ID: 929994678

View in Genome Browser
Species Human (GRCh38)
Location 2:46817853-46817875
Sequence AATGCAGGACCTCCCAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929994675_929994678 10 Left 929994675 2:46817820-46817842 CCATGCAGTTGATGAGGGACAGA 0: 1
1: 0
2: 0
3: 14
4: 190
Right 929994678 2:46817853-46817875 AATGCAGGACCTCCCAAGAATGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929994678 Original CRISPR AATGCAGGACCTCCCAAGAA TGG Intronic
901605653 1:10457127-10457149 AATCCAGTCCCCCCCAAGAAAGG - Exonic
904620812 1:31773947-31773969 AATGCAGGACCACTTAAGAAGGG + Intergenic
906888131 1:49675170-49675192 CATGCAGGCCATCCCTAGAAGGG + Intronic
908059957 1:60336982-60337004 AATACAGGCCATCCCAGGAATGG - Intergenic
910115986 1:83732200-83732222 AATGCATGACCTCCTAATGAGGG - Intergenic
914815695 1:151060361-151060383 AATGCAGCCCCTCCTAAGAAGGG - Exonic
920049037 1:203152254-203152276 CATGCTGGACCCCCAAAGAAGGG - Intronic
923361433 1:233215574-233215596 AATGCAGGACATCCCAGTAAAGG - Intronic
924916684 1:248576999-248577021 ATTGCAGGACATAACAAGAAGGG + Intergenic
1064609726 10:17085709-17085731 GGTGCAGAACTTCCCAAGAAGGG + Exonic
1066203537 10:33164813-33164835 AATGCAGGAGCTTACAAGCAGGG + Intergenic
1068437347 10:57009676-57009698 AATACAGTATTTCCCAAGAAAGG - Intergenic
1069559752 10:69421066-69421088 GGTGCAGGAGCTCCCAAGAGGGG + Intergenic
1071334855 10:84592000-84592022 TATGGAGCACCTCCCAAGAGTGG - Intergenic
1071447375 10:85761423-85761445 AATGCAGCACCTGCATAGAAAGG - Intronic
1071983136 10:91023743-91023765 ACTGCAGAACCTCACAAGCAAGG + Intergenic
1072897457 10:99379038-99379060 AATGCAGACCTTCCCCAGAAGGG + Intronic
1077132202 11:978734-978756 AAGTCAGGAGCCCCCAAGAAAGG + Intronic
1078266200 11:9758003-9758025 ATTTCAGGACCTCCCAAGGAGGG - Intergenic
1084702624 11:70797221-70797243 AAAGCTGGTCTTCCCAAGAATGG - Intronic
1085412901 11:76302072-76302094 AATCCAGGACTTGCCAGGAAGGG + Intergenic
1090769129 11:129903858-129903880 AATGCATGAACCCCCAAAAATGG + Intronic
1091884985 12:4010267-4010289 AATGCGGTACCTCCTAAAAAAGG - Intergenic
1093021119 12:14205324-14205346 AATGAAGCACCTCCACAGAAGGG + Intergenic
1094176877 12:27550010-27550032 AATGCTGGACCTCAGAAAAATGG + Intronic
1097817834 12:64095299-64095321 AATGCAGTACATACAAAGAAAGG - Intronic
1098166567 12:67704586-67704608 AACTCAGGACCTGCCAAGGAAGG - Intergenic
1102974582 12:117197355-117197377 AGAGCAGGAACTCCCAAGCATGG - Intergenic
1104590015 12:130076634-130076656 AATGCAGGACATTCACAGAAAGG - Intergenic
1108897959 13:55359058-55359080 AATGGAGGGCCTCCAAAGCAAGG + Intergenic
1110867070 13:80407833-80407855 AAGGCTGTACCTCCCAGGAATGG - Intergenic
1111450092 13:88404147-88404169 AATGCAGGACCTCTGGAGAGGGG + Intergenic
1112643741 13:101306240-101306262 AATGCAGCACCTCTCAAGGGAGG - Intronic
1113346426 13:109482699-109482721 AGGGCAGGACCACCCAAGGATGG + Intergenic
1119990071 14:79186683-79186705 CAAGGATGACCTCCCAAGAAGGG + Intronic
1121400199 14:93669460-93669482 GATCCAGAACCTACCAAGAATGG + Intronic
1125426681 15:39555975-39555997 AATGCAGGACCGCTTGAGAAGGG + Intergenic
1127788711 15:62379250-62379272 AATGATGGACCTCCCTAGGACGG + Intergenic
1130413996 15:83672931-83672953 CATGCTGGACCTCCCAGGGACGG - Intronic
1130551782 15:84894044-84894066 AATCCAGGATCTTCGAAGAATGG - Intronic
1130580106 15:85129372-85129394 AATCAAAAACCTCCCAAGAAAGG - Intronic
1133391506 16:5414036-5414058 AAAGAAGGACATCCCCAGAATGG + Intergenic
1137580408 16:49630435-49630457 AATGAAGCACATCCCAGGAAGGG + Intronic
1139136988 16:64216432-64216454 CATGCAAGACCACCCCAGAAGGG - Intergenic
1146412174 17:32595955-32595977 AATCCTGGACCTGCCAAGAGGGG - Intronic
1149982901 17:61325453-61325475 AGTGCAGGTCTTCCCAGGAAAGG - Intronic
1152650665 17:81491130-81491152 AGCTCGGGACCTCCCAAGAAGGG + Intergenic
1155429079 18:25736951-25736973 AATGCAGTATCTCCTAAGGAAGG - Intergenic
1155766095 18:29634940-29634962 AATGAAAATCCTCCCAAGAAAGG - Intergenic
1157557963 18:48625201-48625223 AATGGTGGACCACCCATGAAAGG + Intronic
1167308993 19:48725601-48725623 AAAGCAGGCCCTTCCAGGAAGGG + Intronic
1167923895 19:52807832-52807854 AATGCAGAACCTCTAAACAAAGG + Intronic
926427562 2:12753226-12753248 AATGCAGGTTTTCCCAAGTAGGG + Intergenic
928976663 2:37094413-37094435 AATGCAGTACCTCTCAACCAGGG - Intronic
929994678 2:46817853-46817875 AATGCAGGACCTCCCAAGAATGG + Intronic
932322289 2:70831191-70831213 AATCCAGAACCTACCAAGAGCGG + Exonic
932950161 2:76283284-76283306 AATTCAAGACCTCCCTGGAATGG + Intergenic
934623990 2:95833273-95833295 AGTGAAGGACCTCCCAACTAGGG - Intergenic
935176911 2:100656722-100656744 ACTGCTTGACCTCCCAGGAATGG + Intergenic
937304969 2:120865540-120865562 GAGGCAGTACCACCCAAGAAGGG + Intronic
937500210 2:122470286-122470308 AATGCAGGACTCCCCACGCATGG - Intergenic
940854632 2:158720301-158720323 ATAGCAGAACATCCCAAGAAAGG - Intergenic
942455497 2:176135806-176135828 ACTGCAGAACCTCCCGGGAATGG + Intergenic
946334613 2:219028714-219028736 AATTCAGGCCCTCCCAAGGGAGG + Intronic
1170446077 20:16429272-16429294 ACTGGAGAACCTCCCCAGAAAGG - Intronic
1173319960 20:41978477-41978499 GATTCAGGAGCTCTCAAGAAGGG + Intergenic
1174338335 20:49880441-49880463 TATGAAGGACCTCCCATGCATGG - Intronic
1174644983 20:52078065-52078087 AAAGCAGGTCCTCCTAAGCAAGG + Intronic
1175715082 20:61249994-61250016 AAAGCAGTGCCTCCAAAGAATGG - Intergenic
1178480270 21:32974288-32974310 AAAGCAGCAGCTCCCCAGAAGGG - Intergenic
1178811513 21:35886642-35886664 AATGCAGCCCGTCCCAAGGAAGG + Intronic
1181374598 22:22446755-22446777 AATGCAGCAGCTGCCAAAAAGGG + Intergenic
1183963483 22:41427027-41427049 AAGGCAGGTCTTCCCGAGAAGGG - Intergenic
1184253727 22:43275515-43275537 AGTCCATGAGCTCCCAAGAAGGG - Intronic
1185004602 22:48268384-48268406 GCTGCAGGACATCCCAAGGAGGG + Intergenic
951069002 3:18303651-18303673 AAGGCAGGACCTCACAAAAATGG + Intronic
951354355 3:21645966-21645988 AATGCAGCAAATTCCAAGAATGG + Intronic
951475526 3:23101857-23101879 AATGCAGAACCTCACCAGATGGG + Intergenic
952663658 3:35879074-35879096 AAAGCAGGACTTGCCAATAAGGG + Intergenic
952751588 3:36829260-36829282 AATGCAGTGACTCCCAAGGATGG - Intronic
953643566 3:44731678-44731700 AATGCAGGACCACACAGAAATGG + Intronic
955827270 3:62961731-62961753 AATGCAGGCACTCCTGAGAAAGG + Intergenic
955905633 3:63804649-63804671 AATGCAGTAACAGCCAAGAAAGG - Intergenic
956259189 3:67318534-67318556 AATACATGACCTATCAAGAAGGG + Intergenic
956652698 3:71519899-71519921 AATGCAGTCCCTCCCATAAAGGG + Intronic
958185064 3:90110023-90110045 AATGCAGTTCCTCCCAGCAACGG - Intergenic
960003898 3:112762368-112762390 AATGGAGGTGCTCACAAGAAAGG + Intronic
960620072 3:119628820-119628842 AGTGCAGAACTTCCCAATAATGG - Exonic
962687992 3:137865921-137865943 ATTGCAGGTCCCCCCAAGCATGG + Intergenic
967873302 3:194249808-194249830 CAGGCAGGACCTCCCAGCAAAGG + Intergenic
970825416 4:20267051-20267073 AATGGAGGTCCTTCCAAGAGTGG + Intronic
975384440 4:73739369-73739391 AATCCAAGACCTTTCAAGAAAGG + Intergenic
976821537 4:89212716-89212738 GATGTGGGACTTCCCAAGAAAGG + Intergenic
977096624 4:92753703-92753725 AAACCAGGACCTCTAAAGAAGGG + Intronic
987026863 5:13936060-13936082 AATGTACTACCTCACAAGAAAGG + Intronic
987636985 5:20555947-20555969 TATGCAGGATTTCCAAAGAAGGG - Intronic
992215060 5:74517827-74517849 AACTCATGACCTCCCAAGGATGG + Intergenic
998325038 5:141272696-141272718 AATGCAGGATGCCCCAGGAAGGG - Intergenic
998355328 5:141530586-141530608 GTTGGAGGACCTGCCAAGAAGGG - Intronic
998657915 5:144202997-144203019 AAGGCAGAACCTCTCAGGAAAGG - Intronic
1002470478 5:179432207-179432229 AATTCAGGAAATTCCAAGAAGGG - Intergenic
1003462580 6:6344631-6344653 AATGCAGAACCTCCACAGAAAGG + Intergenic
1005360212 6:25024188-25024210 AATGCAGGGCCTGGCGAGAAAGG + Intronic
1005986107 6:30876359-30876381 AATGCAGGTACTCACAAGCAGGG + Intergenic
1006237990 6:32652476-32652498 AATGCAGGACCTCACTGAAAAGG + Intergenic
1010356776 6:74943977-74943999 TATGCAAACCCTCCCAAGAAAGG + Intergenic
1010784979 6:79990671-79990693 AATTTAGGACCTCTCAAAAAGGG + Intergenic
1016055955 6:139578143-139578165 AATGCGTGACCTTCCAAGTAAGG + Intergenic
1018042114 6:159933905-159933927 AATGCAGTATCACCCAAGAAAGG - Intergenic
1018970668 6:168526461-168526483 GGTGCAGAACCTCCCAAGCAAGG - Intronic
1024052957 7:45640909-45640931 TATGCAGGACCCCACAAGCATGG - Intronic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1026332370 7:69363916-69363938 AATGCATGACATTCCAAAAAGGG - Intergenic
1028100456 7:86813802-86813824 AATTTAAGACCTCCCAAGAGAGG + Intronic
1035481695 7:159192079-159192101 AAAGCTGCAGCTCCCAAGAAGGG - Intergenic
1037472950 8:19228753-19228775 AATGCAGCAGCTCCCAGGCAGGG + Intergenic
1044432368 8:92123487-92123509 AATCCAGGACCTACCAAGGGTGG - Intergenic
1048893270 8:138966486-138966508 AATGCAAGACCTCCAGACAATGG - Intergenic
1050167782 9:2784103-2784125 TATACAGGACATACCAAGAAAGG + Intronic
1052417762 9:28200178-28200200 AATGCAGTTCCTGCCAATAAGGG + Intronic
1055626037 9:78178533-78178555 AATGCAGGGCCTGGCAAGAGAGG - Intergenic
1057443075 9:95096010-95096032 AATGCAGCATCTCCCCAGAGTGG + Intergenic
1057495630 9:95558634-95558656 AATGCATGCCCTCTCAAGAAAGG - Intergenic
1058947341 9:109870062-109870084 AATTCAGGACCTCCCAAAGCTGG - Intronic
1186216611 X:7307594-7307616 AAGGCAGGACATCCCAAAGAAGG + Intronic
1187161776 X:16772080-16772102 AATGCCGTAGCTCCCAAGCATGG + Intergenic
1188793808 X:34437882-34437904 TGTGCAGGACCTCCCAACCAGGG + Intergenic
1191019337 X:55842723-55842745 TGGGCAGGACCTCCCAACAAGGG - Intergenic
1193022014 X:76801333-76801355 ACTGCAGGTCCTCCCCACAAGGG - Intergenic
1193295792 X:79829950-79829972 AGGGCAGGACCTCCCAACCAGGG - Intergenic
1196780685 X:119381430-119381452 GTTGCAGGACCTTCCAAGACTGG + Intergenic
1196796241 X:119503954-119503976 AATCCAGGAGCTCCCATCAAAGG + Intergenic
1201586775 Y:15569779-15569801 AAGGCAGGACATCCCAAAGAAGG + Intergenic