ID: 929996541

View in Genome Browser
Species Human (GRCh38)
Location 2:46829547-46829569
Sequence CCTAGGACGTGAGACAGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929996541_929996545 12 Left 929996541 2:46829547-46829569 CCGTCACTGTCTCACGTCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 929996545 2:46829582-46829604 CCTTGTCTGTGCCCCACCAAAGG 0: 1
1: 0
2: 0
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929996541 Original CRISPR CCTAGGACGTGAGACAGTGA CGG (reversed) Intronic
901638676 1:10682245-10682267 AACAGGAGGTGAGACAGTGAAGG + Intronic
904319409 1:29686845-29686867 CCCAGGTTGTGAGACAGTCACGG + Intergenic
904319419 1:29686890-29686912 CCCAGGTTGTGAGACAGTCACGG + Intergenic
905124995 1:35709936-35709958 CTTAGTCCGTGGGACAGTGAGGG - Intergenic
913664149 1:121032042-121032064 CCTAGGAGTTCAGACAGTGAGGG + Intergenic
914015541 1:143815321-143815343 CCTAGGAGTTCAGACAGTGAGGG + Intergenic
914162242 1:145145687-145145709 CCTAGGAGTTCAGACAGTGAGGG - Intergenic
914654160 1:149723862-149723884 CCTAGGAGTTCAGACAGTGAGGG + Intergenic
917566626 1:176218805-176218827 CCCAGGACATGAGATAGTGCGGG - Intergenic
923689158 1:236176161-236176183 CCTGTGACATGAGAGAGTGAGGG + Intronic
1062825400 10:564407-564429 CTTTGGACGTCAGGCAGTGAAGG - Intronic
1067779673 10:49190585-49190607 CCTAGCACCTGACACAGTGCAGG + Intergenic
1073293226 10:102423642-102423664 CCAAGGAGGTGAGAGAGTTAAGG - Exonic
1074846456 10:117403148-117403170 GCCAGGAAGTGAGACAGTAAGGG - Intergenic
1079217087 11:18523452-18523474 CCTAGAACCTAAAACAGTGAGGG + Intronic
1083399773 11:62415462-62415484 GCTAGGAGGAGAGACAGAGATGG - Intronic
1084950435 11:72662355-72662377 CCTGGGAGGCGAGTCAGTGAGGG - Intronic
1089844498 11:121447811-121447833 CCTAGGAAGGGAGACAGTGCTGG + Intergenic
1095864535 12:46957010-46957032 CCATGGAGGTGAGACAGGGATGG + Intergenic
1096124419 12:49109282-49109304 CCCAGGCCTTGAGACAGTGTCGG - Intronic
1097011501 12:55956473-55956495 CCTAGGACCTGACATAGTGTGGG - Intronic
1098340714 12:69448148-69448170 CCTAGGAGCTGAGGCTGTGATGG + Intergenic
1099942550 12:89206034-89206056 CAAGGGAAGTGAGACAGTGAAGG + Intergenic
1100730354 12:97460335-97460357 CCTAGCACATGAAACAGTTATGG + Intergenic
1102057160 12:109905312-109905334 GCTAGGATGTCAGATAGTGAGGG + Intronic
1103723258 12:122985854-122985876 CCGAGGACGTGAGGCAGGGCAGG + Exonic
1104196126 12:126540138-126540160 CCCAGGACGTGGAGCAGTGAGGG - Intergenic
1104548714 12:129735975-129735997 CCTAGGACAGGAGACAGTGGAGG - Intronic
1104793620 12:131500244-131500266 GCCAGGATGTGAGCCAGTGAGGG + Intergenic
1108918145 13:55641837-55641859 CCTAGGACATGGGTCGGTGAGGG - Intergenic
1110138473 13:72098709-72098731 ATTAGGACGTGAGATGGTGATGG - Intergenic
1113414616 13:110118393-110118415 CCTGGGACGGGAGGCAGTCAAGG - Intergenic
1113464028 13:110501548-110501570 CCTAGCGAGCGAGACAGTGATGG - Intronic
1114651303 14:24286313-24286335 CCTGGGATGTGATGCAGTGAAGG - Intergenic
1117866281 14:60152855-60152877 CCAAGGACCTCACACAGTGATGG + Intronic
1119037987 14:71246686-71246708 CCAAGGATGGGAGACAGTAATGG - Intergenic
1119569470 14:75657548-75657570 CAGAGGACATGAGACAATGAGGG + Intronic
1122167269 14:99837243-99837265 TCCAGGATGTGAGACAGGGAGGG - Intronic
1124517167 15:30376486-30376508 CCTTGGAGGTGAGACACTGTTGG + Intronic
1124725777 15:32154508-32154530 CCTTGGAGGTGAGACACTGTTGG - Intronic
1125202145 15:37109703-37109725 CTTGGGATGTGAGAAAGTGATGG - Intergenic
1129333031 15:74837496-74837518 CCGAGCAAGTGAGAGAGTGAAGG + Intronic
1129333037 15:74837545-74837567 CCGAGCAAGTGAGAGAGTGAAGG + Intronic
1129826187 15:78636584-78636606 AACAGGAAGTGAGACAGTGAAGG - Intronic
1132267082 15:100483729-100483751 CCAATGATGTGAGACAGTCAGGG - Intronic
1132464287 16:70672-70694 CCTGGGACCTTAGGCAGTGATGG - Intronic
1132566432 16:625625-625647 CGTAGGCCGTGGGACAGTGCAGG - Intronic
1135796892 16:25453940-25453962 CCTTGGTTCTGAGACAGTGAAGG + Intergenic
1135854953 16:26000673-26000695 CCTGGGAGGTCAGACAGTCAAGG + Intronic
1136395858 16:29992051-29992073 CACAGGACGTCAGACAGTTACGG - Intronic
1136543805 16:30944078-30944100 CCTGGGAGGTGAGAAAGTGCTGG + Intronic
1140023584 16:71262759-71262781 CCCAGGACCTGAGGCAGTGCCGG + Intergenic
1140473411 16:75227069-75227091 CCTGGGAAGTGAGCCAGTCAGGG - Intergenic
1141391111 16:83664803-83664825 CCTTGGATGTATGACAGTGAAGG + Intronic
1148675996 17:49445461-49445483 CCCAGGAAGTGGGACAGTTATGG - Intronic
1150180300 17:63112205-63112227 CCTAGGACCTGAGATGGAGAAGG + Intronic
1151322195 17:73358899-73358921 CCTGGGATGTGGGCCAGTGAGGG + Intronic
1160848058 19:1175246-1175268 CCTGTGACTTGAGCCAGTGAAGG + Intergenic
1163236630 19:16033911-16033933 CCTAGTCAGTGAGTCAGTGAGGG + Intergenic
1163495994 19:17646945-17646967 GCAAGGACTTGAGACAGGGATGG - Intronic
1168191814 19:54744100-54744122 CATAGGACATGAGACAGATATGG - Intronic
925618537 2:5767568-5767590 CATAAGAAGTGAGACAGAGAAGG - Intergenic
926253414 2:11169306-11169328 CCCAGGACCTGTGACAGTGCTGG - Intronic
929996541 2:46829547-46829569 CCTAGGACGTGAGACAGTGACGG - Intronic
930611328 2:53547330-53547352 GCTAGGACTTGAGGCAGTGAGGG - Intronic
931123518 2:59247904-59247926 CCTAGTAAGTGAGACACAGAGGG + Intergenic
933643088 2:84785224-84785246 CCCATGACGTGGGACAGGGAGGG - Intronic
933996620 2:87674685-87674707 CCTATGATGTGAGCTAGTGAAGG + Intergenic
935142892 2:100369826-100369848 ACTTGGTTGTGAGACAGTGAAGG + Intergenic
935305119 2:101730087-101730109 CCTAGGACGGGGGAAAGTAAAGG + Intronic
936297231 2:111276225-111276247 CCTATGATGTGAGCTAGTGAAGG - Intergenic
937258889 2:120572973-120572995 CCTAGCAGGTGAGTCTGTGATGG + Intergenic
947394085 2:229670273-229670295 CCTGGGAGGAGACACAGTGAGGG - Intronic
947470022 2:230392806-230392828 GCTAGCAGGGGAGACAGTGAAGG - Intronic
948657758 2:239487183-239487205 CCTAGGGCGGGAGCCAGCGAAGG + Intergenic
1172691906 20:36796036-36796058 ACTTGGAAGTGAGACAGGGAAGG - Intronic
1172762301 20:37331397-37331419 GCTAGGACAGGAGTCAGTGAGGG - Intergenic
1173297798 20:41774792-41774814 ACTGGGAAGTGAGACAGGGAAGG + Intergenic
1173467590 20:43295654-43295676 CTTAGAGCCTGAGACAGTGAGGG - Intergenic
1175074816 20:56363337-56363359 CCTGGGTCATGAGGCAGTGAGGG + Intronic
1176367315 21:6041036-6041058 CCTAGGACTACAGACAGAGATGG + Intergenic
1179756204 21:43497510-43497532 CCTAGGACTACAGACAGAGATGG - Intergenic
1181998839 22:26903792-26903814 CCTATGATGAGAGACAGTGTGGG - Intergenic
1182783026 22:32882960-32882982 GCTAGGATGTGACACAGTCAGGG - Intronic
950737303 3:15020253-15020275 CCCAGGACGTGAATCAGAGAGGG + Intronic
951258043 3:20473895-20473917 CCCAGGATTTGAGACAGTAAAGG - Intergenic
956851169 3:73229550-73229572 CCTAGGAAGTGGGAAAGTGGTGG - Intergenic
958060011 3:88467336-88467358 TACAGGACGTGAGAGAGTGAGGG - Intergenic
960420891 3:117444253-117444275 CCCAGGACTTGTGACAGGGATGG + Intergenic
962494487 3:135925418-135925440 CTCAGTAGGTGAGACAGTGAAGG - Intergenic
962829644 3:139128812-139128834 CAAAGGACATGAGACAGGGAGGG + Intronic
964174039 3:153804034-153804056 CCTAGGAAGTTTGAAAGTGATGG - Intergenic
969969199 4:11028495-11028517 ACCAGGAGGTGAGAGAGTGAGGG - Intergenic
970603258 4:17656818-17656840 CCGAGGACAGGAGACAGAGAGGG - Intronic
971231956 4:24807289-24807311 CCAAGGACATGATACAGGGATGG - Exonic
974635041 4:64552980-64553002 TCTAGGAAGAGAGACAGTAATGG + Intergenic
976074204 4:81278302-81278324 CCTAGGCCTTGATACAGGGAAGG - Intergenic
976887641 4:90005670-90005692 CACAGTATGTGAGACAGTGATGG + Intergenic
978755429 4:112296622-112296644 CCTAGAAACTGAGAGAGTGAAGG - Intronic
980009384 4:127579356-127579378 CCTGGGAAATGAGTCAGTGAAGG + Intergenic
984647852 4:182238591-182238613 CTTAGGACCTGGGGCAGTGACGG + Intronic
985657856 5:1141328-1141350 CCTAGCACTTGAGAATGTGATGG - Intergenic
986625221 5:9717290-9717312 CCTTGGAGATGAGACAGAGACGG + Intergenic
989197716 5:38731886-38731908 CCTAGGGCTCTAGACAGTGAAGG + Intergenic
991019686 5:61967168-61967190 CCTGGGGTGTGAGACACTGAGGG + Intergenic
991212801 5:64125863-64125885 TCTAAGACTTGAGACATTGATGG + Intergenic
992198558 5:74363062-74363084 CCTGGGAAGTGAGGCACTGATGG - Intergenic
993254954 5:85578796-85578818 CCCACGAGGTGACACAGTGAAGG - Intergenic
997389134 5:133499211-133499233 CCCAGGACATTAGACAGGGATGG - Intronic
1000256377 5:159542383-159542405 CAAAGGACATGAGACAATGAGGG - Intergenic
1003734319 6:8860741-8860763 CCTAGAATGTGAGTCAGAGAAGG + Intergenic
1006781509 6:36635631-36635653 TCCAGGACTTGAGGCAGTGAGGG - Intergenic
1007100228 6:39240885-39240907 CCTAGGATGTGAGTCTGTCAGGG - Intergenic
1007192760 6:40033541-40033563 CATAGGAAGTGATACAGAGAAGG + Intergenic
1007708681 6:43807085-43807107 GCTGGGAGGTGAGACAGAGATGG - Intergenic
1010789006 6:80042822-80042844 CCTAGCAAGTCATACAGTGAGGG - Intergenic
1013147033 6:107403831-107403853 CCTAGGCCATGGGACTGTGATGG + Intronic
1020195879 7:6038671-6038693 CCTAGGAGAGGACACAGTGATGG + Exonic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1022514951 7:30969545-30969567 CCTAGGTGCTGGGACAGTGAGGG + Intronic
1027793790 7:82666245-82666267 CATAGGAAATGAGACAGTGGAGG + Intergenic
1028341481 7:89725913-89725935 CCCATGACATGACACAGTGAAGG - Intergenic
1029443258 7:100599890-100599912 CCTGGGGCGTGGGACAGTGCTGG + Intronic
1030768671 7:113444270-113444292 CCTCTGAAGTAAGACAGTGAAGG + Intergenic
1030900577 7:115118535-115118557 CATAGGACATCAGACAGTCAAGG - Intergenic
1034564036 7:151899370-151899392 ACAAGCACGTGAGCCAGTGATGG - Intergenic
1039465673 8:37783664-37783686 CCTAGTACATGAGGCACTGAGGG + Intergenic
1039807199 8:41010602-41010624 CTTGGGACGTGAGGCAGTGATGG - Intergenic
1047853927 8:128889422-128889444 CCAAGTACATGCGACAGTGAAGG + Intergenic
1050016458 9:1239079-1239101 CCTAGGATGTGAGATAGGAAAGG - Intergenic
1051808710 9:21026308-21026330 CCCAGGCAGTGACACAGTGAGGG + Intronic
1052530810 9:29682171-29682193 CCTAGGCCCTTGGACAGTGATGG - Intergenic
1055008238 9:71534099-71534121 CCTAGGGTGTGAGGCAGTTATGG - Intergenic
1056568233 9:87793676-87793698 CCTATAACGTGGGGCAGTGATGG + Intergenic
1057710618 9:97439592-97439614 CCTAAGAGGTGAGAGAGTAAGGG - Intronic
1187555018 X:20343371-20343393 AGTAGGAAGTGAGACAGGGAAGG + Intergenic
1189097704 X:38157720-38157742 GTCAGGAAGTGAGACAGTGAAGG + Intronic
1191883180 X:65862853-65862875 CCTAGGAGAAGAGACAGTGAAGG - Intergenic
1199334964 X:146608004-146608026 CCTAGATCGTGATACATTGAAGG + Intergenic