ID: 929994115

View in Genome Browser
Species Human (GRCh38)
Location 2:46814471-46814493
Sequence CACAAAAAGAAGTTGAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 532}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929994105_929994115 25 Left 929994105 2:46814423-46814445 CCACTTCAGACTGATCATAAAAT 0: 1
1: 0
2: 3
3: 8
4: 207
Right 929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG 0: 1
1: 0
2: 1
3: 31
4: 532
929994107_929994115 -1 Left 929994107 2:46814449-46814471 CCCTCCTCTCTCCACGCTCCCCC 0: 1
1: 0
2: 7
3: 221
4: 2078
Right 929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG 0: 1
1: 0
2: 1
3: 31
4: 532
929994109_929994115 -5 Left 929994109 2:46814453-46814475 CCTCTCTCCACGCTCCCCCACAA 0: 1
1: 0
2: 2
3: 35
4: 518
Right 929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG 0: 1
1: 0
2: 1
3: 31
4: 532
929994108_929994115 -2 Left 929994108 2:46814450-46814472 CCTCCTCTCTCCACGCTCCCCCA 0: 1
1: 0
2: 3
3: 111
4: 1199
Right 929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG 0: 1
1: 0
2: 1
3: 31
4: 532
929994106_929994115 0 Left 929994106 2:46814448-46814470 CCCCTCCTCTCTCCACGCTCCCC 0: 1
1: 0
2: 25
3: 500
4: 2119
Right 929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG 0: 1
1: 0
2: 1
3: 31
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929994115 Original CRISPR CACAAAAAGAAGTTGAACCA AGG Intergenic
902420992 1:16279937-16279959 CACAAGAATCAGTTGAGCCAGGG - Intronic
903097484 1:20991473-20991495 CACAAAAATCACTTGAACCTGGG + Intronic
903414676 1:23173961-23173983 GACAAAAAGAATTTTAAGCAGGG + Intronic
904708141 1:32407462-32407484 CACAAAAATCACTTGAACCTGGG - Intergenic
906351189 1:45061461-45061483 CACAAAAATCACTTGAACCCAGG - Intronic
906895942 1:49772117-49772139 TACACAAAGAAGTAGAACAATGG - Intronic
907183965 1:52594907-52594929 CACAAAAATCACTTGAACCCAGG + Intergenic
910611560 1:89149196-89149218 TACAAGAAGGAGATGAACCATGG + Intronic
910716971 1:90242985-90243007 CACAAAAGGAAGGGGCACCAGGG - Intergenic
911608366 1:99933695-99933717 CACAAAAATAGCTTGAACCCGGG + Intergenic
911854381 1:102858567-102858589 CACATGAACAAGCTGAACCAAGG + Intergenic
912253370 1:108033649-108033671 TACAAAAAGAAGTTGACCGAAGG + Intergenic
912539136 1:110399180-110399202 CACAAAAATCACTTGAACCCGGG + Intergenic
912628972 1:111230048-111230070 CTCAAAAAGAACTAGAACAAGGG - Intronic
912791411 1:112655382-112655404 CACAAGAATCACTTGAACCAGGG + Intronic
912923063 1:113887793-113887815 CATAAACAGAAGTTGAACGCTGG - Intergenic
913650327 1:120907464-120907486 CACAAGAAGCACTTGAACCCAGG - Intergenic
913683832 1:121213136-121213158 CACAAAAATCATTTGAACCTGGG - Intronic
913689293 1:121263336-121263358 AACAAAAAAAACTTGAACCCGGG + Intronic
914035671 1:144000751-144000773 CACAAAAATCATTTGAACCTGGG - Intergenic
914148306 1:145016939-145016961 AACAAAAAAAACTTGAACCCGGG - Intronic
914153784 1:145067194-145067216 CACAAAAATCATTTGAACCTGGG + Intronic
914170789 1:145221606-145221628 CACAAGAAGCACTTGAACCCAGG + Intergenic
914525906 1:148465568-148465590 CACAAGAAGCACTTGAACCCAGG + Intergenic
914640496 1:149601558-149601580 CACAAGAAGCACTTGAACCCAGG - Intergenic
914743588 1:150485135-150485157 CAGAAAAAGCAGTTTAATCAAGG - Intergenic
914789730 1:150867109-150867131 CACAAAAATCATTTGAACCTAGG + Intronic
914821545 1:151108260-151108282 CACAAGAATTACTTGAACCAGGG - Intronic
914911923 1:151794421-151794443 CACAGAAATAATTTGAACAAAGG - Intergenic
915156441 1:153880372-153880394 CACAAAAATCACTTGAACCTGGG + Intronic
915188456 1:154127641-154127663 CACAAGAATCAGTTGAACCCAGG - Intronic
915295207 1:154915960-154915982 CACAAGAATCAGTTGAACCTGGG + Intergenic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
915443288 1:155960053-155960075 CAGAGAAAGAAATTGAAGCAGGG - Intronic
916229539 1:162526703-162526725 CAAAAAAATAAGGTAAACCAAGG - Exonic
916311314 1:163401811-163401833 CACAAAAATAACTTGAACCCAGG - Intergenic
916757008 1:167780985-167781007 CAGAACAAGAAATAGAACCAGGG + Intronic
917796340 1:178535400-178535422 AAAAAAAAGAATTTGAATCAGGG - Intronic
918435758 1:184511208-184511230 CAAAAGAAAAAGTTAAACCATGG + Intronic
918928673 1:190823332-190823354 CACAACAATAATTTGAACCTGGG + Intergenic
919071827 1:192765503-192765525 CACATAAAGAAGTTGATTTATGG + Intergenic
919891653 1:201979875-201979897 CAAAATAAGAAATTGGACCAAGG - Intergenic
920239868 1:204538796-204538818 CACAAGAATCACTTGAACCAAGG - Intronic
920471138 1:206231628-206231650 CACAAAAATCATTTGAACCTGGG - Intronic
920476616 1:206281819-206281841 AACAAAAAAAACTTGAACCCGGG + Intronic
921228858 1:213048487-213048509 CACAAGAATCACTTGAACCAGGG - Intergenic
922227941 1:223661823-223661845 AACAAAAAGAACTGGAAGCAGGG + Intronic
922498571 1:226080199-226080221 CACAAAAATCACTTGAACCCGGG + Intergenic
923327082 1:232889797-232889819 CACAAGAATCGGTTGAACCAGGG - Intergenic
923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG + Intronic
923455393 1:234161144-234161166 CACAAAAAGTAACTGAACCAAGG - Intronic
924651676 1:245934368-245934390 CACAATAAGAATTTTAATCAGGG + Intronic
1064902002 10:20305008-20305030 AACATGAAGAAGTTGAGCCAAGG + Intergenic
1065037968 10:21659976-21659998 CTCAAAAAAAAGTTTAAGCAAGG - Intronic
1065372494 10:25002969-25002991 CACAAAAATATATTGAATCATGG - Intronic
1065598185 10:27338280-27338302 CACGAAAATCACTTGAACCAGGG - Intergenic
1065938085 10:30539213-30539235 CACAAGAATCAGTTGAACCCAGG - Intergenic
1065997052 10:31069163-31069185 AACAAAAAGAAGTTGATACTGGG + Intergenic
1066127218 10:32353060-32353082 CAGAAAAATACCTTGAACCAAGG + Intronic
1066172478 10:32865289-32865311 CACAAAAAGAAGGTATACAAAGG + Intronic
1067355131 10:45517091-45517113 CACAACAAGAAGTCAAAACATGG + Intronic
1067465753 10:46497656-46497678 CACAACAAGGGGTTGAACCCAGG + Intergenic
1067621434 10:47886950-47886972 CACAACAAGGGGTTGAACCCAGG - Intergenic
1067760733 10:49044233-49044255 CACAAGAATAACTTGAACCAGGG + Intronic
1067773847 10:49147070-49147092 CTCAAAAAGAAGTTGAGCCTGGG - Intergenic
1068399792 10:56513519-56513541 CACATACACAAGTTGGACCAGGG - Intergenic
1068586933 10:58810246-58810268 CATAGGAAGAAGTTCAACCATGG - Intronic
1068639527 10:59387786-59387808 CACAAAAACAACTAGAACCAAGG + Intergenic
1068748285 10:60560884-60560906 AAAATACAGAAGTTGAACCACGG - Intronic
1069077908 10:64057392-64057414 CAAGAAAAGAATTTGAACCCTGG - Intergenic
1069496114 10:68904699-68904721 TACAGAGAGAAGTTGAAGCAAGG - Intronic
1070029276 10:72661397-72661419 CACAAGAATCACTTGAACCAGGG + Intergenic
1070502852 10:77088051-77088073 CACAAAAATCACTTGAACCTGGG - Intronic
1070621844 10:78018673-78018695 CACAAAAATCACTTGAACCCAGG - Intronic
1071216394 10:83407323-83407345 CACAAGAATCAGTTGAACCCAGG + Intergenic
1072034215 10:91549728-91549750 CACAAGAATCAGTTGAACCCGGG + Intergenic
1074083816 10:110192158-110192180 CACAAGAAGCGCTTGAACCAGGG - Intergenic
1074136305 10:110629939-110629961 CACAGACAGAAGTTGGATCAGGG - Intergenic
1074479092 10:113802175-113802197 CAAAATAAGAACTTGAACCTAGG + Intergenic
1074523848 10:114248012-114248034 CACAAAAATCACTTGAACCCCGG + Intronic
1074824230 10:117202967-117202989 CACAAGAATCACTTGAACCAGGG - Intronic
1074857194 10:117482155-117482177 CACAACAAGCAGTTGAAACCAGG - Intergenic
1075619822 10:123917957-123917979 CACATAAAGAAATTAAAACAGGG + Intronic
1078647116 11:13151064-13151086 GAAAAAAAGAAGCTGATCCAAGG - Intergenic
1078841445 11:15079225-15079247 TACATAGAGAATTTGAACCATGG - Intronic
1079809049 11:24972047-24972069 CACAAGAATAACTTGAACCCAGG + Intronic
1079871928 11:25808648-25808670 CCCAAAAAGAATTGAAACCATGG + Intergenic
1080691236 11:34560215-34560237 CACAAAAAGCTCTTGAACCTGGG - Intergenic
1080724248 11:34879735-34879757 CACAAGAATCACTTGAACCAGGG - Intronic
1082018580 11:47511939-47511961 CACAAGAAGCACTTGAACCCGGG - Intronic
1083280529 11:61624269-61624291 CACAAAAATCACTTGAACCCAGG - Intergenic
1083542399 11:63521798-63521820 CACAAAAATCTGTTGAACCCAGG + Intergenic
1085110506 11:73883607-73883629 CACAAAAATCACTTGAACCTGGG - Intronic
1085597487 11:77822428-77822450 AAAAAAAAGAATTTGAAGCAAGG + Intronic
1085663357 11:78390494-78390516 CACAAGAATCACTTGAACCAGGG + Intronic
1085880153 11:80457762-80457784 TAAAAAAAGAAATTGGACCAGGG + Intergenic
1086248739 11:84788007-84788029 CATAAGAATCAGTTGAACCAGGG + Intronic
1086860112 11:91915755-91915777 CACAAGAATCAGTTGAACCCGGG + Intergenic
1087836895 11:102884527-102884549 CTCCAAAAGATTTTGAACCATGG - Intergenic
1088014388 11:105040905-105040927 CATAAATAGAAGTTGACCCTAGG - Intergenic
1088418920 11:109620860-109620882 CACGAGAAGCACTTGAACCAGGG - Intergenic
1088636681 11:111827772-111827794 CACAAAAATCCCTTGAACCAGGG + Intronic
1089250653 11:117158043-117158065 CACAAAAATTGGTTGAACCCGGG + Intronic
1089439263 11:118501374-118501396 CACAAGAATCACTTGAACCAGGG + Intronic
1090751187 11:129747901-129747923 CACAAGAATCACTTGAACCAGGG - Intergenic
1090801275 11:130173995-130174017 CAAAAAAAGTATTTGAAACAAGG - Intronic
1090888313 11:130898971-130898993 CACAAGCAGAATTTGAACCCAGG - Intronic
1091310117 11:134567559-134567581 AACAAAAAGAATATCAACCATGG - Intergenic
1091517853 12:1203148-1203170 CACAAGAATCGGTTGAACCAGGG - Intronic
1091743863 12:2978494-2978516 CACAAAAATCACTTGAACCCCGG - Intronic
1091888724 12:4035652-4035674 CAGATAAAGAAATTGAAGCATGG + Intergenic
1093171724 12:15868604-15868626 CACAAGAATCACTTGAACCAAGG + Intronic
1093470226 12:19493306-19493328 CACAAAAATCACTTGAACCCAGG + Intronic
1093474675 12:19541887-19541909 CACAAGAATCAGTTGAACCTAGG - Intronic
1093758926 12:22883321-22883343 CACAAGAATAACTTGAACCCGGG - Intergenic
1094181949 12:27601238-27601260 CAAAAAAAGCAGTTGAAATAAGG - Intronic
1095168092 12:38998402-38998424 CTCATAAAGAAGTTTAAGCAAGG - Intergenic
1095722548 12:45416266-45416288 GACAAAAAGAAATGGACCCATGG - Intronic
1095896599 12:47286104-47286126 CACAAGAATCAGTTGAACCTGGG + Intergenic
1096936517 12:55285809-55285831 AACATAAACAATTTGAACCAGGG - Intergenic
1097982908 12:65752490-65752512 CCAAAGAAGAACTTGAACCAGGG + Intergenic
1098178475 12:67819549-67819571 AACAATAAGAAGTTTAACAAAGG + Intergenic
1099196128 12:79618219-79618241 CACAAAAATTACTTGAACCTTGG - Intronic
1099241056 12:80139436-80139458 CAAAAAATGAAGTTGTGCCATGG - Intergenic
1099349338 12:81545586-81545608 CAAAAATAGAAGTTGCACCATGG + Intronic
1099504841 12:83460813-83460835 CACTAAAAGAACATGAACCTAGG + Intergenic
1099855991 12:88167309-88167331 CACAAGAATCACTTGAACCAGGG + Intronic
1101118756 12:101557103-101557125 CACAAAAATTACTTGAACCCAGG + Intergenic
1101169135 12:102070284-102070306 CACAGAAATAAGCTGATCCAAGG + Intergenic
1101333772 12:103778436-103778458 CACAAGAATCATTTGAACCAGGG + Intronic
1101407786 12:104443867-104443889 CACAAAAGAAAGCTGAGCCAAGG + Intergenic
1101626773 12:106451527-106451549 CACAAGAATCAGTTGAACCCAGG + Intronic
1101913065 12:108875117-108875139 CACAAGAATCACTTGAACCAGGG + Intronic
1101949262 12:109162067-109162089 CACAAAAATCACTTGAACCCGGG - Intronic
1102131008 12:110528818-110528840 CACAAAAATCACTTGAACCCGGG - Intronic
1102312176 12:111854332-111854354 CAAAATAATCAGTTGAACCAGGG - Intronic
1102871418 12:116417056-116417078 CACAAGAAGCACTTGAACCTGGG + Intergenic
1103157178 12:118695638-118695660 GACTAAAAGAAGTTGATTCATGG + Intergenic
1103472176 12:121190682-121190704 AAAAAAGAGAAGTTGAATCAGGG - Intergenic
1103524003 12:121555463-121555485 CACAAGAATTACTTGAACCAGGG - Intronic
1103962606 12:124618320-124618342 AACAAAAAAAAGGTGAACGATGG - Intergenic
1104205377 12:126633913-126633935 CACAAAAATCACTTGAACCCAGG - Intergenic
1104356919 12:128095087-128095109 CAAAAACAGAATTGGAACCAAGG - Intergenic
1105461532 13:20594180-20594202 AACAAAGAGAAGCTGGACCAGGG - Intronic
1105542900 13:21330049-21330071 CAGAAACAGAAATTGAGCCAAGG + Intergenic
1105752148 13:23431282-23431304 CACAAAGAGAAGTCAAAGCAGGG + Intronic
1106021502 13:25920127-25920149 CACAAAAAGAATCTGAAGAAGGG - Intronic
1106193032 13:27470975-27470997 CACAAAAATCACTTGAACCCGGG - Intergenic
1106557219 13:30820225-30820247 CTCACAAAGAAATTGAACCCTGG + Intergenic
1106878972 13:34108263-34108285 CTGTAAAAGAAGTTAAACCAAGG - Intergenic
1107087018 13:36436049-36436071 CACAATAGGGATTTGAACCAGGG - Intronic
1107301034 13:38965879-38965901 TCCAAAAAGAAATTGCACCATGG + Intergenic
1107483326 13:40803305-40803327 CACAAGAAGCGCTTGAACCAGGG - Intronic
1108350650 13:49587884-49587906 CACAAAAATCACTTGAACCCAGG + Intergenic
1109318456 13:60780341-60780363 CACAAAAATCACTTGAACCCAGG - Intergenic
1109323753 13:60841680-60841702 CATAAGAATAAGTTTAACCAAGG - Intergenic
1110210980 13:72972569-72972591 CAGAAAAATGAGTTGAACCCAGG + Intronic
1110243648 13:73296659-73296681 CACAAAATTCACTTGAACCAGGG - Intergenic
1110925294 13:81143135-81143157 AACAAAAAGAATTTCAAACAGGG + Intergenic
1110952094 13:81507645-81507667 TCCAAAAAGAAATTGATCCATGG - Intergenic
1111718042 13:91905451-91905473 TACAAAAAGAAGTGGGTCCAAGG + Intronic
1112193616 13:97202960-97202982 CAAAACAAGAAGTGGAGCCAAGG - Intergenic
1112469624 13:99675944-99675966 CACAAGAACAACTTGAACCCGGG - Intronic
1113041741 13:106110711-106110733 CACAAAAGGAATTTCAAACATGG - Intergenic
1113161324 13:107384726-107384748 AAACAAAAGAAGGTGAACCATGG + Intronic
1114739561 14:25081434-25081456 CACAAGAATCACTTGAACCAAGG - Intergenic
1114879421 14:26765647-26765669 CACAAAAATAAGTGAAAGCAAGG - Intergenic
1115250067 14:31335744-31335766 CACAAGAATCAGTTGAACCCAGG - Intronic
1115989485 14:39137632-39137654 GACAAAAAGAAGGGGAAGCAGGG + Intergenic
1117300304 14:54419063-54419085 CACAAAAATCACTTGAACCTGGG + Intronic
1119298078 14:73549479-73549501 CAGAAAAAGAAATTGAGGCAAGG + Intronic
1119302367 14:73581663-73581685 CAGAAAAAGAAATTGAGGCAAGG + Intergenic
1119354649 14:73995885-73995907 AACAAAAAGAATTGGAAACAGGG - Intronic
1119440826 14:74627550-74627572 CACAAGAATCAGTTGAACCTGGG + Intergenic
1119710729 14:76821303-76821325 CACAAGAATCAGTTGAACCCGGG - Intronic
1120030305 14:79633404-79633426 TACAAAAATAACTGGAACCAAGG - Intronic
1122230048 14:100302136-100302158 CACAAAAATCACTTGAACCTGGG - Intronic
1124603867 15:31156102-31156124 CACAAGAATCAGTTGAACCTGGG + Intronic
1125142045 15:36419746-36419768 CAGAAAAAGAAGGTGAGTCAAGG + Intergenic
1126501195 15:49347236-49347258 CACAAAAATAAGTAGAGACATGG + Intronic
1127814754 15:62598184-62598206 CACACAAAGAAGTTAGACCCTGG + Intronic
1128222704 15:65980489-65980511 CACAAGAATAACTTGAACCAGGG - Intronic
1128285065 15:66429850-66429872 AACAAAAAGAACTGGCACCATGG - Intronic
1128376937 15:67083446-67083468 CACAAAAAGGCTTTGATCCAGGG + Intronic
1128945860 15:71820282-71820304 TACAACAAGAAGTTGAATAATGG - Intergenic
1129203198 15:74018228-74018250 CACAAGAATCACTTGAACCAGGG + Intronic
1129286215 15:74527170-74527192 GAAAGAAAGAACTTGAACCAAGG - Intergenic
1129581205 15:76812393-76812415 CACAAAAATCACTTGAACCTGGG + Intronic
1130443006 15:83974086-83974108 GACAGAAAGAATTTGAACAAGGG - Intronic
1130621169 15:85464028-85464050 GACAAAAAGAAGTAGGAACAGGG - Intronic
1132057937 15:98666386-98666408 CCCAAAAAGAAGTGAAAGCAGGG + Intronic
1132435306 15:101796226-101796248 CACAAAAATCACTTGAACCTGGG - Intergenic
1133213393 16:4275497-4275519 AAAAAAAAAAAATTGAACCAGGG - Intergenic
1133747570 16:8698851-8698873 CACAAGAATCACTTGAACCAAGG + Intronic
1134142182 16:11729999-11730021 CACAAGAAGCACTTGAACCCAGG + Intronic
1135116519 16:19728339-19728361 CACAAGAATCATTTGAACCAGGG - Intronic
1135340253 16:21639608-21639630 CACAAAAACAAATTAAACAATGG - Exonic
1135344277 16:21675240-21675262 CACAAAAATCACTTGAACCTGGG - Intergenic
1135470316 16:22723679-22723701 CACGAGAAGAACTTGAACCTGGG + Intergenic
1136130927 16:28220748-28220770 CACAAGAATCACTTGAACCAGGG - Intergenic
1137338908 16:47579087-47579109 CACAAAAAGACTTAGAAACATGG - Intronic
1137454413 16:48607532-48607554 CTCTAACACAAGTTGAACCAGGG + Intronic
1137690011 16:50419126-50419148 CACAAGAAGCACTTGAACCCAGG - Intergenic
1138714198 16:59002974-59002996 CAGAAGAAGAAGTTGAGCCTTGG + Intergenic
1138922285 16:61546347-61546369 CACATAGAGAAGTTGATCAAAGG - Intergenic
1139240877 16:65390823-65390845 CACAAGAATCACTTGAACCATGG - Intergenic
1139539938 16:67607396-67607418 CACGAAAAGAACTTGAACCCTGG - Intronic
1140175902 16:72659429-72659451 AAAAAAAACAAGTAGAACCAAGG - Intergenic
1141371355 16:83489088-83489110 CACAAGAAAAAGATGAAGCATGG + Intronic
1141605248 16:85149433-85149455 CATAAAAAGAAGCTGAGCCTGGG + Intergenic
1142014450 16:87737182-87737204 CACAGCCAGAATTTGAACCAAGG + Intronic
1143664940 17:8352092-8352114 CACAAAAATCACTTGAACCCAGG + Intergenic
1147471023 17:40661357-40661379 CACAAAAATTACTTGAACCTGGG - Intronic
1147749382 17:42719642-42719664 CACAAGAATCACTTGAACCAGGG + Intronic
1148038176 17:44684602-44684624 CACAAGAATAACTTGAACCCAGG + Intronic
1149350923 17:55786188-55786210 CACGAAAATAACTTGAACCCGGG + Intronic
1151710433 17:75801938-75801960 CACAAGAATCACTTGAACCAGGG - Intronic
1153245807 18:3072024-3072046 CAAAAAAAGAAAATGATCCAGGG + Intronic
1153734040 18:8045831-8045853 CTCAAAAAGATGTTGAAAAAAGG + Intronic
1153867799 18:9289079-9289101 AACAAAAAGATGTGGACCCAAGG + Intergenic
1153890043 18:9504919-9504941 CACAAGAATCAGTTGAACCCGGG - Intronic
1155473313 18:26213121-26213143 CACAAGAATCAGTTGAACCCAGG - Intergenic
1155927501 18:31672728-31672750 CAGATAAAGAAATTGAAGCATGG + Intronic
1155930197 18:31698972-31698994 CACAAGAATCACTTGAACCAGGG + Intergenic
1157861480 18:51144871-51144893 CACAAGAATCACTTGAACCATGG - Intergenic
1158447773 18:57536152-57536174 CTCAAAAATAAGTTTAACCAGGG + Intergenic
1158575216 18:58631481-58631503 CACAAACAGAACATGATCCAGGG + Intergenic
1158754782 18:60308915-60308937 TAAAAAAAAAAGTTGGACCATGG + Intergenic
1160572551 18:79828014-79828036 CACAAGAATCACTTGAACCAGGG - Intergenic
1160945533 19:1641543-1641565 CACGAAAAGCACTTGAACCTGGG - Intronic
1161798133 19:6399561-6399583 CACAAAAATCACTTGAACCCGGG - Intergenic
1162065902 19:8125319-8125341 TACAAAAATCAGTTGAACCCAGG + Intronic
1164706830 19:30325989-30326011 CACAAACAGAAATTGAACTTGGG + Intronic
1164991342 19:32686563-32686585 CACAAGAATCACTTGAACCAGGG + Intergenic
1165472636 19:36012065-36012087 CACAAGAATCAGTTGAACCCAGG + Intronic
1165647724 19:37457344-37457366 GAAAAAAAGAAGTTTAAACAGGG - Intronic
1166154292 19:40899327-40899349 CACAAAAATCACTTGAACCCGGG + Intergenic
1166173592 19:41049682-41049704 CACAAAAATCACTTGAACCCGGG + Intergenic
1166173816 19:41051256-41051278 CACAAAAATCACTTGAACCCGGG - Intergenic
1166292154 19:41870147-41870169 CACAAAAATCACTTGAACCCGGG + Intronic
1167551492 19:50163857-50163879 CACAAAAATAGGTTGAACCTGGG - Intergenic
924965570 2:73447-73469 CACAAAGAGAGGCTGAGCCATGG + Intergenic
925066269 2:931085-931107 CACACAAAGAAGTGAAAACAAGG + Intergenic
925930912 2:8707059-8707081 CATTAAAACAGGTTGAACCAAGG + Intergenic
926533171 2:14077741-14077763 AACAAAAACAAGGTGAATCAGGG - Intergenic
927488384 2:23504662-23504684 CAGAAAAAGAAGCTGGAGCAAGG + Intronic
927923638 2:26993549-26993571 CACAGAAAGAAGTTGTTCCAGGG + Intronic
927930996 2:27044166-27044188 CACAAAAAGAAGTTATATCAAGG - Intronic
928689061 2:33780146-33780168 CAGAAAAAGAAGGTGACCTATGG - Intergenic
929780521 2:44954142-44954164 CACAAGAAGCACTTGAACCCAGG + Intergenic
929793971 2:45044301-45044323 CACAAAAAGCAGCAGAAACATGG - Intergenic
929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG + Intergenic
930782205 2:55233719-55233741 CACAAAAATCACTTGAACCCGGG - Intronic
931480994 2:62639749-62639771 CAAAAAAAGAAGTTCAACATGGG + Intergenic
931616652 2:64165951-64165973 GACAAAATGATGTTGAAACAGGG - Intergenic
931858939 2:66333568-66333590 CACAAGAATCACTTGAACCAGGG + Intergenic
933878239 2:86641999-86642021 CACAAGAATCATTTGAACCAGGG - Intronic
936127463 2:109801444-109801466 CACAAAAATCAGTTGAACCCAGG - Intronic
936217234 2:110570041-110570063 CACAAAAATCAGTTGAACCCAGG + Intronic
936270992 2:111048931-111048953 CCCAAAAGGAAGCTGAACCCAGG + Intronic
936426374 2:112424624-112424646 CACAAAAATCAGTTGAACCCAGG + Intronic
938849433 2:135245542-135245564 CACAAGAATCACTTGAACCAGGG - Intronic
938889344 2:135687100-135687122 CACAAGAAGCACTTGAACCTGGG + Intronic
938978882 2:136506989-136507011 CACAAATAAAAGTTGACCCTGGG - Intergenic
940155514 2:150651994-150652016 CACTAATAGAGGTTGAAACATGG + Intergenic
940549939 2:155141028-155141050 CCAAAAAAGAAGTGGAAGCAAGG - Intergenic
941771426 2:169349782-169349804 CAGAAGAAGAAGTTGAACTCTGG - Intronic
942302959 2:174580041-174580063 CACAAGAATCACTTGAACCAAGG - Intronic
942967280 2:181911861-181911883 CACAGCAAGAACTTGAACCCAGG + Intronic
943481079 2:188418538-188418560 CACAAGAATCAGTTGAACCTGGG + Intronic
943577249 2:189644535-189644557 CACAAGAATCACTTGAACCAAGG + Intergenic
943948180 2:194094194-194094216 CACAAATACAATTTGAACAATGG - Intergenic
944255897 2:197623569-197623591 CACAAGAATCAGTTGAACCTGGG - Intronic
944438725 2:199719979-199720001 CATAAAAATAAGTTTAACCTAGG - Intergenic
944939080 2:204603727-204603749 CACAAAAAGAATATGAAACTAGG + Intronic
946484322 2:220086402-220086424 CACAAAAAGAAGTAGAGCTGGGG - Intergenic
947206941 2:227669468-227669490 CACAAGAAGCACTTGAACCCAGG + Intergenic
948094509 2:235322777-235322799 CACAAAAATCACTTGAACCCAGG + Intergenic
948397974 2:237661526-237661548 CAGGAACAGAAGGTGAACCAGGG - Intronic
1169214889 20:3786998-3787020 CTCAAAAAGAATAAGAACCAGGG + Intronic
1169785038 20:9350649-9350671 CACAAGAATAACTTGAACCCGGG - Intronic
1170689010 20:18595357-18595379 CACAAAAATCGCTTGAACCAGGG - Intronic
1171529125 20:25840349-25840371 CACAAAAAACACTTGAACCCAGG - Intronic
1171547701 20:26015536-26015558 CACAAAAAACACTTGAACCCAGG + Intergenic
1171984730 20:31651825-31651847 CACAAAATGAAGTTGAAGGCTGG + Intergenic
1172064920 20:32212672-32212694 CACAAAAATCACTTGAACCCGGG - Intronic
1172397991 20:34623225-34623247 CAGAAAAGGAAGTTGCACCAGGG + Intronic
1172525830 20:35600298-35600320 CACAGAAAGAAGTGCGACCAAGG + Intergenic
1172539858 20:35702912-35702934 AAGAAAAAGAAATTGAACCTTGG + Intergenic
1172709984 20:36914441-36914463 CAGAAAAATAACTTGAACCCGGG - Intronic
1172909804 20:38399581-38399603 CACAAGAATCACTTGAACCAGGG - Intergenic
1175103119 20:56594320-56594342 TACAAAAAGAGCTTGAACCTGGG + Intergenic
1175406319 20:58732887-58732909 CACAAAAATCACTTGAACCCAGG - Intergenic
1175659468 20:60799880-60799902 CACAAGAATCACTTGAACCAAGG - Intergenic
1176041738 20:63069306-63069328 CAGAAAAATCACTTGAACCAGGG - Intergenic
1176427020 21:6554374-6554396 CACAGAAATATGTTGAACCACGG + Intergenic
1177011188 21:15731277-15731299 TAAAAAAAGAAGTTAAATCATGG - Intronic
1177105791 21:16953975-16953997 CACAAGAATAACTTGAACCCAGG - Intergenic
1178119154 21:29450452-29450474 CACAAAAATCACTTGAACCCGGG - Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178166061 21:29979040-29979062 CACAAAAAGAACTTGTTCCAAGG + Intergenic
1179032024 21:37729315-37729337 CCCAAAAAGAAGAAGAATCAGGG - Intronic
1179702511 21:43162696-43162718 CACAGAAATATGTTGAACCACGG + Intergenic
1180105355 21:45614855-45614877 CACAAAAATCACTTGAACCCGGG + Intergenic
1180607618 22:17071644-17071666 CACAAGAATAACTTGAACCTGGG - Intergenic
1180863500 22:19101646-19101668 CACAAGAATCACTTGAACCAGGG + Intronic
1181158450 22:20940794-20940816 CAGTAAAGGAAGTTGTACCATGG - Intronic
1181817725 22:25451209-25451231 CACAAAAATCACTTGAACCTGGG - Intergenic
1182068834 22:27449024-27449046 CAGAAAATGCAGTTGAACCAAGG + Intergenic
1182305999 22:29368832-29368854 CACAAGAAGCACTTGAACCCAGG + Intronic
1182449432 22:30410103-30410125 CACAAAAATCACTTGAACCCGGG + Intronic
1182478149 22:30588109-30588131 CACAAGAAGAAGGTTAACAAGGG - Exonic
1182736829 22:32536783-32536805 CACACAAAGAAGCTGAACTTGGG + Intronic
1183846814 22:40548264-40548286 CACAAGAATCACTTGAACCAGGG + Intronic
1184482231 22:44754446-44754468 CACGAGAAGCACTTGAACCAAGG - Intronic
949424614 3:3903590-3903612 CACAAAAATCACTTGAACCAGGG - Intronic
950743960 3:15072297-15072319 CACAAATATCACTTGAACCAGGG + Exonic
950975682 3:17240998-17241020 CACAAAAAAATGTTCAACAAAGG - Intronic
951283424 3:20780102-20780124 AACAAGTAGAAGTTGACCCAAGG + Intergenic
951404300 3:22275990-22276012 CACAAAAATCACTTGAACCCAGG + Intronic
951802269 3:26609077-26609099 CACAATTAGAGGTAGAACCAGGG - Intergenic
952176233 3:30866364-30866386 CACAAGAATCAGTTGAACCTGGG + Intronic
952579653 3:34817565-34817587 AAGAAAAATAAGTTTAACCAAGG - Intergenic
952929014 3:38345569-38345591 CAGAAGAATCAGTTGAACCAGGG + Intergenic
953004585 3:38966416-38966438 TACAAAAAAAAGATGAAGCAAGG + Intergenic
953056742 3:39393590-39393612 CACAAGAATCACTTGAACCAGGG - Intronic
953210951 3:40874761-40874783 CATAAGAAAAAGATGAACCAAGG + Intergenic
953602212 3:44378285-44378307 CACAAGAATCACTTGAACCAAGG + Intronic
953619408 3:44520106-44520128 GCCAAAAAGAAATTGCACCAAGG - Intergenic
954312023 3:49777141-49777163 CACAAAAATCACTTGAACCTAGG + Intronic
954344008 3:49980770-49980792 AAAAAAAAAAAGTTGAACCTGGG + Intronic
954557301 3:51528167-51528189 CACAAAAATCAGTTGAAGCCAGG - Intergenic
955208964 3:56923222-56923244 CAAAAAAAGAAGCAGAACAATGG + Intronic
955915015 3:63899153-63899175 CACAAAAATCACTTGAACCTAGG - Intronic
956058054 3:65321673-65321695 CACAAGAATCAGTTGAACCCAGG - Intergenic
956527320 3:70179264-70179286 CTCAAAAAGAAGGGGAACCAAGG - Intergenic
956835884 3:73095739-73095761 CACAAGAATCAGTTGAACCCAGG - Intergenic
957004694 3:74931544-74931566 GACAAAAATAAGCTGAAACATGG + Intergenic
957758986 3:84531037-84531059 AACAAGAAGAAGGTGCACCAAGG - Intergenic
957933460 3:86912445-86912467 CACAAAAATCACTTGAACCTGGG - Intergenic
959010270 3:101067886-101067908 AATAAAAAAAAGTTGAACAACGG + Intergenic
959260262 3:104070129-104070151 TACAAAAAGAGGTTGAATAAGGG - Intergenic
959386579 3:105715944-105715966 CAGAAAAATCACTTGAACCAGGG + Intronic
959455105 3:106550202-106550224 CACACACAAAAGTTCAACCAAGG + Intergenic
959625959 3:108451285-108451307 CACAATAATCACTTGAACCAGGG + Intronic
961032134 3:123615424-123615446 CACAAGAATCACTTGAACCAAGG - Intronic
961207195 3:125093929-125093951 GAGAAAAAGATGGTGAACCAGGG - Intronic
962230209 3:133658712-133658734 CACAAGAATCACTTGAACCAAGG + Intronic
962512207 3:136113700-136113722 CACAAGAAGCACTTGAACCTGGG + Intronic
962698059 3:137970540-137970562 CAAAACAAGAAGTTAAACCCAGG + Intergenic
962938334 3:140102276-140102298 CCCAAAGAGAAGTTGTACCAAGG + Intronic
963277434 3:143346698-143346720 CACAAAAATCATTTGAACCTGGG + Intronic
964042313 3:152276420-152276442 CACAATAAGGAGTTGAACCAAGG + Intronic
964301952 3:155297938-155297960 CACAAAAATCACTTGAACCTGGG + Intergenic
965164686 3:165181775-165181797 CAGAAACAGAAGTAGAAGCAGGG + Intergenic
965274058 3:166657827-166657849 CAGGAAAATAACTTGAACCAAGG + Intergenic
965616554 3:170599414-170599436 CAGAAAAAGAAGTTGAAGGCAGG - Intronic
966764873 3:183451754-183451776 CAGATAAAAATGTTGAACCAAGG + Intergenic
967064902 3:185906353-185906375 CACAAGAAGATCTTGAACCTGGG - Intergenic
967677738 3:192319502-192319524 CACGAGAAGAACTTGAACCTGGG + Intronic
968166266 3:196467645-196467667 CACAAAAATCACTTGAACCCAGG - Intergenic
969123905 4:4931810-4931832 CAGAAGAAGAATTTGAACCTAGG + Intergenic
970202437 4:13623563-13623585 CACCCAAAGAAATGGAACCATGG - Intronic
970527824 4:16950096-16950118 CACAAAAATCACTTGAACCTGGG + Intergenic
970981574 4:22105007-22105029 CACAAAAAGAACTTTAGACATGG - Intergenic
971602150 4:28606802-28606824 TACATAATGAAGTTAAACCAAGG - Intergenic
972135770 4:35891305-35891327 CACAAAAATCACTTGAACCCAGG - Intergenic
972161260 4:36231034-36231056 CACACAAAGAAGTTACACCTCGG + Intronic
972172166 4:36359554-36359576 TACAGAAGGAAGGTGAACCATGG - Intergenic
973476986 4:50909772-50909794 AACTAACAGAAGTTGAACCTTGG + Intergenic
973549442 4:52018365-52018387 CACAAAAATAAGTTTAAAAATGG + Intergenic
973603136 4:52561440-52561462 CAGAGAGAGAAGCTGAACCAAGG - Intergenic
974001025 4:56510862-56510884 CACAAAAATCACTTGAACCCAGG - Intronic
974071886 4:57131392-57131414 CAAATACAGAAATTGAACCAAGG - Intergenic
974940636 4:68463392-68463414 CACAAAAATCACTTGAACCCAGG - Intronic
975176723 4:71297982-71298004 CAGAAGCAGAACTTGAACCAAGG - Intronic
976125406 4:81829000-81829022 AAGATAAAGAAGTTGGACCATGG + Intronic
976725200 4:88209215-88209237 CACAAGAATCACTTGAACCAGGG + Intronic
977188189 4:93966918-93966940 CACAAAAATAAGGTGAATAATGG + Intergenic
978562979 4:110053220-110053242 CAGAAGAAGAAGAAGAACCAGGG - Intronic
978573789 4:110168424-110168446 CACAAAAATCACTTGAACCCAGG + Intronic
978686646 4:111453097-111453119 AATAAAAAGAAGTTTAAGCAAGG - Intergenic
979299313 4:119068315-119068337 CACAAAAATCACTTGAACCCAGG + Intergenic
979482130 4:121231597-121231619 GAAAAAAAGGAGATGAACCATGG + Intergenic
980443154 4:132872858-132872880 CACAACAATAACTTGAACCCAGG + Intergenic
980703569 4:136462732-136462754 GACAAAAAGGAGTTTAATCAAGG - Intergenic
980901341 4:138908093-138908115 CACAAAAATTGCTTGAACCACGG + Intergenic
981263302 4:142749045-142749067 CACAAGAAGTACTTGAACCTGGG + Intronic
981347359 4:143691713-143691735 CACAGAAAAAAGTTAAAACATGG + Intronic
981997553 4:150990926-150990948 CACAAGAATCACTTGAACCAGGG + Intronic
983270898 4:165560418-165560440 CATAAAAAGAAGTTAAAGCATGG + Intergenic
983995703 4:174179036-174179058 CATAAAAATAAGTTGAAAGAAGG + Intergenic
984207404 4:176801473-176801495 GACAAAAAGAGGTTCAACAAAGG - Intergenic
984355230 4:178650419-178650441 AACAACAAGAAGTTAAACAACGG - Intergenic
984529923 4:180903121-180903143 CAGAACAAGAACTTGAACCCGGG - Intergenic
985174436 4:187186290-187186312 CATGAAAAGAAGTTGATTCAGGG + Intergenic
986627217 5:9733409-9733431 CACAAAATGAAGTGACACCAGGG - Intergenic
987208135 5:15649087-15649109 CACAAGAATAGCTTGAACCAGGG - Intronic
987241698 5:16006675-16006697 CACAAAAATTACTTGAACCCGGG - Intergenic
987495559 5:18639260-18639282 CACAAAAATATCTTGAACCCTGG + Intergenic
988346647 5:30045406-30045428 GAATAAAAGAAGTAGAACCAAGG - Intergenic
988401467 5:30766636-30766658 CACACAAAGAGGTTGAGACAGGG - Intergenic
988574883 5:32411988-32412010 CAAAAAAAGAAGTGGAAGGAGGG + Intronic
989069469 5:37495803-37495825 AACAAAATGAAGTTCAACTAAGG - Intronic
989211039 5:38859803-38859825 CCTAAAAATAAATTGAACCATGG - Intronic
989315859 5:40077938-40077960 CTCAAAAAGTGGTTGGACCAGGG - Intergenic
989432495 5:41372089-41372111 CACAAAAAAAAGTTGAAAGGAGG - Intronic
990583882 5:57191176-57191198 CACAAGAATCACTTGAACCAAGG - Intronic
991224318 5:64251862-64251884 CCTAGAAATAAGTTGAACCAAGG + Intronic
992845301 5:80740805-80740827 CACAAGAATCACTTGAACCAGGG - Intronic
992983141 5:82198345-82198367 CACAAGAATTAGTTGAACCCAGG - Intronic
993313996 5:86375921-86375943 CAGAAAAAGAAGTGGCACAAAGG - Intergenic
993480905 5:88423315-88423337 CACATAAAGCAGTTGACCCTGGG - Intergenic
993641895 5:90415897-90415919 CATAGAGAGAAGTTAAACCATGG - Intergenic
995693977 5:114859085-114859107 CACAAAAGAAGCTTGAACCAGGG + Intergenic
995826719 5:116307600-116307622 AACAAAAAGAAGTTGCACGGAGG - Intronic
996096481 5:119404694-119404716 AAAAAAAAAAAGATGAACCAAGG - Intergenic
997161262 5:131611577-131611599 CACAAAAATCACTTGAACCTGGG + Intronic
997556344 5:134802255-134802277 CACAAAAATCACTTGAACCTGGG - Intronic
997815031 5:137008458-137008480 AAGAAAAGAAAGTTGAACCAAGG + Intronic
998548014 5:143048351-143048373 CACAAAAATCACTTGAACCTAGG - Intronic
998910565 5:146955630-146955652 CACAAGAAGAACTGGAACAAAGG + Intronic
999072308 5:148758773-148758795 CAAAATAAGAAGTTCAACAAAGG - Intergenic
999104015 5:149053108-149053130 CACAAATAGTGGTTGAGCCAAGG - Intronic
999799272 5:155018273-155018295 CACAAGAATCACTTGAACCATGG - Intergenic
999807417 5:155095474-155095496 CACAAGAATCACTTGAACCAGGG + Intergenic
999831261 5:155322458-155322480 CACAAACAGATGTTCAAGCAGGG + Intergenic
1000764965 5:165276346-165276368 AACAAAAAGAAATTGAAGCATGG - Intergenic
1000876799 5:166649583-166649605 CAGAAGAATCAGTTGAACCAGGG + Intergenic
1001485545 5:172117184-172117206 CACAAGAAGCACTTGAACCTGGG + Intronic
1001729107 5:173935872-173935894 CAAAAAAATAATTTGATCCATGG - Intronic
1001776840 5:174335293-174335315 CACAAGAATCACTTGAACCAGGG - Intergenic
1003783324 6:9454585-9454607 CACCAAAAGAAGTTAAATGATGG + Intergenic
1004072818 6:12316997-12317019 CACAAGAATCACTTGAACCAGGG + Intergenic
1005186820 6:23171822-23171844 CACAAGAAGAGCTTGAACCCAGG + Intergenic
1005332563 6:24764053-24764075 CACAAGAATCACTTGAACCAGGG - Intergenic
1005340497 6:24839426-24839448 CCAAAAAAGAAGTACAACCATGG + Intronic
1005649865 6:27876483-27876505 CACAAGAATCAGTTGAACCCAGG + Intergenic
1005683125 6:28226069-28226091 CTCAAAAAGAAGTTGACCTTGGG + Intronic
1006061613 6:31424550-31424572 CACAAAAAGAAGTGAAATAACGG - Intergenic
1006782296 6:36640193-36640215 CACAAAAATCACTTGAACCCGGG - Intergenic
1007015933 6:38466668-38466690 CACGAAAATAACTTGAACCTGGG - Intronic
1007586983 6:42997086-42997108 CACAAAAATCACTTGAACCCGGG - Intronic
1007643090 6:43358644-43358666 CACAAGAATCACTTGAACCAGGG - Intronic
1008278458 6:49567900-49567922 CACAAAAATTGCTTGAACCAGGG - Intergenic
1009689704 6:67013141-67013163 CACAAGAATCATTTGAACCAGGG - Intergenic
1010370972 6:75106992-75107014 CACGAAAAGCATTTGAACCTGGG - Intronic
1010732052 6:79401549-79401571 CACAAAAATCACTTGAACCCAGG - Intergenic
1010923709 6:81717281-81717303 CACAAAAACATTTTGAATCAAGG + Intronic
1011628218 6:89300415-89300437 CACAAGAATCACTTGAACCAAGG + Intronic
1011713206 6:90076292-90076314 CACAAAAAGAAAATAAAACAAGG + Intronic
1012566705 6:100665051-100665073 CACAGTAAGAAGTTAAACAAGGG + Intronic
1014446896 6:121538526-121538548 CACAAGAATCACTTGAACCAAGG + Intergenic
1015105545 6:129532338-129532360 CACAAGAAGCACTTGAACCCGGG - Intergenic
1015590622 6:134819379-134819401 CACAAAAAGCAGTTGATCCCTGG - Intergenic
1016729192 6:147409321-147409343 CACAAGAAGCACTTGAACCCAGG - Intergenic
1017140713 6:151187508-151187530 CACAAGAATCAGTTGAACCCGGG + Intergenic
1017425449 6:154315950-154315972 CACAAGAATAACTTGAACCTGGG - Intronic
1017767455 6:157618412-157618434 CACAAAAATCACTTGAACCCAGG - Intronic
1018285923 6:162237607-162237629 CACAAAAAGAAGGTGGAGAAAGG + Intronic
1021083418 7:16390428-16390450 CACAAAAATACATTTAACCAAGG + Intronic
1022154883 7:27650293-27650315 CTCAAAAAGATGTTAAACCCAGG + Intronic
1022651297 7:32278075-32278097 AAAAAAAAGAAGCTGAAACACGG + Intronic
1022670286 7:32449160-32449182 CACAAGAAACACTTGAACCAGGG + Intergenic
1022888222 7:34668168-34668190 CACATAAAGATATTGAACGAAGG + Intronic
1023711190 7:42994629-42994651 CATAAAAAGAAGTGTAAGCATGG - Intergenic
1024502431 7:50125004-50125026 CACAAAAATCACTTGAACCCAGG + Intronic
1024713576 7:52046683-52046705 TACCAAAAGAAGTCAAACCATGG + Intergenic
1025145630 7:56499700-56499722 CTCAAATAGAAATTGAACAACGG + Intergenic
1026451839 7:70536194-70536216 CACAAGAATCACTTGAACCAGGG + Intronic
1026587129 7:71665068-71665090 CACAAGAATCAGTTGAACCCGGG - Intronic
1026661674 7:72308269-72308291 CACAAAGATCATTTGAACCAGGG + Intronic
1026997189 7:74625254-74625276 CACAAGAATCAGTTGAACCCAGG + Intergenic
1027456602 7:78399710-78399732 CACAAGAATAATTTGAACCTGGG + Intronic
1028283776 7:88968341-88968363 CAGAAAAAGATGATGAATCAGGG - Intronic
1028739747 7:94260089-94260111 CAAAAACAAAATTTGAACCAAGG + Intergenic
1029107174 7:98187701-98187723 CACAAGAATTACTTGAACCAGGG - Intronic
1029315614 7:99710502-99710524 AACAGAAAGCAGATGAACCAGGG + Intronic
1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG + Intronic
1029934719 7:104411719-104411741 CACGAAAAGAAGTTCAAAGAAGG + Intronic
1032381565 7:131488889-131488911 CACACAAAAAATTTGACCCATGG - Exonic
1032527924 7:132593830-132593852 CACAAAAAGAGGTTGAATGAAGG + Intronic
1033441678 7:141385794-141385816 CAGAAATAGAAGTGGACCCAAGG - Intronic
1033626853 7:143118593-143118615 CACGAAAACAACTTGAACCCTGG + Intergenic
1034575112 7:151990133-151990155 CACAAAAATCACTTGAACCCAGG - Intronic
1035164311 7:156975986-156976008 CACAAGAATCACTTGAACCAGGG - Intergenic
1036289683 8:7476435-7476457 CACAAAAAGAAAATTAGCCAGGG + Intergenic
1036331795 8:7835097-7835119 CACAAAAAGAAAATTAGCCAGGG - Intergenic
1036383387 8:8254930-8254952 CACACAAAGAACTTGAACATTGG - Intergenic
1036451468 8:8871455-8871477 CACAAGAATCATTTGAACCAGGG + Intronic
1036596583 8:10218443-10218465 CACCAAAAGAAAAGGAACCAGGG - Intronic
1037954638 8:23045135-23045157 CACAAAAATCACTTGAACCTGGG + Intronic
1038044640 8:23755763-23755785 TCCAAAGAAAAGTTGAACCAGGG - Intergenic
1038049274 8:23793762-23793784 CACATAAAGAAGTTGGAACTTGG - Intergenic
1038177977 8:25198477-25198499 CACAAAAATCACTTGAACCCGGG + Intronic
1038564250 8:28606645-28606667 CACAAGAACAACTTGAACCCAGG - Intronic
1038724329 8:30066880-30066902 CAAAACCAGAAGTTGCACCATGG + Exonic
1039477293 8:37846253-37846275 CACAAAAATCACTTGAACCCGGG + Intronic
1039508798 8:38072348-38072370 CACAAAAATCACTTGAACCCAGG + Intergenic
1039788224 8:40852671-40852693 CACCAAAAGAAGTTTTACAATGG - Intronic
1041770787 8:61470765-61470787 CCTAAAAAGAAATTCAACCATGG - Intronic
1042045014 8:64640924-64640946 CACAAATAGAAGTTGCCCTATGG - Intronic
1043347870 8:79321105-79321127 TACTAAATGAAGTTGAACCTGGG - Intergenic
1044057982 8:87596418-87596440 CACCAGAAGCAGTTGAACCTGGG - Intronic
1045123110 8:99060033-99060055 CTCAAAAAGAAGCTAAACCTTGG - Intronic
1045931225 8:107629041-107629063 CAGGAAACAAAGTTGAACCAGGG - Intergenic
1046605900 8:116372312-116372334 CAGATAAAGAATTTGAAGCATGG - Intergenic
1046696424 8:117344837-117344859 CAAAACAAGAAGTTGCACAAAGG + Intergenic
1046719549 8:117603843-117603865 CAGAAACAGAAGTTGAACTCAGG + Intergenic
1047278997 8:123428691-123428713 CACAAAAATCACTTGAACCTGGG - Intronic
1047752632 8:127893367-127893389 CACAAGAATCACTTGAACCAAGG - Intergenic
1047758581 8:127937338-127937360 CACAAAAATCACTTGAACCCAGG - Intergenic
1048681179 8:136843224-136843246 CACAACCAGCACTTGAACCATGG + Intergenic
1050551204 9:6749891-6749913 CACAAGAATCACTTGAACCAGGG + Intronic
1050735516 9:8758038-8758060 CACAGATGGAAGTTGAAGCACGG - Intronic
1051905124 9:22085991-22086013 AACAGAAAGAAGATGAACCTTGG + Intergenic
1051920173 9:22256101-22256123 CACATAAAGAAGTCAAAGCATGG - Intergenic
1053215080 9:36264223-36264245 CACAAAAATTACTTGAACCTGGG - Intronic
1053460215 9:38262888-38262910 CACAAAAATCACTTGAACCCAGG + Intergenic
1053797106 9:41736584-41736606 CACAAAAATCACTTGAACCCAGG - Intergenic
1054148091 9:61578284-61578306 CACAAAAATCACTTGAACCCAGG + Intergenic
1054185520 9:61948665-61948687 CACAAAAATCACTTGAACCCAGG - Intergenic
1054467831 9:65509378-65509400 CACAAAAATCACTTGAACCCAGG + Intergenic
1054652993 9:67639828-67639850 CACAAAAATCACTTGAACCCGGG + Intergenic
1054720438 9:68598231-68598253 CACAAAAATCACTTGAACCTGGG - Intergenic
1055375454 9:75645088-75645110 CACAAAAACAAATTGAAGGATGG + Intergenic
1055830283 9:80370275-80370297 CAGAAAAATCACTTGAACCAGGG - Intergenic
1056185393 9:84129582-84129604 CACAAAAGGAATGTGAAGCAAGG + Intergenic
1057378734 9:94548614-94548636 CTCAAAAAGAAATTAAAACAAGG - Intergenic
1058128871 9:101226983-101227005 CACCAAAAGAGGCTGAACCTTGG + Intronic
1058695534 9:107556021-107556043 CACAAGAATCATTTGAACCAGGG - Intergenic
1059662161 9:116412497-116412519 CACAAGAATAACTTGAACCAGGG + Intergenic
1060584122 9:124775546-124775568 CACAAAAATCACTTGAACCCAGG - Intergenic
1060704332 9:125784219-125784241 CACAAGAATCACTTGAACCAGGG - Intronic
1061567834 9:131455496-131455518 AAAAAAAAGAAGTTGAACCCAGG - Intronic
1061977959 9:134081793-134081815 CAAAAAATGAAGTTGAAGCTGGG + Intergenic
1186024908 X:5298799-5298821 CACAAGAATCAGTTGAACCCGGG + Intergenic
1186569782 X:10702333-10702355 CACAAAAACAAATTCAACCTAGG - Intronic
1187575963 X:20555637-20555659 CACAAGAAGAAATAGACCCATGG + Intergenic
1187724776 X:22191110-22191132 CACAAGAATAATTTGAACCTGGG - Intronic
1188008278 X:25033151-25033173 CACAAAAATTGCTTGAACCAGGG - Intergenic
1189282485 X:39828547-39828569 CACAAGAATCACTTGAACCAGGG + Intergenic
1189418925 X:40838502-40838524 CACAAGAATCACTTGAACCAGGG - Intergenic
1190966579 X:55306924-55306946 CACATAAAGAATTCGAAGCATGG - Intergenic
1192910874 X:75602628-75602650 CACAGAAAGCAGTTAAAGCAGGG - Intergenic
1192944614 X:75951750-75951772 CATAAAAAGAAGTAAAACAATGG - Intergenic
1193109018 X:77708567-77708589 CACAAAAATCATTTGAACCTGGG + Intronic
1194549008 X:95273416-95273438 CACAAGATGAAGTGGAAGCAAGG + Intergenic
1194993146 X:100566613-100566635 CACAAGAATCACTTGAACCAGGG + Intergenic
1195791873 X:108597091-108597113 AACAAAAAGAAGTAGAAGGAAGG + Intronic
1195879998 X:109583223-109583245 CATAAAAAGAAATTAAATCATGG + Intergenic
1196432365 X:115640454-115640476 GACAAAAGGAAGGTGAACCACGG + Exonic
1197330817 X:125152160-125152182 CACAAGAATATGTTGAACCCGGG + Intergenic
1197360374 X:125494434-125494456 CACAAACAGATCTTGAAACAAGG - Intergenic
1197728241 X:129790716-129790738 CACAGAAACAGGTTCAACCAGGG - Intronic
1198038368 X:132823756-132823778 CACAAAAATCACTTGAACCCAGG + Intronic
1198170160 X:134097443-134097465 CAGAAAAAGAAGTGCAACAATGG + Intergenic
1198748545 X:139915575-139915597 CACGAAAATAATTTGAACCCAGG + Intronic
1198982518 X:142415646-142415668 CAAAAGAAGAAATTAAACCAGGG + Intergenic
1199849780 X:151717221-151717243 CACCCATAGAAGTTGCACCAGGG - Intronic
1200094860 X:153652847-153652869 CACAAGAAGCACTTGAACCCAGG + Intergenic
1200642039 Y:5733116-5733138 CACAAAAAGAATTCAAAGCATGG - Intronic
1201926187 Y:19290486-19290508 CACAAAAGGAAATTGACCCTGGG + Intergenic
1201932444 Y:19366351-19366373 CATAAAAAGAAATTCAACAACGG + Intergenic
1202097140 Y:21263593-21263615 CACAAAAATCACTTGAACCCAGG - Intergenic