ID: 929993284

View in Genome Browser
Species Human (GRCh38)
Location 2:46807545-46807567
Sequence CACTTGAATCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929993279_929993284 9 Left 929993279 2:46807513-46807535 CCCAACTACTAAGTGGGCTGAGG No data
Right 929993284 2:46807545-46807567 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
929993276_929993284 17 Left 929993276 2:46807505-46807527 CCTGTAATCCCAACTACTAAGTG No data
Right 929993284 2:46807545-46807567 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
929993281_929993284 8 Left 929993281 2:46807514-46807536 CCAACTACTAAGTGGGCTGAGGC No data
Right 929993284 2:46807545-46807567 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929993284 Original CRISPR CACTTGAATCCAGGAGACGG AGG Intergenic
Too many off-targets to display for this crispr