ID: 929982916

View in Genome Browser
Species Human (GRCh38)
Location 2:46698541-46698563
Sequence CTTGAATTGCAGGAGGTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929982902_929982916 29 Left 929982902 2:46698489-46698511 CCCTCCGATTTGTGAGTCATTTT 0: 1
1: 0
2: 1
3: 6
4: 182
Right 929982916 2:46698541-46698563 CTTGAATTGCAGGAGGTGCCCGG 0: 1
1: 0
2: 2
3: 28
4: 259
929982903_929982916 28 Left 929982903 2:46698490-46698512 CCTCCGATTTGTGAGTCATTTTT 0: 1
1: 0
2: 0
3: 15
4: 160
Right 929982916 2:46698541-46698563 CTTGAATTGCAGGAGGTGCCCGG 0: 1
1: 0
2: 2
3: 28
4: 259
929982904_929982916 25 Left 929982904 2:46698493-46698515 CCGATTTGTGAGTCATTTTTGTG 0: 1
1: 0
2: 1
3: 30
4: 326
Right 929982916 2:46698541-46698563 CTTGAATTGCAGGAGGTGCCCGG 0: 1
1: 0
2: 2
3: 28
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929982916 Original CRISPR CTTGAATTGCAGGAGGTGCC CGG Intergenic
900382189 1:2390515-2390537 CTGGAACTGCAGGAGTTGGCGGG - Intronic
901265372 1:7906125-7906147 ATAGAATTGCATGAGGTGCATGG + Intergenic
901393419 1:8963235-8963257 GGTGAATTGCAGGAGGGGCTGGG - Intronic
904317546 1:29675497-29675519 GTGGAATTGGAGGAGGGGCCTGG - Intergenic
904493130 1:30872314-30872336 CTTGCATTGCAGTACGTGTCTGG + Intronic
905314047 1:37069802-37069824 CCTGTAGTGCAGGAGGGGCCAGG + Intergenic
910616434 1:89204012-89204034 GTCGAATTGGAGGAGGGGCCTGG + Intergenic
910788851 1:91029876-91029898 CTTAAAATGCAGGTGGGGCCGGG - Intergenic
913278818 1:117165415-117165437 ATTATATTGGAGGAGGTGCCTGG + Intronic
916096534 1:161356581-161356603 TTAGAATTGTATGAGGTGCCAGG + Intronic
917523414 1:175766646-175766668 GTCGAATTGGAGGAGGGGCCTGG + Intergenic
917652629 1:177094027-177094049 TCTGAGTTGCAGGAGTTGCCTGG - Intronic
919409001 1:197220695-197220717 GTCGAATTGGAGGAGGGGCCTGG + Intergenic
921179125 1:212617680-212617702 CTTGAATTGAAGAAGAGGCCGGG + Intronic
921278296 1:213540990-213541012 CTAGAATTACAGGTGGAGCCTGG - Intergenic
1063269841 10:4495706-4495728 CTGGAATTACAGGCCGTGCCTGG - Intergenic
1063648856 10:7913321-7913343 TTTGAAATGCAGGATGTGCCTGG + Intronic
1064857295 10:19783809-19783831 GTGGAATTGGAGGAGGGGCCTGG + Intronic
1067688089 10:48479754-48479776 CCTGTCTTGCAGGTGGTGCCGGG - Exonic
1068070364 10:52186437-52186459 CATGAATAGCAGGAGGTGATTGG - Intronic
1070713664 10:78701933-78701955 CTTGAAAAGCAGTGGGTGCCCGG - Intergenic
1073097387 10:100988162-100988184 CTTGAAATGCCTTAGGTGCCTGG - Exonic
1073331577 10:102673437-102673459 CTTTAAGTGCAGGTGGGGCCTGG - Intergenic
1074930881 10:118124777-118124799 GTTGAATTGGAGGAAGTGCCTGG + Intergenic
1076832289 10:133001873-133001895 CTGGAATTGCATGTGGTGCTGGG + Intergenic
1078096711 11:8301863-8301885 CTTGTTGTGGAGGAGGTGCCAGG - Intergenic
1078892004 11:15566080-15566102 ATTGAATTGCTGCAGCTGCCTGG + Intergenic
1079132143 11:17753301-17753323 CTAGCATAGCAGGTGGTGCCTGG + Intronic
1079519862 11:21313841-21313863 CTAGTATTGGAGGAGGGGCCTGG + Intronic
1079818649 11:25095127-25095149 GTTGAATTGGAGGAGGGACCTGG - Intergenic
1079910139 11:26299659-26299681 CTAGAATGGCAGGGGGTGCAGGG + Intergenic
1080613905 11:33929584-33929606 CTTGAAGTGCTGGAGGTTCTGGG + Intergenic
1080668952 11:34358515-34358537 CTCGGATTGCGGGAGGGGCCTGG - Intergenic
1080894627 11:36439137-36439159 CTTTAAACGCAGGAGGCGCCAGG - Intronic
1080997124 11:37617901-37617923 GTTGAATTGGAGGAGGGGCCTGG + Intergenic
1081185442 11:40036792-40036814 CTTGTGTTGAAGGAGGAGCCTGG - Intergenic
1084446639 11:69207455-69207477 CAGGGATGGCAGGAGGTGCCGGG - Intergenic
1085122177 11:73974298-73974320 CTGGAACTGCAGGAGATGCAGGG + Intergenic
1085258462 11:75190652-75190674 CTTGAACTAGAGGAGGTTCCTGG + Intronic
1087216684 11:95502533-95502555 TTTGAGTTACAGAAGGTGCCAGG + Intergenic
1087706279 11:101496211-101496233 GTTGAATTGGAGGAGGGGCCTGG - Intronic
1091422624 12:356341-356363 CTTGAATTGCAGTCTGTGCTGGG - Intronic
1092148720 12:6232558-6232580 CAGGAATTGCCGGAGATGCCTGG + Intronic
1094745738 12:33342188-33342210 CTTGCATTGCAGGAAATGTCTGG + Intergenic
1095143291 12:38693241-38693263 CTTGAATGGCTAGAGATGCCTGG - Intronic
1095420873 12:42022262-42022284 GTTGAATTGGAAGAGGTTCCTGG - Intergenic
1095978491 12:47956272-47956294 GTTGAATTGGTGGAGGGGCCTGG + Intergenic
1096476940 12:51914150-51914172 CTGGAATCACAGGCGGTGCCAGG + Intronic
1097956995 12:65496410-65496432 TTTGAATTGCAGGAGTTGCAGGG - Intergenic
1098131230 12:67352705-67352727 GTTGAATTGGAGGAGGGGACTGG + Intergenic
1099127177 12:78776936-78776958 CTTGACTGGGAGGATGTGCCAGG - Intergenic
1099929239 12:89054130-89054152 CATGAGTTGCAGGAGGGACCTGG - Intergenic
1104094155 12:125541287-125541309 CTTGAGTTTCAGAAGGAGCCAGG + Intronic
1104792736 12:131493960-131493982 CTTGTACTGCAGCAGTTGCCAGG + Intergenic
1106310930 13:28553593-28553615 CCTCAATTTAAGGAGGTGCCGGG - Intergenic
1106428423 13:29656384-29656406 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
1107313798 13:39109141-39109163 ATTGAATTACAGAAGGTGCAGGG + Intergenic
1109130318 13:58576083-58576105 GTTGAATTGGAGGAGGGGTCTGG - Intergenic
1109395501 13:61753385-61753407 GTTGAATTAGAGGAGGGGCCTGG + Intergenic
1111578543 13:90191313-90191335 GCTGAATTGGAGGAGGGGCCTGG - Intergenic
1111756117 13:92398027-92398049 CTTAAATTGCAGGCTGTGTCTGG + Intronic
1112029527 13:95444315-95444337 CTTGAATTGCAGAAGGCAGCAGG + Intronic
1112742830 13:102494842-102494864 GTTGAATTGGAGGAGGAGCCTGG - Intergenic
1113392180 13:109908441-109908463 ATTGAATTGGAGGAGGGGCATGG - Intergenic
1113424278 13:110195059-110195081 CTGGAATTCCAGGAGGACCCTGG + Exonic
1113529956 13:111016527-111016549 CTAGTATTGGAGGAGGTTCCTGG + Intergenic
1114424412 14:22610400-22610422 CTGGAGTAGCAGCAGGTGCCTGG - Intronic
1114499508 14:23157808-23157830 CTTTTCTTGCAGGAGCTGCCTGG + Intronic
1116091154 14:40308403-40308425 ATGGAATTGAAGGAGGGGCCTGG + Intergenic
1117652152 14:57918287-57918309 CATGAATTGCTGGAGGTTCAGGG - Intronic
1119691615 14:76677339-76677361 CTCGTATTGCAGGTGGGGCCTGG + Intergenic
1122280596 14:100620060-100620082 CCTAAATTGCAGGGGGGGCCTGG - Intergenic
1122378651 14:101286213-101286235 CCTGAAGTCCAGGAGGAGCCCGG + Intergenic
1123677988 15:22731560-22731582 CTTAAGTTTGAGGAGGTGCCAGG - Intergenic
1123850225 15:24347914-24347936 CTTGAATAGCAGGATGTCACAGG + Intergenic
1123871195 15:24575409-24575431 CTTGAATAGCAGGATGTCACAGG + Intergenic
1124330188 15:28805831-28805853 CTTAAGTTTGAGGAGGTGCCAGG - Intergenic
1126282087 15:46965278-46965300 CTAATATTGCAGGAGGGGCCTGG + Intergenic
1131336924 15:91558092-91558114 GTGGAATTGGAGGAGGGGCCTGG - Intergenic
1132738694 16:1400002-1400024 CTCGCAGTGCAGGAGGTGCACGG + Intronic
1133556314 16:6909374-6909396 CTTGAAATGGAAGAGTTGCCAGG - Intronic
1134004590 16:10809764-10809786 CTTGGGATGCAGGAGGAGCCTGG - Intronic
1134165726 16:11927765-11927787 GTTGAGTTGGAGGAGGTGGCTGG + Exonic
1134494997 16:14725975-14725997 GTTGAGTTGGAGGAGGTGGCTGG - Exonic
1134500381 16:14765095-14765117 GTTGAGTTGGAGGAGGTGGCTGG - Exonic
1134526922 16:14951707-14951729 GTTGAGTTGGAGGAGGTGGCTGG - Exonic
1134545482 16:15104644-15104666 GTTGAGTTGGAGGAGGTGGCTGG + Intronic
1134580198 16:15363955-15363977 GTTGAGTTGGAGGAGGTGGCTGG + Exonic
1134714499 16:16350184-16350206 GTTGAGTTGGAGGAGGTGGCTGG - Intergenic
1134722374 16:16393548-16393570 GTTGAGTTGGAGGAGGTGGCTGG - Exonic
1134945053 16:18318321-18318343 GTTGAGTTGGAGGAGGTGGCTGG + Exonic
1134952317 16:18358474-18358496 GTTGAGTTGGAGGAGGTGGCTGG + Intergenic
1135311118 16:21405179-21405201 GTTGAGTTGGAGGAGGTGGCTGG + Exonic
1135364070 16:21837630-21837652 GTTGAGTTGGAGGAGGTGGCTGG + Exonic
1135393032 16:22110079-22110101 CTGGAATTGGTGGAGGTGGCTGG - Intronic
1135447772 16:22533718-22533740 GTTGAGTTGGAGGAGGTGGCTGG - Exonic
1136150271 16:28343074-28343096 GTTGAGTTGGAGGAGGTGGCTGG + Exonic
1136166510 16:28456912-28456934 GTTGAGTTGGAGGAGGTGGCTGG + Exonic
1136196464 16:28658120-28658142 GTTGAGTTGGAGGAGGTGGCTGG - Exonic
1136212804 16:28772245-28772267 GTTGAGTTGGAGGAGGTGGCTGG - Exonic
1136257529 16:29052164-29052186 GTTGAGTTGGAGGAGGTGGCTGG - Exonic
1136307822 16:29384175-29384197 GTTGAGTTGGAGGAGGTGGCTGG + Exonic
1136321238 16:29485719-29485741 GTTGAGTTGGAGGAGGTGGCTGG + Exonic
1136435918 16:30225689-30225711 GTTGAGTTGGAGGAGGTGGCTGG + Exonic
1136710068 16:32229596-32229618 CATGAGATTCAGGAGGTGCCAGG + Intergenic
1136757841 16:32699815-32699837 CATGAGATTCAGGAGGTGCCAGG - Intergenic
1136810265 16:33170560-33170582 CATGAGATTCAGGAGGTGCCAGG + Intergenic
1136816741 16:33280640-33280662 CATGAGATTCAGGAGGTGCCAGG + Intronic
1136987211 16:35118649-35118671 CTTGCAGACCAGGAGGTGCCAGG + Intergenic
1139195843 16:64917752-64917774 CATGTGTTGCAGGAGGGGCCTGG - Intergenic
1139855512 16:69976618-69976640 GTTGAGTTGGAGGAGGTGGCTGG + Intergenic
1140215063 16:73000490-73000512 CTTTAACTGAAGGATGTGCCAGG + Intronic
1140367221 16:74391483-74391505 GTTGAGTTGGAGGAGGTGGCTGG - Exonic
1140465866 16:75181962-75181984 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
1140465950 16:75182883-75182905 CTGGGATTACAGGAGGTGCAGGG - Intergenic
1140538438 16:75732864-75732886 CTTGCCATGCAGGAAGTGCCTGG - Intronic
1140811178 16:78579597-78579619 CTTGAAGTACAGGAGTTTCCTGG - Intronic
1141842224 16:86580282-86580304 CTTGAAGTTGTGGAGGTGCCGGG + Exonic
1203059991 16_KI270728v1_random:960164-960186 CATGAGATTCAGGAGGTGCCAGG - Intergenic
1143159564 17:4860283-4860305 CTAGAAATGCAGGAGAGGCCTGG - Intronic
1143251105 17:5523699-5523721 CTTGCATTGCAGCAGTTACCAGG - Intronic
1144004171 17:11085263-11085285 CTCGAATTGTAGGAGGGGCCTGG + Intergenic
1147439645 17:40440187-40440209 CATGAATGGTAGGAGGTGCTTGG + Intergenic
1149630225 17:58116055-58116077 CTAGAATAGCAGGAGGTCCCAGG - Intergenic
1151320044 17:73347575-73347597 CTGGCTGTGCAGGAGGTGCCAGG - Intronic
1154116983 18:11619805-11619827 GTTGAGTTGGAGGAGGTGGCTGG + Intergenic
1154948528 18:21185495-21185517 CTGGACTTCCAGGAGGTGCTAGG - Intergenic
1155142208 18:23053807-23053829 CTGGAGTTGGAGGAGGCGCCGGG + Intergenic
1155293971 18:24368888-24368910 GTTGAATTGGAGCAGGGGCCTGG + Intronic
1155808942 18:30207700-30207722 GTTGAATTGGAGGAGGGGCATGG - Intergenic
1156617948 18:38810274-38810296 CTTCAATCACAGGATGTGCCTGG - Intergenic
1157416233 18:47505510-47505532 CTGGAATTACAGCATGTGCCAGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158591185 18:58780331-58780353 GTTGAGTTGGAGGAGGGGCCTGG - Intergenic
1158942570 18:62419195-62419217 GTTGAATTGGAGGACGGGCCTGG + Intergenic
1159892189 18:73963607-73963629 GATGAATTGGAGGAGGGGCCTGG - Intergenic
1159892474 18:73965594-73965616 GTTGAATTGGATGAGGGGCCTGG - Intergenic
1161520313 19:4720109-4720131 CCTGAAATGCAGGAGGTTCTGGG + Intronic
1164004113 19:21133470-21133492 CTTTAATGTCAGGAGGTGACTGG + Intergenic
1167358809 19:49019224-49019246 CTTGAACAGCAGAAGGTGCTTGG - Intergenic
1167961187 19:53105385-53105407 CTTGAATTCCATGATGAGCCAGG - Intergenic
926057570 2:9783652-9783674 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927144224 2:20151092-20151114 CTTGATTTGCAGGGACTGCCTGG + Intergenic
927302957 2:21536704-21536726 GTTGAATTGGAGGAGAGGCCTGG + Intergenic
927427306 2:22995579-22995601 CCTGGGCTGCAGGAGGTGCCAGG - Intergenic
929612964 2:43285271-43285293 GTTGAATTGGAGGCGGGGCCTGG + Intronic
929982916 2:46698541-46698563 CTTGAATTGCAGGAGGTGCCCGG + Intergenic
930961371 2:57266356-57266378 GTTGAATTGGAGGAGGAGCCTGG - Intergenic
930961600 2:57268254-57268276 GCTGAATTGAAGGAGGGGCCTGG - Intergenic
933334007 2:80930896-80930918 GTTGAATTGGAGGAGGGGCCTGG - Intergenic
936344047 2:111661757-111661779 TTTGAGATGCAGGAGGTGCCGGG - Intergenic
941046908 2:160686698-160686720 CTTGAATGGTTGGAGGTGACTGG + Intergenic
943546370 2:189284587-189284609 CATGTATTGTAGGAGGGGCCTGG - Intergenic
944591870 2:201225354-201225376 CTGGAATTCCAGGATGTGGCTGG + Intronic
945426934 2:209717406-209717428 GTTGAATTGGAGGAGGGACCTGG - Intronic
946518152 2:220435949-220435971 CTTTGAATGCAGGAAGTGCCTGG + Intergenic
946855517 2:223945910-223945932 CTTGATCTCCAGGAGCTGCCTGG + Intergenic
946937221 2:224734841-224734863 ATTGAACTGGAGGAGGTGCCTGG - Intergenic
946937552 2:224737333-224737355 GTTGAATTGGAGGTGGGGCCTGG + Intergenic
948258177 2:236583762-236583784 CTAGAATTTCAGTAGGTTCCCGG + Intergenic
1171144077 20:22766613-22766635 CATGGGTTTCAGGAGGTGCCTGG - Intergenic
1171262636 20:23747574-23747596 GTTTAATTGCAGGAGGTGGGGGG + Exonic
1171343479 20:24448097-24448119 CTTGCAGTGCAGGGAGTGCCTGG + Intergenic
1172314003 20:33939467-33939489 GTTGAATTGGAGGAGGGACCTGG + Intergenic
1173525835 20:43731881-43731903 TTTAACCTGCAGGAGGTGCCTGG - Intergenic
1174463242 20:50697964-50697986 CTGGGATTACAGGTGGTGCCTGG + Intergenic
1174786773 20:53440368-53440390 CTGCAATTGCAGGGGGTTCCTGG + Intronic
1174932732 20:54833298-54833320 GTTGGATTACAGGAGGGGCCTGG + Intergenic
1175701298 20:61139257-61139279 CTGGAATTGCAAGAGCTCCCAGG - Intergenic
1178062851 21:28871471-28871493 CTAGTATTGGAGGAGGTGCATGG - Intergenic
1179193363 21:39142334-39142356 GTTGAATTGGAGGAGGGACCTGG + Intergenic
1179915097 21:44472036-44472058 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
1181920617 22:26317651-26317673 CTTTAATTGCATGAGGTTCCCGG - Intronic
1182018704 22:27062896-27062918 CCTGAGCTGCAGGTGGTGCCTGG + Intergenic
1182710948 22:32323027-32323049 CTTGCAGTGCAGGGAGTGCCTGG - Intergenic
1184881448 22:47306923-47306945 GTAGAATTGGAGGAGGGGCCTGG + Intergenic
949156802 3:837523-837545 GTTGAATTGGAGGAGGAGACTGG - Intergenic
953156940 3:40384220-40384242 CTTGTGTTGGAGAAGGTGCCAGG - Intergenic
954150107 3:48653057-48653079 CTGGAGTTGCAGGAGGAACCAGG - Exonic
955536993 3:59934371-59934393 GTTGAATAGCAGGGGGTGCAGGG - Intronic
956118904 3:65946154-65946176 CAGGAATGGCAGGAAGTGCCAGG - Intronic
958187988 3:90148048-90148070 GTTGAATTGGAGGAGGGGCCTGG - Intergenic
958410533 3:93809945-93809967 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
958469499 3:94499403-94499425 GTTGAATTGGAGGAGGGGCCTGG + Intergenic
958475069 3:94569748-94569770 GTTGAAGTGGAGGAGGAGCCTGG + Intergenic
960658618 3:120033648-120033670 CATGTATTGGAGGAGGGGCCTGG + Intronic
961067470 3:123888816-123888838 GTTGAATTGGAGGAGGGGCCTGG - Intergenic
962177748 3:133172792-133172814 CATGTATTGCAGGAGGGACCTGG + Intronic
962456812 3:135572489-135572511 CTTGTGTTGAAGGAGGGGCCTGG - Intergenic
963083907 3:141419289-141419311 GTTGAACTGGAGGAGGGGCCTGG - Intronic
964896453 3:161602401-161602423 GTTGGATTGGAGGAGGGGCCTGG - Intergenic
965089891 3:164148921-164148943 GTTAAATTGGAGGAGGGGCCTGG - Intergenic
969610983 4:8227709-8227731 CTTGAGGTGCACGTGGTGCCTGG - Exonic
970274819 4:14386976-14386998 CTACAATTGCAGGAAGTACCAGG - Intergenic
970487598 4:16540182-16540204 GTTGATTTGGAGGAGGGGCCTGG - Intronic
971157224 4:24096030-24096052 CTTGAATTGGAGGAGGGGCCTGG + Intergenic
971895550 4:32589104-32589126 CTTGAACAGCAAGATGTGCCAGG + Intergenic
972186961 4:36541102-36541124 CTAGTGTTGCAGGAGGGGCCTGG - Intergenic
973026991 4:45284716-45284738 CTGAAATTGGAGCAGGTGCCGGG + Intergenic
976287725 4:83386255-83386277 GTTGAATTGGAGGAGGGGCCTGG - Intergenic
976853545 4:89576603-89576625 GTTGAATTGGAGGAGGGGCCTGG + Intergenic
976937428 4:90654105-90654127 GTTGAATTGAAGGAGGGGCGTGG - Intronic
978255875 4:106692312-106692334 GTTGAATTGGAGGAGGGGCCTGG + Intergenic
978391293 4:108228232-108228254 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
981055554 4:140357507-140357529 CATTCACTGCAGGAGGTGCCAGG - Intronic
981392094 4:144203003-144203025 GTTGAATTGGAGAAGGGGCCTGG + Intergenic
982471718 4:155799771-155799793 TTTGAATGGTAGGAGGTGGCAGG + Intronic
986081708 5:4401144-4401166 CTGGTATTGCATGAGATGCCAGG - Intergenic
986121882 5:4846873-4846895 CTTGAATTGCAGGATCTACTGGG - Intergenic
986481632 5:8194773-8194795 GTTGAATTGGAGGAGGCGCCTGG - Intergenic
986654843 5:10000626-10000648 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
988574362 5:32405748-32405770 CTTGGTTGGCAGGAGGTGACGGG - Intronic
988644674 5:33081287-33081309 CTTGACTTTGAGGTGGTGCCTGG - Intergenic
991138654 5:63213539-63213561 GTGGAACTGCAGGATGTGCCGGG - Intergenic
991662089 5:68960767-68960789 GTTGAATTGGAGGAGGGGCTTGG - Intergenic
992969501 5:82042378-82042400 GTCGAATTGTAGGAGGGGCCTGG - Intronic
992969778 5:82044343-82044365 GTTGAATTAGAGGAGGGGCCTGG - Intronic
993605958 5:89991007-89991029 CTTGAATAGCAGGAGCAGGCAGG - Intergenic
995201564 5:109430427-109430449 CTAGAAATGCAGAAGGTGCCCGG + Intergenic
997222078 5:132177825-132177847 GTAGAAGTGCATGAGGTGCCAGG - Intergenic
997856883 5:137380742-137380764 GTTGAATTGCAGGAGGGGCCAGG - Intronic
999068182 5:148714824-148714846 GTTGAATTGGAGGAGGAGCCTGG + Intergenic
999305694 5:150518093-150518115 CTAGAATTGCAGGGAGTCCCTGG + Intronic
1000741977 5:164979773-164979795 GTCGAATTGAAGGAGGGGCCTGG - Intergenic
1001187241 5:169586217-169586239 CTTGAATTCCTGGAGGTCTCTGG - Intronic
1004111206 6:12720655-12720677 CTGGATTTGCAGGAGGGGCGGGG + Intronic
1009394824 6:63187488-63187510 CTTGCATGGCAGGAGGGGCAAGG - Intergenic
1009791344 6:68404886-68404908 GTTGAATTGGACGAGGGGCCTGG - Intergenic
1011215874 6:85005103-85005125 CTTGAATTGGAGGAAGTTTCAGG - Intergenic
1011354445 6:86459553-86459575 GTTGAATTTGAGGAGGTTCCTGG + Intergenic
1011434403 6:87321967-87321989 CTTGTGTTGAAGGAGGGGCCTGG - Intronic
1012461697 6:99469859-99469881 CTGGGATTACAGGTGGTGCCTGG + Intronic
1012883047 6:104814682-104814704 GTTGAATTGGAGGAGGGACCTGG + Intronic
1013292586 6:108732165-108732187 TGTGCACTGCAGGAGGTGCCCGG + Intergenic
1013731263 6:113170429-113170451 CTTGAAATGTAGGTGGGGCCTGG + Intergenic
1014232558 6:118920513-118920535 CTAGTATTGGAGGAGATGCCTGG + Intronic
1014493664 6:122092953-122092975 CTTGTGTTGCAGGAAGGGCCTGG - Intergenic
1015827860 6:137335081-137335103 CTGGAATGGAAGGAGGTGCCTGG + Intergenic
1016264206 6:142212881-142212903 GTTGAATTGAAGGAGGGGCCTGG - Intronic
1018305704 6:162453087-162453109 CTTGAGGTGGAAGAGGTGCCCGG + Intronic
1019319845 7:410638-410660 CTTGGACAGCAGGAGGGGCCCGG + Intergenic
1022523817 7:31024603-31024625 GTTGAATTGGAGGAGGGGCCTGG - Intergenic
1022832327 7:34080286-34080308 CTTGAATTGAAGTAATTGCCAGG - Intronic
1024895899 7:54261532-54261554 GTTGAATTGGAGGAGGGGCCAGG - Intergenic
1025707636 7:63882203-63882225 CTTGCAATGCAGGTGGAGCCTGG - Intergenic
1030752292 7:113242572-113242594 GTTGAATTGGAGGTGGGGCCTGG + Intergenic
1032062367 7:128735774-128735796 CTAGTATTGGAGGAGGGGCCTGG - Intergenic
1037039396 8:14211780-14211802 GTTGAATTGGAGAAGGGGCCTGG - Intronic
1037866148 8:22444092-22444114 CTTAAATTGAAGGATGTGGCTGG + Intronic
1038522547 8:28245665-28245687 GTTGAATTGGAGGAGGGGCCGGG - Intergenic
1038957829 8:32486322-32486344 CTTATAGTACAGGAGGTGCCTGG - Intronic
1041965534 8:63670483-63670505 CTGAAATTGGAGCAGGTGCCAGG + Intergenic
1042756899 8:72224542-72224564 CTTTATTTGCATGACGTGCCTGG - Intergenic
1044381496 8:91539515-91539537 CTAGAATTAGAGGAGGGGCCTGG + Intergenic
1044765660 8:95571370-95571392 GTTGAATTGGAAGAGGGGCCTGG + Intergenic
1046571891 8:115976509-115976531 CTTTAATTGCAGGAGGAGGGTGG + Intergenic
1048462114 8:134629517-134629539 GTTGAATTGGAGGAGAGGCCTGG + Intronic
1048758484 8:137765846-137765868 CATGTATTGGAGGAGGGGCCTGG + Intergenic
1051811420 9:21053960-21053982 GTGGAATTGGAGGAGGGGCCTGG + Intergenic
1051988344 9:23119049-23119071 GTTGAATTGGAGGAGGGGCCTGG - Intergenic
1053606814 9:39668319-39668341 TTTGAATTGCTGGAGGTGGGAGG + Intergenic
1054246722 9:62674083-62674105 TTTGAATTGCTGGAGGTGGGAGG - Intergenic
1054560843 9:66708617-66708639 TTTGAATTGCTGGAGGTGGGAGG - Intergenic
1056430985 9:86527352-86527374 CATGAATTGCAGAATGTTCCTGG - Intergenic
1057362808 9:94390382-94390404 GTTGAATTGAAGGTGTTGCCAGG + Intronic
1057491710 9:95525303-95525325 CTTGGAATGCAGGAGGTGAAGGG + Intergenic
1057660530 9:96997711-96997733 GTTGAATTGAAGGTGTTGCCAGG - Intronic
1058880029 9:109277896-109277918 CTTGGAGTGCAGGTGGTGACAGG + Intronic
1059162365 9:112047327-112047349 CATGTATTGAAGGAGGGGCCTGG - Intronic
1060137864 9:121174862-121174884 AAAGAATTGTAGGAGGTGCCAGG - Intronic
1061447247 9:130647050-130647072 GTTGAATTTGAGGAGGGGCCTGG - Intergenic
1061538877 9:131266617-131266639 GTTGAATAGCAGGAGGCACCTGG - Intronic
1061711146 9:132488808-132488830 CTGATATTGCAGGAGGAGCCCGG + Intronic
1062014521 9:134284465-134284487 CTGGGATGGCAGGAGATGCCAGG + Intergenic
1062015069 9:134287274-134287296 CTGGGATGGCAGGAGATGCCAGG + Intergenic
1185807470 X:3071897-3071919 CTTGAGCTTCAGGAGATGCCTGG + Intronic
1186056301 X:5653302-5653324 CTTGCTTTGCAGGAGGCTCCAGG + Intergenic
1186062559 X:5725948-5725970 CTTGAATTCCAGGTGTTGGCAGG + Intergenic
1194205112 X:91002841-91002863 CTGAAATTGGAGAAGGTGCCCGG + Intergenic
1195156990 X:102133451-102133473 CTTGAATTTCAGTTGGTACCAGG + Intergenic
1195164922 X:102209912-102209934 ATTGAATTGAAGGATGTGGCTGG + Intergenic
1195193936 X:102477179-102477201 ATTGAATTGAAGGATGTGGCTGG - Intergenic
1199532676 X:148868053-148868075 CTTCAATTGTAGTAGGTGCTTGG - Intronic
1200345186 X:155440587-155440609 CTTGAATTTTGGGAGGGGCCAGG - Intergenic
1200550932 Y:4577962-4577984 CTGAAATTGGAGAAGGTGCCCGG + Intergenic
1202276372 Y:23124879-23124901 CATGAAATGCTGGAGGTGGCAGG - Intergenic
1202289656 Y:23295811-23295833 CATGAAATGCTGGAGGTGGCAGG + Intergenic
1202429366 Y:24758604-24758626 CATGAAATGCTGGAGGTGGCAGG - Intergenic
1202441425 Y:24911486-24911508 CATGAAATGCTGGAGGTGGCAGG + Intergenic