ID: 929986228

View in Genome Browser
Species Human (GRCh38)
Location 2:46735529-46735551
Sequence TGAAATAATTAGAGTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929986228_929986231 20 Left 929986228 2:46735529-46735551 CCCAGAGCACTCTAATTATTTCA 0: 1
1: 0
2: 1
3: 19
4: 212
Right 929986231 2:46735572-46735594 TTGCCTTCTCTGCTTGATTCTGG 0: 1
1: 0
2: 1
3: 33
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929986228 Original CRISPR TGAAATAATTAGAGTGCTCT GGG (reversed) Intronic
900563221 1:3318932-3318954 TGAATTAATTACAGAGCTCAGGG - Intronic
901374985 1:8831569-8831591 TGAAAAAATCAGAGTGTTCTGGG - Intergenic
901444333 1:9298603-9298625 GGAAATAATTAGATTGTTCGGGG + Intronic
903020837 1:20392950-20392972 TGAAATAATCAGAGAACTCAAGG - Intergenic
904693984 1:32317009-32317031 TACAATAATTACAGTACTCTTGG - Intronic
907068319 1:51509437-51509459 TAAAATAATGAGAGAGATCTTGG - Intronic
907799264 1:57748644-57748666 TCAAATAACTAGAGTGGTCAGGG + Intronic
908896699 1:68909399-68909421 TGGAATAATGACAGTTCTCTGGG - Intergenic
910785780 1:90996863-90996885 TTAAATAATGACAGTTCTCTGGG - Intronic
911654052 1:100423093-100423115 TTAAAAAATTAAATTGCTCTTGG + Intronic
915244548 1:154547144-154547166 TAAAATAATTACAGGGATCTGGG - Intronic
917638863 1:176962754-176962776 TGAATTAATTAGTTTGCTCTGGG + Intronic
918448159 1:184634651-184634673 AGAAATAAGTAGAGTCCTCAGGG + Intergenic
919868057 1:201798315-201798337 TGATATAATTGGATTACTCTGGG - Intronic
920156969 1:203960509-203960531 TCAAATAATGACAGTCCTCTGGG - Intergenic
922778752 1:228232950-228232972 TGAAATAATGACAGTGCTCTAGG + Intronic
922872091 1:228911204-228911226 TGAAATAATGAGAGAGGCCTTGG - Intergenic
923335092 1:232961403-232961425 GAAAATAAGTAGAGTGCTCAGGG - Intronic
1065609803 10:27461826-27461848 TAAAATAATTAGAACTCTCTTGG + Intergenic
1067319805 10:45206718-45206740 TCACATAATTAGAGGGCGCTGGG - Intergenic
1067692792 10:48512958-48512980 TCAAATTTTTACAGTGCTCTAGG - Intronic
1069382037 10:67851183-67851205 TAAAATAAATTGAGTGTTCTGGG + Intergenic
1070072377 10:73102052-73102074 TGAAATCATCAGGGTGCTCTGGG + Intergenic
1071036922 10:81258583-81258605 TGAAAAAAATAGTGTGCTGTTGG + Intergenic
1071382872 10:85086863-85086885 TCAAATAATGACAGTTCTCTGGG - Intergenic
1071713071 10:88068644-88068666 TTTAATAATTATGGTGCTCTAGG - Intergenic
1074344207 10:112665959-112665981 TGAAATAATTGCAGTGTTCATGG + Intronic
1075284819 10:121174348-121174370 TGAAATAATTAGATTGCAAGTGG - Intergenic
1075835296 10:125447822-125447844 GGAAATAAATATAGGGCTCTGGG + Intergenic
1076091118 10:127686539-127686561 TAAAATACCTAGAGTGCTTTCGG + Intergenic
1078627801 11:12973639-12973661 AGAAATGTTTAGAGAGCTCTAGG + Intergenic
1078863243 11:15272739-15272761 TGAAATAGTTTCAGTGCTGTTGG - Intergenic
1082067793 11:47914992-47915014 GGAAGAAATTAGATTGCTCTAGG + Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1087049459 11:93870699-93870721 TGAAAATATTTGAGTGTTCTTGG - Intergenic
1087382774 11:97428212-97428234 TGCAATAATTAGAGAGATATTGG + Intergenic
1089478631 11:118787825-118787847 TAAAATTATTAGAGTCATCTTGG - Intronic
1089726970 11:120490324-120490346 TCAATTGATTAGAGTGCTTTTGG + Intergenic
1090694494 11:129224672-129224694 TGATATAATGACAGTTCTCTGGG - Intronic
1092410473 12:8249093-8249115 TGCAATAATCACAGTGTTCTGGG + Intergenic
1093313633 12:17622113-17622135 TGGAATAATTAGAATAATCTGGG + Intergenic
1093443133 12:19223368-19223390 TAAAATAAGTAGGGTACTCTAGG + Intronic
1095233823 12:39773691-39773713 TGAAATAATTTGACTGCTCCAGG + Intronic
1098135781 12:67400300-67400322 AGAAACCATTAGAGTCCTCTCGG - Intergenic
1098606790 12:72400831-72400853 GCAAATAAGTAAAGTGCTCTAGG - Intronic
1099056513 12:77848372-77848394 TAAAATAACAAGACTGCTCTGGG + Intronic
1099483053 12:83192986-83193008 TCAAATTGTTAGAGTGCCCTAGG - Intergenic
1101294613 12:103408341-103408363 CTAAATAATTAGAGAGATCTGGG + Intronic
1101719489 12:107338796-107338818 TTAATTAATTAAAATGCTCTGGG - Intronic
1101923043 12:108948263-108948285 TGATTTATTGAGAGTGCTCTTGG - Intronic
1104111993 12:125712792-125712814 TAAAATAAAAAGAATGCTCTTGG + Intergenic
1105763330 13:23533146-23533168 TGAAACAATTAGAGCACTATTGG - Intergenic
1105967320 13:25396612-25396634 TGCAATCATGAGGGTGCTCTTGG + Intronic
1106596374 13:31143099-31143121 GTAAATAATTAGCCTGCTCTTGG - Intronic
1108071655 13:46635086-46635108 TGAAATAAATAGAATTCACTGGG - Intronic
1108974735 13:56424694-56424716 AGAAATCATTACAGTACTCTTGG - Intergenic
1109414074 13:62012305-62012327 TTAAATAATTATAGTTCTGTTGG - Intergenic
1109512599 13:63399225-63399247 TGAAAAAATTTTAGTGCTCCTGG + Intergenic
1110525551 13:76532378-76532400 TTGAATAATAACAGTGCTCTCGG + Intergenic
1111072810 13:83190547-83190569 TGAATTAACCAGAGTGCTATAGG + Intergenic
1111803044 13:93003813-93003835 TCAAATAATTCCAGTTCTCTGGG - Intergenic
1111975416 13:94962055-94962077 TGAAAGAATTAGACAGGTCTTGG + Intergenic
1112630741 13:101158868-101158890 TGAAATAAGGAGAGTGCTGTGGG - Intronic
1114511778 14:23268222-23268244 TCAAATAATGACAGTTCTCTGGG + Intronic
1115579118 14:34740898-34740920 TAAAAGAACTAGAGAGCTCTCGG - Intergenic
1115921084 14:38374562-38374584 TGAAACAATTAGAAAGTTCTAGG - Intergenic
1116121885 14:40731486-40731508 TGAAAGAACCACAGTGCTCTTGG - Intergenic
1116265622 14:42686296-42686318 TGTAATAATGAGAGGGCACTGGG + Intergenic
1117461066 14:55945305-55945327 TGCATTAATTAGGGTTCTCTAGG + Intergenic
1117811405 14:59551178-59551200 TGATATAATTAAAGTACTTTGGG + Intronic
1119945949 14:78694467-78694489 TGAAAAACTTAGAATGATCTGGG - Intronic
1120057387 14:79940545-79940567 TGAAATATTTAAAGTGCTGAGGG - Intergenic
1120143115 14:80950673-80950695 TGCAATAATTGGAATGCTCAAGG + Intronic
1120511188 14:85416678-85416700 TGAAATAATTTGAATGCTGTTGG - Intergenic
1121705965 14:95993927-95993949 TTAACTGAATAGAGTGCTCTGGG + Intergenic
1121882976 14:97516798-97516820 TGAGATAATTACATTTCTCTTGG + Intergenic
1122139738 14:99655679-99655701 TGAAATACTTAGGGTGGTTTAGG - Intronic
1123163716 14:106305617-106305639 TAAAATGAGTAGAGTGCTATTGG - Intergenic
1202933126 14_KI270725v1_random:57958-57980 TGAAATAATCACAGTGCATTTGG - Intergenic
1124582494 15:30971908-30971930 TGACAAAATTAGATTGCTTTGGG - Intronic
1126149819 15:45513805-45513827 TCAAATAATGACAGTTCTCTGGG - Intronic
1126735172 15:51725272-51725294 TGAAATAACTAGAGATATCTGGG - Intronic
1127109807 15:55656498-55656520 AGAAAAAATTACACTGCTCTGGG - Intronic
1129342299 15:74893943-74893965 TAAAATAAAAAGAGAGCTCTGGG - Intronic
1133903557 16:10000019-10000041 TGGAATAATGAGGGTGCTCAGGG - Intronic
1135701400 16:24635697-24635719 AGAAATAATAAGAGAGTTCTGGG - Intergenic
1137334749 16:47537013-47537035 TGGAATAAATAGAGTTCTGTGGG + Intronic
1137738234 16:50741194-50741216 TTAAATATTTTGAGTGCTTTTGG + Intergenic
1137996022 16:53213808-53213830 TGACATAAGTAGAATGCTTTTGG + Intronic
1138302147 16:55939558-55939580 TAACATAAATAGAGAGCTCTAGG + Intronic
1138321745 16:56119947-56119969 GGGAATAATTACAGTGCTCATGG + Intergenic
1138932206 16:61673325-61673347 AGAAATATTTAGTGTCCTCTAGG + Intronic
1139010468 16:62626187-62626209 AGAAAAACTTGGAGTGCTCTAGG + Intergenic
1139026252 16:62822077-62822099 ATAAATCATTAGAGTTCTCTTGG + Intergenic
1139792890 16:69454744-69454766 TTAAATACTTAGAATCCTCTTGG + Intronic
1139813443 16:69643514-69643536 TAAAATTACTAGAGTACTCTCGG + Intronic
1142990247 17:3725272-3725294 TGAAATACTTAGAGTGTTTAAGG - Exonic
1145849916 17:28082727-28082749 TGAATTGAGTAGAGTGCTTTTGG + Intronic
1148224882 17:45892414-45892436 TGACATAATTAAAATGATCTGGG + Intergenic
1149687911 17:58548700-58548722 TGAAATTACTAGAGTACCCTTGG - Intergenic
1154360411 18:13656063-13656085 TGAAATAATCACAGCACTCTGGG + Intergenic
1156087000 18:33417741-33417763 TGAAATAATTATAGTTTTATAGG - Intronic
1156528544 18:37792828-37792850 GGAAATGTTTAGAGTTCTCTTGG + Intergenic
1158289792 18:55927130-55927152 TAAAATAAATAGAATGCACTAGG + Intergenic
1158810238 18:61024552-61024574 TGAAATCATTTTAATGCTCTTGG + Intergenic
1159319079 18:66822974-66822996 TGATATAATTAAAGTGCTGAAGG - Intergenic
1159561643 18:70001483-70001505 TGAAATAATTTTCGTGTTCTAGG + Intergenic
1164792559 19:31000789-31000811 GGAAGTATTTAGAGTGCTTTGGG - Intergenic
1166135933 19:40777248-40777270 TGCAAAGATTAGAGGGCTCTAGG + Intronic
1167331174 19:48857312-48857334 TGAAATATCTACAGTTCTCTAGG + Intronic
925269629 2:2593430-2593452 TGAAATATTTAAAGTGCTGAAGG + Intergenic
925703643 2:6663427-6663449 TGAAATAATTTGAATGGTGTTGG + Intergenic
925715911 2:6784239-6784261 TGAAAAATTTAGAGTGCTATAGG + Intergenic
929986228 2:46735529-46735551 TGAAATAATTAGAGTGCTCTGGG - Intronic
931169326 2:59786184-59786206 AAAAATAATTAGAGTGCTTTTGG - Intergenic
931823894 2:65979460-65979482 TGAAACACTTCCAGTGCTCTGGG - Intergenic
932227553 2:70054606-70054628 TAAAATAATAAGAGGGCTCCAGG + Intergenic
935745042 2:106182936-106182958 TTAAATAATTAGGATGCACTGGG + Intronic
936653161 2:114453485-114453507 TCAAATAATTAGGGTTCTCAGGG + Intronic
936720747 2:115249998-115250020 TGACAGAATTGGAATGCTCTTGG + Intronic
937574687 2:123405815-123405837 TGAAATAGTTCAAGAGCTCTGGG - Intergenic
938619518 2:133034208-133034230 TGAAATATTTAAAGTGCTGAAGG + Intronic
938983308 2:136547449-136547471 TGAAATATTTACAGTGAGCTAGG + Intergenic
940503577 2:154525708-154525730 TGACATAATTAAAGTGCTGAAGG - Intergenic
940629586 2:156220827-156220849 TGAAATATTTAAAGTGCTGAAGG + Intergenic
942291343 2:174474536-174474558 TGAAATAATTTGTTTGCACTTGG - Intronic
943484526 2:188463310-188463332 TGACATAATTAAAGTGCTGAAGG - Intronic
943914457 2:193611015-193611037 TGCAATATTTAGATTGCTTTAGG + Intergenic
944913879 2:204337717-204337739 TGAAATAAGCAGAGTCCTGTTGG + Intergenic
946060794 2:216939796-216939818 TGAAATAATCAAAATGTTCTGGG - Intergenic
946597116 2:221318120-221318142 TGAAATCCTTAGAGTTCTCGTGG - Intergenic
1169057232 20:2633627-2633649 TCAAATAATGACAGTTCTCTGGG + Intronic
1181922504 22:26331489-26331511 TGAAATATTTAGAAAGATCTGGG - Intronic
949448299 3:4159852-4159874 TGACATATTTAAAGTGCTCTGGG - Intronic
950324400 3:12092616-12092638 TGAAATAATATGAGTGGTCCAGG - Intronic
951142907 3:19187996-19188018 TGAAGTCCTTAGAGTGCTCATGG - Intronic
951794347 3:26522181-26522203 TGAAATATTTAAAGTGCTGAGGG - Intergenic
952538127 3:34335614-34335636 TCATACAATCAGAGTGCTCTGGG + Intergenic
955274112 3:57531307-57531329 TGAAATATTTAAAGTGCTGAAGG - Intronic
956294170 3:67693962-67693984 TGAAATAATTTCAGGGCTTTGGG + Intergenic
958179332 3:90038280-90038302 GGGAATAAATACAGTGCTCTGGG + Intergenic
960860804 3:122151099-122151121 TGAAATAATTATAGTCTTCTTGG + Intergenic
961250152 3:125495973-125495995 TGAAACAATTAGAATTTTCTTGG - Intronic
963772737 3:149405357-149405379 TTAAATTTTTATAGTGCTCTGGG - Intergenic
964012982 3:151912998-151913020 TTAAATAATCAGAGTGGGCTGGG - Intergenic
969143978 4:5103885-5103907 TGAAATAGTTAGAGTTCACTCGG + Intronic
969996666 4:11319405-11319427 TAAAGTGATTGGAGTGCTCTTGG - Intergenic
971145008 4:23967101-23967123 GGAAATAAATAGGGTGCTATAGG - Intergenic
972436923 4:39044339-39044361 TCTGATAATTAGTGTGCTCTAGG - Intergenic
973307054 4:48664180-48664202 TGAAATACTCAGAGGGCTCCAGG + Intronic
974067273 4:57090446-57090468 TGAATAAAATTGAGTGCTCTGGG - Intronic
974219148 4:58943946-58943968 TTAAATAAGTAGAGTTCTGTGGG + Intergenic
974471203 4:62320159-62320181 TTAAATAATTAGATTTCTTTTGG + Intergenic
975390594 4:73812653-73812675 TGAAACAATTAGATTTCTCATGG - Intergenic
975924890 4:79437859-79437881 TGAAAGAATTAGAGAACTGTTGG - Intergenic
976237328 4:82912233-82912255 TGATATATTTAGTGTGATCTTGG + Intronic
979218934 4:118198854-118198876 TGAAATATTTAAAGTGCTGAAGG - Intronic
979559805 4:122089167-122089189 TGAAAGAATCAGAGTGCTGGTGG - Intergenic
979591976 4:122491241-122491263 TGACATCACTAGAGTGTTCTTGG + Intergenic
979735910 4:124083852-124083874 TCAAATTTTTAGAGTGCTTTTGG + Intergenic
981936685 4:150246956-150246978 TGAAATAATTAGTTCACTCTTGG - Intronic
982411764 4:155085753-155085775 TAATATAATTTGAATGCTCTTGG - Intergenic
982958860 4:161809317-161809339 TGAAATAATAAGTGTTGTCTAGG + Intronic
984062586 4:175009239-175009261 TGAAATCACTAGATTGCTTTGGG + Intergenic
984074735 4:175161712-175161734 AAAAATATTTAGATTGCTCTGGG + Intergenic
986082057 5:4405185-4405207 AGAGATAATTAAAGAGCTCTTGG + Intergenic
986499431 5:8383641-8383663 TGCAATCAATAGAGTCCTCTGGG + Intergenic
988236727 5:28555706-28555728 TGAAATATTTAAAGTGCTGATGG - Intergenic
988984856 5:36607675-36607697 TGAAATAAGCAAAGTGCTCTGGG - Intronic
990720439 5:58689380-58689402 TGAAATATTTAAATTGCTGTAGG - Intronic
992140498 5:73792013-73792035 TGGATTAATTAAATTGCTCTAGG - Intronic
992375434 5:76183714-76183736 TGAACTACCTAGAGTCCTCTTGG + Intronic
993280070 5:85914489-85914511 TGGAGTCATTAGAGTTCTCTAGG - Intergenic
993363481 5:87006312-87006334 TAAAATAATTTGAATGCTTTTGG - Intergenic
994237937 5:97386995-97387017 TGAAATAATTAAACTGCTACAGG + Intergenic
994438872 5:99775633-99775655 AGAAATAAATACAATGCTCTGGG + Intergenic
995654744 5:114412930-114412952 TGAAATACTTAGAGTTTACTTGG - Intronic
995879939 5:116833420-116833442 AGAAATAAATAGAGTGCTAGAGG - Intergenic
999807203 5:155093222-155093244 TAAAATAATCAGAGAGCTTTAGG + Intergenic
1000493279 5:161943872-161943894 TGAAATATTTATAGTGCTAAAGG - Intergenic
1001018910 5:168166065-168166087 TGATATAATTAGTGTGCTGCAGG - Intronic
1001878556 5:175222395-175222417 GGAAATAATTAAACTGCTCTGGG + Intergenic
1008050831 6:46899033-46899055 TAAAATAATTACAGTGCTTTGGG + Intronic
1008442234 6:51544938-51544960 TGAAATAATTAAAGAGTTTTGGG - Intergenic
1010488491 6:76446087-76446109 AGCAATAATCAGAATGCTCTAGG - Intergenic
1012683906 6:102218899-102218921 TAAAATAATTGTAATGCTCTTGG - Intergenic
1013908733 6:115248415-115248437 TGACATATTTAAAGTGCTCAAGG + Intergenic
1016898225 6:149074837-149074859 AGAGATAATTACACTGCTCTTGG - Exonic
1018536034 6:164819943-164819965 TGACATAATTAAAGTGCTGAAGG + Intergenic
1020766189 7:12324359-12324381 GGAAACAATTGGAGTTCTCTAGG + Intergenic
1021123932 7:16828106-16828128 TGACATATTTAGAGTGCTGAAGG + Intronic
1027563785 7:79765671-79765693 TGAGAAAATTTGAGAGCTCTTGG - Intergenic
1030472168 7:109978621-109978643 TGAAAATATTTGACTGCTCTTGG + Intergenic
1030599258 7:111573794-111573816 TGACATATTTAGAGTGCTGAAGG + Intergenic
1034025876 7:147703205-147703227 TGTTCTAATTAGAGTGATCTGGG - Intronic
1035551005 8:525162-525184 TGACATAATTAAAGTGCTGAAGG + Intronic
1036992368 8:13612698-13612720 TGAAAGAATAAGAGTTATCTAGG - Intergenic
1039328064 8:36506475-36506497 TGACAGAATTTGAGAGCTCTTGG + Intergenic
1039336277 8:36593683-36593705 TGAACTAATTTGTGAGCTCTAGG + Intergenic
1039394250 8:37209721-37209743 TAAAATAATGACAATGCTCTGGG - Intergenic
1040893773 8:52344190-52344212 TGAACTACTTAGAATGCTTTGGG - Intronic
1042159637 8:65879452-65879474 TGAAAGAGTTGGAGTGCTTTGGG - Intergenic
1045656066 8:104387702-104387724 TGAAAGAATTAAAGTGTGCTTGG + Intronic
1046434565 8:114170259-114170281 TGAAGAAATTAGAGTGATTTAGG + Intergenic
1048420009 8:134268899-134268921 TGAAATATGTAGAGGGCTGTAGG - Intergenic
1048740492 8:137553509-137553531 TGAAATAATCATGGTGCTCTGGG + Intergenic
1050248371 9:3715473-3715495 TGACATATTTAGAGTGCTGAAGG + Intergenic
1050654604 9:7813119-7813141 TGAAATAATTAAAGTATTTTTGG - Intronic
1052149519 9:25097336-25097358 TGAAATATTTTGAGATCTCTAGG - Intergenic
1052472374 9:28916211-28916233 TGAAATACTTTGATTTCTCTCGG - Intergenic
1055675782 9:78658933-78658955 TTGAATAAGTAGAATGCTCTAGG + Intergenic
1056085647 9:83147203-83147225 TGATATTTTTAGAGTGCTTTAGG + Intergenic
1056207922 9:84338154-84338176 TCAAATATTAAGAGTGCCCTTGG - Intronic
1059861274 9:118465462-118465484 TGAAATAATGGGAGTTCTTTAGG + Intergenic
1060769623 9:126322642-126322664 GGAAATTACTAGAGTGGTCTAGG + Intergenic
1188655868 X:32694487-32694509 TGAAATAATTAGAGAAATCAAGG - Intronic
1192001961 X:67160797-67160819 TGAAATATTTAAAGTGCTGAAGG + Intergenic
1192135177 X:68590019-68590041 TGCAAAAACTACAGTGCTCTAGG + Intergenic
1192406242 X:70888926-70888948 TGACATATTTAAAGTGCTGTGGG + Intronic
1192549754 X:72044482-72044504 TGTAATCATTAGAGTTCTGTGGG - Intergenic
1192614543 X:72605737-72605759 TGAAAGAATCAGAATGCTATTGG - Intronic
1193098530 X:77580506-77580528 TGAAATATTTAAAGTGCTCAAGG + Intronic
1193604711 X:83551906-83551928 TTAAATCTTTAGAGTGCTCTGGG - Intergenic
1193620000 X:83739999-83740021 TGAAATATTTAAAGTGCTGAAGG + Intergenic
1194274627 X:91864287-91864309 TGACATATTTAGAGTGCTGAAGG - Intronic
1196322264 X:114355264-114355286 TCAAATAATAACAGTTCTCTAGG - Intergenic
1196387283 X:115171974-115171996 TGAAATAATTAGAATGGGCTGGG - Intronic
1196922318 X:120596592-120596614 TGACATATTTAGAGTGCTGAAGG + Intronic
1197124298 X:122925927-122925949 TTAAAAAATTATAGTGCTTTTGG - Intergenic
1197670444 X:129271639-129271661 TGACATATTTAAAGTGCTCAAGG - Intergenic
1199368914 X:147021746-147021768 TGTAATCATTAGAGGGCTCTTGG + Intergenic
1200591869 Y:5085690-5085712 TGACATATTTAGAGTGCTGAAGG - Intronic
1201678265 Y:16612444-16612466 TGAAATAATTATAGTGGAATTGG + Intergenic