ID: 929979276

View in Genome Browser
Species Human (GRCh38)
Location 2:46663743-46663765
Sequence GGTACCTGGCCAGGATGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929979267_929979276 10 Left 929979267 2:46663710-46663732 CCTAATCTGGTGCTTTCTCCACC No data
Right 929979276 2:46663743-46663765 GGTACCTGGCCAGGATGCCAGGG No data
929979270_929979276 -8 Left 929979270 2:46663728-46663750 CCACCACATCCGGCTGGTACCTG No data
Right 929979276 2:46663743-46663765 GGTACCTGGCCAGGATGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929979276 Original CRISPR GGTACCTGGCCAGGATGCCA GGG Intergenic
No off target data available for this crispr