ID: 929989289

View in Genome Browser
Species Human (GRCh38)
Location 2:46771763-46771785
Sequence GGATGCAGCAAGGGCCAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929989289_929989294 0 Left 929989289 2:46771763-46771785 CCGTCCTGGCCCTTGCTGCATCC No data
Right 929989294 2:46771786-46771808 TGAGAGCCCAGCCCAGTGCTCGG No data
929989289_929989297 7 Left 929989289 2:46771763-46771785 CCGTCCTGGCCCTTGCTGCATCC No data
Right 929989297 2:46771793-46771815 CCAGCCCAGTGCTCGGCTTATGG No data
929989289_929989299 11 Left 929989289 2:46771763-46771785 CCGTCCTGGCCCTTGCTGCATCC No data
Right 929989299 2:46771797-46771819 CCCAGTGCTCGGCTTATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929989289 Original CRISPR GGATGCAGCAAGGGCCAGGA CGG (reversed) Intergenic
No off target data available for this crispr