ID: 929992879

View in Genome Browser
Species Human (GRCh38)
Location 2:46804281-46804303
Sequence CTCCAAGAGCAGTCAGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929992873_929992879 3 Left 929992873 2:46804255-46804277 CCAAAGAAAGACAGAAAGGATGC No data
Right 929992879 2:46804281-46804303 CTCCAAGAGCAGTCAGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929992879 Original CRISPR CTCCAAGAGCAGTCAGGCCG GGG Intergenic
No off target data available for this crispr