ID: 929992564

View in Genome Browser
Species Human (GRCh38)
Location 2:46802298-46802320
Sequence CCTCCAAGCAGGGCACCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929992564_929992571 12 Left 929992564 2:46802298-46802320 CCAGACGGTGCCCTGCTTGGAGG No data
Right 929992571 2:46802333-46802355 GATGTCCTCCAGTGTCCCCGTGG No data
929992564_929992574 23 Left 929992564 2:46802298-46802320 CCAGACGGTGCCCTGCTTGGAGG No data
Right 929992574 2:46802344-46802366 GTGTCCCCGTGGCCAGTCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929992564 Original CRISPR CCTCCAAGCAGGGCACCGTC TGG (reversed) Intergenic
No off target data available for this crispr