
Species Human (GRCh38)
Location 2:46663728-46663750
Sequence CAGGTACCAGCCGGATGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929979270_929979276 -8 Left 929979270 2:46663728-46663750 CCACCACATCCGGCTGGTACCTG No data
Right 929979276 2:46663743-46663765 GGTACCTGGCCAGGATGCCAGGG No data
929979270_929979280 30 Left 929979270 2:46663728-46663750 CCACCACATCCGGCTGGTACCTG No data
Right 929979280 2:46663781-46663803 AATAAACATGTTATCCTTCATGG No data
929979270_929979275 -9 Left 929979270 2:46663728-46663750 CCACCACATCCGGCTGGTACCTG No data
Right 929979275 2:46663742-46663764 TGGTACCTGGCCAGGATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929979270 Original CRISPR CAGGTACCAGCCGGATGTGG TGG (reversed) Intergenic
No off target data available for this crispr